Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP008775 Brucella abortus strain BAB8416 chromosome 2, complete sequence 1 crisprs csa3,cas3,DEDDh 0 0 96 0
NZ_CP008774 Brucella abortus strain BAB8416 chromosome 1, complete sequence 1 crisprs csa3,WYL,DEDDh 0 1 2 0

Results visualization

1. NZ_CP008774
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008774_1 1787176-1787264 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP008774_1 1.1|1787202|37|NZ_CP008774|CRISPRCasFinder 1787202-1787238 37 NZ_CP020810 Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence 75259-75295 8 0.784

1. spacer 1.1|1787202|37|NZ_CP008774|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

gtcgatccgaccgctgttccggccaatggcagtcttg	CRISPR spacer
atcgatccgaccgctgttcctgccgatggcgaacccg	Protospacer
.******************* ***.*****.. *..*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 540115 : 642880 97 Hokovirus(10.0%) protease,transposase,portal,integrase,tail,holin,capsid,head attL 635454:635468|attR 645491:645505
DBSCAN-SWA_2 866988 : 878900 13 uncultured_Mediterranean_phage(90.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP008775
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008775_1 180964-181064 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 13522 12 Staphylococcus_phage(33.33%) protease NA
DBSCAN-SWA_2 24164 : 29977 6 Pithovirus(20.0%) NA NA
DBSCAN-SWA_3 33021 : 37227 4 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_4 44259 : 44730 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_5 69153 : 81504 11 Bacillus_phage(20.0%) NA NA
DBSCAN-SWA_6 86458 : 90927 5 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_7 97345 : 98479 1 Bovine_gammaherpesvirus(100.0%) NA NA
DBSCAN-SWA_8 108144 : 110711 2 Cyanophage(50.0%) NA NA
DBSCAN-SWA_9 129479 : 130460 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_10 136140 : 140611 5 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_11 169477 : 175705 6 Tupanvirus(66.67%) tRNA NA
DBSCAN-SWA_12 181045 : 195087 11 uncultured_virus(33.33%) tRNA NA
DBSCAN-SWA_13 201578 : 201830 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_14 205349 : 207221 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_15 223172 : 224348 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_16 233838 : 234651 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_17 243436 : 244357 1 Microcystis_phage(100.0%) NA NA
DBSCAN-SWA_18 248087 : 248915 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_19 254201 : 256052 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_20 262298 : 263294 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_21 266599 : 267040 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_22 270259 : 273444 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_23 280665 : 284400 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_24 292696 : 293698 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_25 296800 : 302758 5 Mycobacterium_phage(40.0%) NA NA
DBSCAN-SWA_26 307924 : 308992 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_27 326640 : 338755 9 Burkholderia_virus(20.0%) NA NA
DBSCAN-SWA_28 342663 : 344226 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_29 357527 : 371429 12 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_30 390894 : 391782 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_31 395480 : 400269 5 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_32 411063 : 411831 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_33 417938 : 418655 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_34 424861 : 425749 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_35 430463 : 431600 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_36 443793 : 447209 2 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_37 456842 : 457844 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_38 462038 : 467326 4 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_39 471078 : 472689 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_40 479786 : 485066 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_41 490359 : 492798 3 Stx2-converting_phage(66.67%) transposase NA
DBSCAN-SWA_42 502460 : 504023 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_43 518570 : 521862 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_44 531786 : 533886 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_45 539327 : 563136 21 Bacillus_phage(18.18%) NA NA
DBSCAN-SWA_46 579371 : 580175 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_47 586349 : 587812 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_48 594204 : 599318 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_49 603904 : 605560 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_50 609145 : 611806 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_51 618123 : 624632 5 Planktothrix_phage(66.67%) NA NA
DBSCAN-SWA_52 634160 : 641473 5 Mycoplasma_phage(33.33%) NA NA
DBSCAN-SWA_53 648996 : 654453 5 Ostreococcus_tauri_virus(50.0%) NA NA
DBSCAN-SWA_54 663435 : 666234 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_55 678502 : 679498 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_56 682542 : 684373 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_57 687565 : 690669 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_58 699500 : 701036 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_59 712226 : 720105 7 Planktothrix_phage(40.0%) NA NA
DBSCAN-SWA_60 728434 : 729091 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_61 737862 : 739448 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_62 746889 : 750860 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_63 772817 : 773375 1 Geobacillus_phage(100.0%) NA NA
DBSCAN-SWA_64 777289 : 782995 3 Liberibacter_phage(100.0%) NA NA
DBSCAN-SWA_65 794774 : 796319 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_66 805970 : 814006 5 Klosneuvirus(25.0%) NA NA
DBSCAN-SWA_67 819779 : 830712 12 Klosneuvirus(40.0%) tRNA NA
DBSCAN-SWA_68 836783 : 837716 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_69 841063 : 845022 4 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_70 860621 : 861950 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_71 865512 : 867048 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_72 872473 : 874063 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_73 885842 : 890025 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_74 893328 : 906650 15 Bacillus_virus(16.67%) holin NA
DBSCAN-SWA_75 914526 : 917939 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_76 930835 : 932368 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_77 941505 : 948459 8 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_78 951864 : 952623 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_79 963879 : 964719 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_80 970475 : 975309 5 Caulobacter_phage(50.0%) NA NA
DBSCAN-SWA_81 983253 : 985083 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_82 996224 : 1000652 3 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_83 1004449 : 1005654 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_84 1009576 : 1011611 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_85 1029348 : 1031348 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_86 1035782 : 1037749 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_87 1042845 : 1043922 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_88 1048234 : 1052704 6 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_89 1063434 : 1064331 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_90 1099611 : 1101147 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_91 1114354 : 1115713 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_92 1125715 : 1128129 2 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_93 1133088 : 1134267 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_94 1137987 : 1138770 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_95 1147504 : 1148964 2 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_96 1153465 : 1154659 1 Ochrobactrum_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage