Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP011580 Enterobacter hormaechei strain CAV1411 plasmid pKPC_CAV1411, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP011579 Enterobacter hormaechei strain CAV1411 plasmid pCAV1411-34, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP011581 Enterobacter hormaechei strain CAV1411 chromosome, complete genome 2 crisprs cas3,csa3,PD-DExK,WYL,DinG,DEDDh 0 2 9 0

Results visualization

1. NZ_CP011580
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 43328 38 Escherichia_phage(25.0%) transposase,integrase attL 17972:17987|attR 43871:43886
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP011581
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011581_1 3121966-3122127 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011581_2 3742781-3742869 Orphan I-F
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP011581_2 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder 3742810-3742840 31 JF974302 Vibrio phage VBpm10, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces 21037-21067 6 0.806
NZ_CP011581_2 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder 3742810-3742840 31 MG592513 Vibrio phage 1.142.O._10N.261.49.E11, partial genome 26631-26661 7 0.774
NZ_CP011581_2 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder 3742810-3742840 31 MG592412 Vibrio phage 1.028.O._10N.286.45.B6, partial genome 26631-26661 7 0.774
NZ_CP011581_2 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder 3742810-3742840 31 MG592527 Vibrio phage 1.159.O._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP011581_2 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder 3742810-3742840 31 MG592588 Vibrio phage 1.217.O._10N.261.45.A1, partial genome 26631-26661 7 0.774
NZ_CP011581_2 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder 3742810-3742840 31 MG592589 Vibrio phage 1.219.O._10N.261.45.E2, partial genome 26631-26661 7 0.774
NZ_CP011581_2 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder 3742810-3742840 31 MG592524 Vibrio phage 1.156.O._10N.261.45.A6, partial genome 26631-26661 7 0.774
NZ_CP011581_2 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder 3742810-3742840 31 MG592669 Vibrio phage 2.159.A._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP011581_2 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder 3742810-3742840 31 MG592670 Vibrio phage 2.159.B._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP011581_2 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder 3742810-3742840 31 MG592507 Vibrio phage 1.136.O._10N.261.45.E11, partial genome 26631-26661 7 0.774
NZ_CP011581_2 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder 3742810-3742840 31 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1534665-1534695 7 0.774
NZ_CP011581_2 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder 3742810-3742840 31 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 62534-62564 8 0.742
NZ_CP011581_2 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder 3742810-3742840 31 NZ_CP035511 Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence 283146-283176 8 0.742
NZ_CP011581_2 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder 3742810-3742840 31 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 22328-22358 9 0.71
NZ_CP011581_2 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder 3742810-3742840 31 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 475099-475129 9 0.71
NZ_CP011581_2 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder 3742810-3742840 31 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 714186-714216 10 0.677
NZ_CP011581_1 1.1|3122018|58|NZ_CP011581|CRISPRCasFinder 3122018-3122075 58 NZ_LN868946 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence 15954-16011 12 0.793

1. spacer 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder matches to JF974302 (Vibrio phage VBpm10, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces) position: , mismatch: 6, identity: 0.806

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
acaatgctctggcgcgtttcagtgtcgccgt	Protospacer
* **..* ********* **.**********

2. spacer 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder matches to MG592513 (Vibrio phage 1.142.O._10N.261.49.E11, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

3. spacer 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder matches to MG592412 (Vibrio phage 1.028.O._10N.286.45.B6, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

4. spacer 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder matches to MG592527 (Vibrio phage 1.159.O._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

5. spacer 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder matches to MG592588 (Vibrio phage 1.217.O._10N.261.45.A1, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

6. spacer 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder matches to MG592589 (Vibrio phage 1.219.O._10N.261.45.E2, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

7. spacer 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder matches to MG592524 (Vibrio phage 1.156.O._10N.261.45.A6, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

8. spacer 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder matches to MG592669 (Vibrio phage 2.159.A._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

9. spacer 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder matches to MG592670 (Vibrio phage 2.159.B._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

10. spacer 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder matches to MG592507 (Vibrio phage 1.136.O._10N.261.45.E11, partial genome) position: , mismatch: 7, identity: 0.774

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
actatgctctggcgcgtttcagtgtcgccgt	Protospacer
*  *..* ********* **.**********

11. spacer 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

aaaacacg----ctggcgcgtgtcggtgtcgccgt	CRISPR spacer
----cccggcacctggcgcgtgacggtctcgccgt	Protospacer
    * **    ********** **** *******

12. spacer 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 8, identity: 0.742

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
tgagatcgcgggcgagtgtcggtgtcgccgc	Protospacer
 .*.  *** **** ***************.

13. spacer 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 8, identity: 0.742

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
tagaactgctggcgcgtgtcggcatcgccga	Protospacer
 *.*  .***************..****** 

14. spacer 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.71

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
atcctgggctgccgcgtgtcgatgtcgccgg	Protospacer
*   .. **** *********.******** 

15. spacer 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 9, identity: 0.71

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
atcctgggctgccgggtgtcggtgtcgccgg	Protospacer
*   .. **** ** *************** 

16. spacer 2.1|3742810|31|NZ_CP011581|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.677

aaaacacgctggcgcgtgtcggtgtcgccgt	CRISPR spacer
ctgcggcgctggcgcgggtcggagtcgcccc	Protospacer
  .  .********** ***** ****** .

17. spacer 1.1|3122018|58|NZ_CP011581|CRISPRCasFinder matches to NZ_LN868946 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence) position: , mismatch: 12, identity: 0.793

gaaacgataaaaagccgggtggcggctacgccttacccggcctacatgttctacatat	CRISPR spacer
tcgcaaataaaaagccgggtggcggctacgccttacccggcctacatcgtctgcttga	Protospacer
  .  .*****************************************  ***.* *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 110985 : 155045 55 Enterobacteria_phage(28.26%) portal,protease,terminase,tail,integrase,tRNA attL 105528:105543|attR 163444:163459
DBSCAN-SWA_2 1279523 : 1321903 49 Erwinia_phage(38.1%) portal,lysis,terminase,head,capsid,tail,integrase,plate,tRNA attL 1274048:1274067|attR 1328921:1328940
DBSCAN-SWA_3 1379841 : 1416349 25 Stx2-converting_phage(20.0%) integrase,transposase attL 1368833:1368847|attR 1381785:1381799
DBSCAN-SWA_4 1794761 : 1826215 26 Salmonella_phage(16.67%) integrase,transposase,protease attL 1791853:1791872|attR 1832104:1832123
DBSCAN-SWA_5 1873399 : 1897889 30 Enterobacteria_phage(40.0%) integrase,transposase attL 1861728:1861743|attR 1888494:1888509
DBSCAN-SWA_6 2361636 : 2372449 9 Hokovirus(12.5%) NA NA
DBSCAN-SWA_7 2472336 : 2552382 91 Enterobacteria_phage(14.29%) portal,protease,terminase,holin,tail,coat,integrase,plate attL 2466052:2466067|attR 2485276:2485291
DBSCAN-SWA_8 3442436 : 3500978 77 Enterobacterial_phage(33.33%) portal,protease,head,terminase,capsid,tail,holin,integrase,tRNA attL 3462553:3462568|attR 3498205:3498220
DBSCAN-SWA_9 4722762 : 4728882 9 Enterobacteria_phage(75.0%) integrase,transposase attL 4716937:4716950|attR 4733116:4733129
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage