Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP011331 Escherichia coli O104:H4 str. C227-11 isolate 368 shch chromosome, complete genome 8 crisprs RT,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,DEDDh,c2c9_V-U4,DinG,PrimPol 0 17 13 0
NZ_CP011338 Escherichia coli O104:H4 str. C227-11 isolate 368 shch plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP011332 Escherichia coli O104:H4 str. C227-11 isolate 368 shch plasmid unnamed, complete sequence 0 crisprs NA 0 0 3 0
NZ_CP011334 Escherichia coli O104:H4 str. C227-11 isolate 368 shch plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP011337 Escherichia coli O104:H4 str. C227-11 isolate 368 shch plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP011336 Escherichia coli O104:H4 str. C227-11 isolate 368 shch plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP011335 Escherichia coli O104:H4 str. C227-11 isolate 368 shch plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP011333 Escherichia coli O104:H4 str. C227-11 isolate 368 shch plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP011331
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011331_1 468555-469376 Orphan I-E
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011331_2 496425-496514 TypeI-E I-E
1 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011331_3 1750719-1750842 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011331_4 2563753-2563844 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011331_5 2923283-2923396 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011331_6 2933079-2933223 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011331_7 3172375-3172471 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011331_8 3713569-3713701 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP011331_4 4.1|2563779|40|NZ_CP011331|CRISPRCasFinder 2563779-2563818 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP011331_5 5.2|2923353|25|NZ_CP011331|PILER-CR 2923353-2923377 25 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37604-37628 0 1.0
NZ_CP011331_5 5.2|2923353|25|NZ_CP011331|PILER-CR 2923353-2923377 25 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37887-37911 0 1.0
NZ_CP011331_8 8.1|3713586|42|NZ_CP011331|PILER-CR 3713586-3713627 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
NZ_CP011331_8 8.2|3713645|40|NZ_CP011331|PILER-CR 3713645-3713684 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 0 1.0
NZ_CP011331_5 5.1|2923306|24|NZ_CP011331|PILER-CR 2923306-2923329 24 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37652-37675 1 0.958
NZ_CP011331_5 5.1|2923306|24|NZ_CP011331|PILER-CR 2923306-2923329 24 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37935-37958 1 0.958
NZ_CP011331_5 5.2|2923353|25|NZ_CP011331|PILER-CR 2923353-2923377 25 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44524-44548 1 0.96
NZ_CP011331_3 3.1|1750762|38|NZ_CP011331|CRISPRCasFinder 1750762-1750799 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP011331_5 5.1|2923306|24|NZ_CP011331|PILER-CR 2923306-2923329 24 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44572-44595 2 0.917
NZ_CP011331_5 5.2|2923353|25|NZ_CP011331|PILER-CR 2923353-2923377 25 NZ_CP015341 Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence 35661-35685 4 0.84
NZ_CP011331_1 1.2|468644|33|NZ_CP011331|PILER-CR 468644-468676 33 NZ_CP038598 Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.3, complete sequence 2051-2083 7 0.788
NZ_CP011331_1 1.2|468644|33|NZ_CP011331|PILER-CR 468644-468676 33 NZ_CP033827 Klebsiella sp. FDAARGOS_511 plasmid unnamed4, complete sequence 692-724 7 0.788
NZ_CP011331_1 1.2|468644|33|NZ_CP011331|PILER-CR 468644-468676 33 NZ_CP029125 Enterobacter hormaechei strain AR432 plasmid unnamed2, complete sequence 518-550 7 0.788
NZ_CP011331_1 1.2|468644|33|NZ_CP011331|PILER-CR 468644-468676 33 NZ_AP019693 Salmonella enterica subsp. enterica serovar Senftenberg strain SL180013 plasmid pSL180013-1, complete sequence 2811-2843 7 0.788
NZ_CP011331_1 1.2|468644|33|NZ_CP011331|PILER-CR 468644-468676 33 NZ_CP030192 Salmonella enterica strain SA20104250 plasmid pSA20104250.2, complete sequence 1835-1867 7 0.788
NZ_CP011331_1 1.2|468644|33|NZ_CP011331|PILER-CR 468644-468676 33 NZ_CP039274 Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.4, complete sequence 118-150 7 0.788
NZ_CP011331_1 1.2|468644|33|NZ_CP011331|PILER-CR 468644-468676 33 NZ_CP016528 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_4, complete sequence 52-84 7 0.788
NZ_CP011331_1 1.2|468644|33|NZ_CP011331|PILER-CR 468644-468676 33 NZ_CP030227 Salmonella enterica strain SA20041605 plasmid pSA20041605.2, complete sequence 3123-3155 7 0.788
NZ_CP011331_1 1.2|468644|33|NZ_CP011331|PILER-CR 468644-468676 33 NC_013090 Endophytic bacterium LOB-07 plasmid pLK39, complete sequence 52-84 7 0.788
NZ_CP011331_1 1.2|468644|33|NZ_CP011331|PILER-CR 468644-468676 33 NZ_CP030009 Enterobacter hormaechei subsp. xiangfangensis strain Pb204 plasmid pPb204002, complete sequence 2572-2604 7 0.788
NZ_CP011331_1 1.2|468644|33|NZ_CP011331|PILER-CR 468644-468676 33 NZ_CP011606 Citrobacter freundii strain CAV1321 plasmid pCAV1321-4310, complete sequence 3835-3867 7 0.788
NZ_CP011331_1 1.2|468644|33|NZ_CP011331|PILER-CR 468644-468676 33 NZ_CP044113 Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed4, complete sequence 3638-3670 7 0.788
NZ_CP011331_1 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT 468645-468676 32 NZ_CP038598 Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.3, complete sequence 2052-2083 7 0.781
NZ_CP011331_1 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT 468645-468676 32 NZ_CP033827 Klebsiella sp. FDAARGOS_511 plasmid unnamed4, complete sequence 693-724 7 0.781
NZ_CP011331_1 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT 468645-468676 32 NZ_CP029125 Enterobacter hormaechei strain AR432 plasmid unnamed2, complete sequence 518-549 7 0.781
NZ_CP011331_1 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT 468645-468676 32 NZ_AP019693 Salmonella enterica subsp. enterica serovar Senftenberg strain SL180013 plasmid pSL180013-1, complete sequence 2812-2843 7 0.781
NZ_CP011331_1 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT 468645-468676 32 NZ_CP030192 Salmonella enterica strain SA20104250 plasmid pSA20104250.2, complete sequence 1835-1866 7 0.781
NZ_CP011331_1 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT 468645-468676 32 NZ_CP039274 Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.4, complete sequence 118-149 7 0.781
NZ_CP011331_1 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT 468645-468676 32 NZ_CP016528 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_4, complete sequence 53-84 7 0.781
NZ_CP011331_1 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT 468645-468676 32 NZ_CP030227 Salmonella enterica strain SA20041605 plasmid pSA20041605.2, complete sequence 3124-3155 7 0.781
NZ_CP011331_1 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT 468645-468676 32 NC_013090 Endophytic bacterium LOB-07 plasmid pLK39, complete sequence 53-84 7 0.781
NZ_CP011331_1 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT 468645-468676 32 NZ_CP030009 Enterobacter hormaechei subsp. xiangfangensis strain Pb204 plasmid pPb204002, complete sequence 2572-2603 7 0.781
NZ_CP011331_1 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT 468645-468676 32 NZ_CP011606 Citrobacter freundii strain CAV1321 plasmid pCAV1321-4310, complete sequence 3835-3866 7 0.781
NZ_CP011331_1 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT 468645-468676 32 NZ_CP044113 Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed4, complete sequence 3639-3670 7 0.781
NZ_CP011331_1 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT 468889-468920 32 MN693005 Marine virus AFVG_117M50, complete genome 6262-6293 7 0.781
NZ_CP011331_1 1.1|468583|33|NZ_CP011331|PILER-CR 468583-468615 33 NZ_CP012265 Cronobacter condimenti 1330 strain LMG 26250 plasmid pCCO1, complete sequence 26062-26094 8 0.758
NZ_CP011331_1 1.6|468888|33|NZ_CP011331|PILER-CR 468888-468920 33 MN693005 Marine virus AFVG_117M50, complete genome 6262-6294 8 0.758
NZ_CP011331_1 1.11|469193|33|NZ_CP011331|PILER-CR 469193-469225 33 MK016501 Mycobacterium phage Nebkiss, complete genome 21453-21485 8 0.758
NZ_CP011331_1 1.11|469193|33|NZ_CP011331|PILER-CR 469193-469225 33 NC_026590 Mycobacterium phage Gaia, complete genome 21452-21484 8 0.758
NZ_CP011331_1 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT 468584-468615 32 NZ_CP012265 Cronobacter condimenti 1330 strain LMG 26250 plasmid pCCO1, complete sequence 26063-26094 8 0.75
NZ_CP011331_1 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT 468645-468676 32 NC_019341 Pseudomonas syringae plasmid pNCPPB880-40, complete sequence 6612-6643 8 0.75
NZ_CP011331_1 1.17|468767|32|NZ_CP011331|CRISPRCasFinder,CRT 468767-468798 32 AB452989 Serratia phage KSP20 orf7 to orf11 genes for scaffolding protein, major capsid protein, terminase, head completion protein, hypothetical protein, complete and partial cds 1966-1997 8 0.75
NZ_CP011331_1 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT 468889-468920 32 MK295204 Shigella phage vB_SdyM_006, complete genome 16122-16153 8 0.75
NZ_CP011331_1 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT 468889-468920 32 MG696114 Proteus phage phiP4-3, complete genome 149804-149835 8 0.75
NZ_CP011331_1 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT 468889-468920 32 NZ_CP017949 Tenericutes bacterium MO-XQ plasmid unnamed, complete sequence 58006-58037 8 0.75
NZ_CP011331_1 1.22|469072|32|NZ_CP011331|CRISPRCasFinder,CRT 469072-469103 32 NZ_CP010769 Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence 121002-121033 8 0.75
NZ_CP011331_1 1.24|469194|32|NZ_CP011331|CRISPRCasFinder,CRT 469194-469225 32 MK016501 Mycobacterium phage Nebkiss, complete genome 21454-21485 8 0.75
NZ_CP011331_1 1.24|469194|32|NZ_CP011331|CRISPRCasFinder,CRT 469194-469225 32 NC_026590 Mycobacterium phage Gaia, complete genome 21453-21484 8 0.75
NZ_CP011331_1 1.6|468888|33|NZ_CP011331|PILER-CR 468888-468920 33 MK295204 Shigella phage vB_SdyM_006, complete genome 16121-16153 9 0.727
NZ_CP011331_1 1.6|468888|33|NZ_CP011331|PILER-CR 468888-468920 33 MG696114 Proteus phage phiP4-3, complete genome 149804-149836 9 0.727
NZ_CP011331_1 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT 468584-468615 32 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 460266-460297 9 0.719
NZ_CP011331_1 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT 468889-468920 32 AP022649 Bacillus wiedmannii PL1 plasmid pBwiPL1-6 DNA, complete sequence 5394-5425 9 0.719
NZ_CP011331_1 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT 468889-468920 32 KC821606 Cellulophaga phage phi12:2, complete genome 1257-1288 9 0.719
NZ_CP011331_1 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT 468889-468920 32 KT070867 Bacillus phage PBC2, complete genome 154855-154886 9 0.719
NZ_CP011331_1 1.6|468888|33|NZ_CP011331|PILER-CR 468888-468920 33 AP022649 Bacillus wiedmannii PL1 plasmid pBwiPL1-6 DNA, complete sequence 5394-5426 10 0.697
NZ_CP011331_1 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT 468584-468615 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1538980-1539011 10 0.688
NZ_CP011331_1 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT 468584-468615 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1187025-1187056 10 0.688
NZ_CP011331_1 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT 468584-468615 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1615960-1615991 10 0.688
NZ_CP011331_1 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT 468584-468615 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1459996-1460027 10 0.688
NZ_CP011331_1 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT 468584-468615 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1531874-1531905 10 0.688
NZ_CP011331_1 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT 468584-468615 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1459018-1459049 10 0.688
NZ_CP011331_1 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT 468584-468615 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1526371-1526402 10 0.688
NZ_CP011331_1 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT 468584-468615 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1526372-1526403 10 0.688
NZ_CP011331_1 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT 468584-468615 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1459988-1460019 10 0.688
NZ_CP011331_1 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT 468584-468615 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1459341-1459372 10 0.688
NZ_CP011331_1 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT 468584-468615 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1459978-1460009 10 0.688
NZ_CP011331_1 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT 468584-468615 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1539145-1539176 10 0.688
NZ_CP011331_1 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT 468584-468615 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1539126-1539157 10 0.688
NZ_CP011331_1 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT 468584-468615 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1539107-1539138 10 0.688
NZ_CP011331_1 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT 468889-468920 32 KC821631 Cellulophaga phage phi48:1, complete genome 1257-1288 10 0.688
NZ_CP011331_1 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT 468889-468920 32 KC821628 Cellulophaga phage phi18:4, complete genome 1257-1288 10 0.688
NZ_CP011331_1 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT 468889-468920 32 NC_021805 Cellulophaga phage phi12a:1, complete genome 1257-1288 10 0.688
NZ_CP011331_1 1.23|469133|32|NZ_CP011331|CRISPRCasFinder,CRT 469133-469164 32 KU160664 Arthrobacter phage Salgado, complete genome 140-171 11 0.656
NZ_CP011331_1 1.23|469133|32|NZ_CP011331|CRISPRCasFinder,CRT 469133-469164 32 MF140418 Arthrobacter phage LiSara, complete genome 140-171 11 0.656
NZ_CP011331_1 1.23|469133|32|NZ_CP011331|CRISPRCasFinder,CRT 469133-469164 32 KU160654 Arthrobacter phage Laroye, complete genome 140-171 11 0.656

1. spacer 4.1|2563779|40|NZ_CP011331|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 5.2|2923353|25|NZ_CP011331|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttcaggtaaactttat	Protospacer
*************************

3. spacer 5.2|2923353|25|NZ_CP011331|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttcaggtaaactttat	Protospacer
*************************

4. spacer 8.1|3713586|42|NZ_CP011331|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

5. spacer 8.2|3713645|40|NZ_CP011331|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

catggcgtagaaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
****************************************

6. spacer 5.1|2923306|24|NZ_CP011331|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 1, identity: 0.958

cgcctttacctgatgtgggtaaac	CRISPR spacer
cgcctttacctgatttgggtaaac	Protospacer
************** *********

7. spacer 5.1|2923306|24|NZ_CP011331|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 1, identity: 0.958

cgcctttacctgatgtgggtaaac	CRISPR spacer
cgcctttacctgatttgggtaaac	Protospacer
************** *********

8. spacer 5.2|2923353|25|NZ_CP011331|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.96

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttaaggtaaactttat	Protospacer
*********** *************

9. spacer 3.1|1750762|38|NZ_CP011331|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

10. spacer 5.1|2923306|24|NZ_CP011331|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 2, identity: 0.917

cgcctttacctgatgtgggtaaac	CRISPR spacer
tgcctttacctgatttgggtaaac	Protospacer
.************* *********

11. spacer 5.2|2923353|25|NZ_CP011331|PILER-CR matches to NZ_CP015341 (Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84

tttacctctttcaggtaaactttat	CRISPR spacer
ggtatctcattcaggtaaactttat	Protospacer
  **.*** ****************

12. spacer 1.2|468644|33|NZ_CP011331|PILER-CR matches to NZ_CP038598 (Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.3, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

13. spacer 1.2|468644|33|NZ_CP011331|PILER-CR matches to NZ_CP033827 (Klebsiella sp. FDAARGOS_511 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

14. spacer 1.2|468644|33|NZ_CP011331|PILER-CR matches to NZ_CP029125 (Enterobacter hormaechei strain AR432 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

15. spacer 1.2|468644|33|NZ_CP011331|PILER-CR matches to NZ_AP019693 (Salmonella enterica subsp. enterica serovar Senftenberg strain SL180013 plasmid pSL180013-1, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

16. spacer 1.2|468644|33|NZ_CP011331|PILER-CR matches to NZ_CP030192 (Salmonella enterica strain SA20104250 plasmid pSA20104250.2, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

17. spacer 1.2|468644|33|NZ_CP011331|PILER-CR matches to NZ_CP039274 (Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.4, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

18. spacer 1.2|468644|33|NZ_CP011331|PILER-CR matches to NZ_CP016528 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_4, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

19. spacer 1.2|468644|33|NZ_CP011331|PILER-CR matches to NZ_CP030227 (Salmonella enterica strain SA20041605 plasmid pSA20041605.2, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

20. spacer 1.2|468644|33|NZ_CP011331|PILER-CR matches to NC_013090 (Endophytic bacterium LOB-07 plasmid pLK39, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

21. spacer 1.2|468644|33|NZ_CP011331|PILER-CR matches to NZ_CP030009 (Enterobacter hormaechei subsp. xiangfangensis strain Pb204 plasmid pPb204002, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

22. spacer 1.2|468644|33|NZ_CP011331|PILER-CR matches to NZ_CP011606 (Citrobacter freundii strain CAV1321 plasmid pCAV1321-4310, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

23. spacer 1.2|468644|33|NZ_CP011331|PILER-CR matches to NZ_CP044113 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

24. spacer 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP038598 (Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.3, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

25. spacer 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP033827 (Klebsiella sp. FDAARGOS_511 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

26. spacer 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP029125 (Enterobacter hormaechei strain AR432 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

27. spacer 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_AP019693 (Salmonella enterica subsp. enterica serovar Senftenberg strain SL180013 plasmid pSL180013-1, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

28. spacer 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP030192 (Salmonella enterica strain SA20104250 plasmid pSA20104250.2, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

29. spacer 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP039274 (Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.4, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

30. spacer 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP016528 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_4, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

31. spacer 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP030227 (Salmonella enterica strain SA20041605 plasmid pSA20041605.2, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

32. spacer 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NC_013090 (Endophytic bacterium LOB-07 plasmid pLK39, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

33. spacer 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP030009 (Enterobacter hormaechei subsp. xiangfangensis strain Pb204 plasmid pPb204002, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

34. spacer 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP011606 (Citrobacter freundii strain CAV1321 plasmid pCAV1321-4310, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

35. spacer 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP044113 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

36. spacer 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT matches to MN693005 (Marine virus AFVG_117M50, complete genome) position: , mismatch: 7, identity: 0.781

atttttcagactcatcaaaataatcctttaat	CRISPR spacer
tttgttcatactcatcaaaataatctataact	Protospacer
 ** **** ****************. * * *

37. spacer 1.1|468583|33|NZ_CP011331|PILER-CR matches to NZ_CP012265 (Cronobacter condimenti 1330 strain LMG 26250 plasmid pCCO1, complete sequence) position: , mismatch: 8, identity: 0.758

aggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
aagaactggcgctgctggagaaaatccgcaaag	Protospacer
*.****************** *** **  . * 

38. spacer 1.6|468888|33|NZ_CP011331|PILER-CR matches to MN693005 (Marine virus AFVG_117M50, complete genome) position: , mismatch: 8, identity: 0.758

gatttttcagactcatcaaaataatcctttaat	CRISPR spacer
ctttgttcatactcatcaaaataatctataact	Protospacer
  ** **** ****************. * * *

39. spacer 1.11|469193|33|NZ_CP011331|PILER-CR matches to MK016501 (Mycobacterium phage Nebkiss, complete genome) position: , mismatch: 8, identity: 0.758

gacacctctactgacgttcctgaacaagaagat	CRISPR spacer
gacacctccactggcgttcctgaacgtattcat	Protospacer
********.****.***********. .   **

40. spacer 1.11|469193|33|NZ_CP011331|PILER-CR matches to NC_026590 (Mycobacterium phage Gaia, complete genome) position: , mismatch: 8, identity: 0.758

gacacctctactgacgttcctgaacaagaagat	CRISPR spacer
gacacctccactggcgttcctgaacgtattcat	Protospacer
********.****.***********. .   **

41. spacer 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP012265 (Cronobacter condimenti 1330 strain LMG 26250 plasmid pCCO1, complete sequence) position: , mismatch: 8, identity: 0.75

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
agaactggcgctgctggagaaaatccgcaaag	Protospacer
.****************** *** **  . * 

42. spacer 1.15|468645|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NC_019341 (Pseudomonas syringae plasmid pNCPPB880-40, complete sequence) position: , mismatch: 8, identity: 0.75

aaaagggccgcattgacggccctgtgttatcg	CRISPR spacer
aaaagggccgcattagcggcccttttaatttg	Protospacer
**************..******* *    *.*

43. spacer 1.17|468767|32|NZ_CP011331|CRISPRCasFinder,CRT matches to AB452989 (Serratia phage KSP20 orf7 to orf11 genes for scaffolding protein, major capsid protein, terminase, head completion protein, hypothetical protein, complete and partial cds) position: , mismatch: 8, identity: 0.75

gggtggcggtggtgctgtaattcacaccggta	CRISPR spacer
ggcgcgtggtggtgctgttgttcacaccggcc	Protospacer
**   *.*********** .**********. 

44. spacer 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT matches to MK295204 (Shigella phage vB_SdyM_006, complete genome) position: , mismatch: 8, identity: 0.75

atttttcagactcatcaaaataatcctttaat-----	CRISPR spacer
gtttttcataatcatcaaaataatc-----atgacca	Protospacer
.******* * **************     **     

45. spacer 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT matches to MG696114 (Proteus phage phiP4-3, complete genome) position: , mismatch: 8, identity: 0.75

atttttcagactcatcaaaataatcctttaat-----	CRISPR spacer
gtttttcataatcatcaaaataatc-----atgacca	Protospacer
.******* * **************     **     

46. spacer 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP017949 (Tenericutes bacterium MO-XQ plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

-----atttttcagactcatcaaaataatcctttaat	CRISPR spacer
cagtgatt-----aacccatctaaataatcctttaat	Protospacer
     ***     .**.**** ***************

47. spacer 1.22|469072|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP010769 (Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence) position: , mismatch: 8, identity: 0.75

ccgtcaaacagtatcaccgcgttaacgcccgc	CRISPR spacer
cccacaaacagtagcatcgcgttaacgatcaa	Protospacer
**  ********* **.********** .*. 

48. spacer 1.24|469194|32|NZ_CP011331|CRISPRCasFinder,CRT matches to MK016501 (Mycobacterium phage Nebkiss, complete genome) position: , mismatch: 8, identity: 0.75

acacctctactgacgttcctgaacaagaagat	CRISPR spacer
acacctccactggcgttcctgaacgtattcat	Protospacer
*******.****.***********. .   **

49. spacer 1.24|469194|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NC_026590 (Mycobacterium phage Gaia, complete genome) position: , mismatch: 8, identity: 0.75

acacctctactgacgttcctgaacaagaagat	CRISPR spacer
acacctccactggcgttcctgaacgtattcat	Protospacer
*******.****.***********. .   **

50. spacer 1.6|468888|33|NZ_CP011331|PILER-CR matches to MK295204 (Shigella phage vB_SdyM_006, complete genome) position: , mismatch: 9, identity: 0.727

gatttttcagactcatcaaaataatcctttaat-----	CRISPR spacer
cgtttttcataatcatcaaaataatc-----atgacca	Protospacer
 .******* * **************     **     

51. spacer 1.6|468888|33|NZ_CP011331|PILER-CR matches to MG696114 (Proteus phage phiP4-3, complete genome) position: , mismatch: 9, identity: 0.727

gatttttcagactcatcaaaataatcctttaat-----	CRISPR spacer
cgtttttcataatcatcaaaataatc-----atgacca	Protospacer
 .******* * **************     **     

52. spacer 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
ggccaaggcgctgctggaacagaacccggacc	Protospacer
**    ************.**.*******  .

53. spacer 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT matches to AP022649 (Bacillus wiedmannii PL1 plasmid pBwiPL1-6 DNA, complete sequence) position: , mismatch: 9, identity: 0.719

atttttcagactcatcaaaataatcctttaat	CRISPR spacer
ccctatcatattcatcaaaataatcctttgcg	Protospacer
 ..* *** *.******************.  

54. spacer 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT matches to KC821606 (Cellulophaga phage phi12:2, complete genome) position: , mismatch: 9, identity: 0.719

atttttcagactcatcaaaataatcctttaat	CRISPR spacer
gttttttaaactcatcaaaataataacctacc	Protospacer
.*****.*.***************  ..** .

55. spacer 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT matches to KT070867 (Bacillus phage PBC2, complete genome) position: , mismatch: 9, identity: 0.719

atttttcagactcatcaaaataatcctttaat	CRISPR spacer
atttttcagacttatcaaaagaacagtcggaa	Protospacer
************.******* **.  *. .* 

56. spacer 1.6|468888|33|NZ_CP011331|PILER-CR matches to AP022649 (Bacillus wiedmannii PL1 plasmid pBwiPL1-6 DNA, complete sequence) position: , mismatch: 10, identity: 0.697

gatttttcagactcatcaaaataatcctttaat	CRISPR spacer
tccctatcatattcatcaaaataatcctttgcg	Protospacer
  ..* *** *.******************.  

57. spacer 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

58. spacer 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
cctgctggcggtgctggagcagaaccccgcgg	Protospacer
   .****** **********.***** *.. 

59. spacer 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

60. spacer 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

61. spacer 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

62. spacer 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

63. spacer 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

64. spacer 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

65. spacer 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

66. spacer 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

67. spacer 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

68. spacer 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

69. spacer 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

70. spacer 1.14|468584|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

71. spacer 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT matches to KC821631 (Cellulophaga phage phi48:1, complete genome) position: , mismatch: 10, identity: 0.688

atttttcagactcatcaaaataatcctttaat	CRISPR spacer
gttttttaaactcatcaaaataataacccacc	Protospacer
.*****.*.***************  ...* .

72. spacer 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT matches to KC821628 (Cellulophaga phage phi18:4, complete genome) position: , mismatch: 10, identity: 0.688

atttttcagactcatcaaaataatcctttaat	CRISPR spacer
gttttttaaactcatcaaaataataacccacc	Protospacer
.*****.*.***************  ...* .

73. spacer 1.19|468889|32|NZ_CP011331|CRISPRCasFinder,CRT matches to NC_021805 (Cellulophaga phage phi12a:1, complete genome) position: , mismatch: 10, identity: 0.688

atttttcagactcatcaaaataatcctttaat	CRISPR spacer
gttttttaaactcatcaaaataataacccacc	Protospacer
.*****.*.***************  ...* .

74. spacer 1.23|469133|32|NZ_CP011331|CRISPRCasFinder,CRT matches to KU160664 (Arthrobacter phage Salgado, complete genome) position: , mismatch: 11, identity: 0.656

ccacacacgtcgagctggtgggggttaatgct	CRISPR spacer
aacggggcgtcgggctggtgggggtgaatgta	Protospacer
    . .*****.************ ****. 

75. spacer 1.23|469133|32|NZ_CP011331|CRISPRCasFinder,CRT matches to MF140418 (Arthrobacter phage LiSara, complete genome) position: , mismatch: 11, identity: 0.656

ccacacacgtcgagctggtgggggttaatgct	CRISPR spacer
aacggggcgtcgggctggtgggggtgaatgta	Protospacer
    . .*****.************ ****. 

76. spacer 1.23|469133|32|NZ_CP011331|CRISPRCasFinder,CRT matches to KU160654 (Arthrobacter phage Laroye, complete genome) position: , mismatch: 11, identity: 0.656

ccacacacgtcgagctggtgggggttaatgct	CRISPR spacer
aacggggcgtcgggctggtgggggtgaatgta	Protospacer
    . .*****.************ ****. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 197356 : 281045 61 Pseudomonas_phage(18.75%) protease,transposase,integrase,plate,tRNA attL 235106:235123|attR 280044:280061
DBSCAN-SWA_2 512870 : 520010 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_3 880612 : 931098 54 Enterobacteria_phage(48.57%) protease,transposase,integrase,portal,terminase,head attL 878144:878160|attR 915824:915840
DBSCAN-SWA_4 1146372 : 1155814 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_5 1446393 : 1507864 75 Enterobacteria_phage(39.34%) integrase,tRNA,holin,portal,terminase,head,tail,capsid attL 1452289:1452303|attR 1487491:1487505
DBSCAN-SWA_6 1645893 : 1704472 72 Enterobacteria_phage(77.55%) transposase,integrase,plate,tRNA,holin,portal,terminase,head,tail,capsid attL 1656257:1656273|attR 1708464:1708480
DBSCAN-SWA_7 1824216 : 1898848 87 Shigella_phage(43.66%) protease,integrase,lysis,holin,portal,terminase,tail,capsid attL 1828320:1828337|attR 1856370:1856387
DBSCAN-SWA_8 2186696 : 2248166 73 Enterobacteria_phage(43.14%) protease,integrase,holin,portal,terminase,head,tail,capsid attL 2231398:2231412|attR 2252337:2252351
DBSCAN-SWA_9 2473669 : 2624243 145 Escherichia_phage(80.72%) protease,transposase,integrase,lysis,holin,portal,terminase,tail,capsid,bacteriocin attL 2475136:2475151|attR 2625302:2625317
DBSCAN-SWA_10 2835059 : 2931595 108 Enterobacteria_phage(45.45%) transposase,integrase,lysis,portal,head,tail,capsid attL 2861343:2861377|attR 2933029:2933063
DBSCAN-SWA_11 3449837 : 3506142 52 Enterobacteria_phage(27.27%) integrase,plate attL 3451218:3451237|attR 3464178:3464197
DBSCAN-SWA_12 3945376 : 4084541 116 Enterobacteria_phage(17.39%) protease,tRNA,integrase,transposase attL 4030448:4030463|attR 4071178:4071193
DBSCAN-SWA_13 4649337 : 4673785 27 Escherichia_phage(30.0%) integrase,transposase attL 4651907:4651936|attR 4673925:4673939
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP011332
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5280 : 10527 6 Stx2-converting_phage(66.67%) transposase NA
DBSCAN-SWA_2 50121 : 57752 8 Stx2-converting_phage(50.0%) integrase,transposase attL 39672:39686|attR 61566:61580
DBSCAN-SWA_3 63757 : 69935 10 Enterobacteria_phage(33.33%) integrase attL 63589:63601|attR 70316:70328
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage