Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP011132 Citrobacter amalonaticus Y19 chromosome, complete genome 13 crisprs WYL,DinG,cas3,DEDDh,RT,csa3,PD-DExK 2 1 9 1
NZ_CP011133 Citrobacter amalonaticus Y19 plasmid unnamed, complete sequence 0 crisprs DinG,csa3 0 0 1 0

Results visualization

1. NZ_CP011132
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011132_1 340616-340713 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011132_2 798201-798336 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011132_3 1388958-1389091 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011132_4 1456520-1456611 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011132_5 2326355-2326457 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011132_6 2469255-2469452 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011132_7 2556587-2556699 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011132_8 4779462-4779573 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011132_9 4894318-4894423 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011132_10 4994372-4994466 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011132_11 5412277-5412502 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011132_12 5436963-5437057 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011132_13 5571401-5571536 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP011132_2 2.1|798241|56|NZ_CP011132|CRISPRCasFinder 798241-798296 56 NZ_CP011132.1 802978-803033 1 0.982
NZ_CP011132_9 9.1|4894353|36|NZ_CP011132|CRISPRCasFinder 4894353-4894388 36 NZ_CP011132.1 4893609-4893644 1 0.972
NZ_CP011132_2 2.1|798241|56|NZ_CP011132|CRISPRCasFinder 798241-798296 56 NZ_CP011132.1 803646-803701 2 0.964

1. spacer 2.1|798241|56|NZ_CP011132|CRISPRCasFinder matches to position: 802978-803033, mismatch: 1, identity: 0.982

ctcgtaggtctgataagcgcagcgccatcaggcagtttgccggatgacggcacaag	CRISPR spacer
ctcgtaggcctgataagcgcagcgccatcaggcagtttgccggatgacggcacaag	Protospacer
********.***********************************************

2. spacer 9.1|4894353|36|NZ_CP011132|CRISPRCasFinder matches to position: 4893609-4893644, mismatch: 1, identity: 0.972

ttcgtgcttttcgtaggccggatagggcgttggtcc	CRISPR spacer
ttcgtgcatttcgtaggccggatagggcgttggtcc	Protospacer
******* ****************************

3. spacer 2.1|798241|56|NZ_CP011132|CRISPRCasFinder matches to position: 803646-803701, mismatch: 2, identity: 0.964

ctcgtaggtctgataagcgcagcgccatcaggcagtttgccggatgacggcacaag	CRISPR spacer
ctcgtaggcctgataagcgcagcgccatcaggcagtttgccggacgacggcacaag	Protospacer
********.***********************************.***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP011132_9 9.1|4894353|36|NZ_CP011132|CRISPRCasFinder 4894353-4894388 36 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 40322-40357 9 0.75

1. spacer 9.1|4894353|36|NZ_CP011132|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 9, identity: 0.75

ttcgtgcttttcgtaggccggatagggcgttggtcc	CRISPR spacer
tgcacgctttttgtaggccggataaggcgtttacgc	Protospacer
* *..******.************.****** .. *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2289010 : 2335066 59 Salmonella_phage(30.77%) capsid,terminase,tail,transposase,integrase,head,holin attL 2331435:2331449|attR 2337542:2337556
DBSCAN-SWA_2 2410309 : 2420264 6 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_3 2453202 : 2461621 9 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_4 3569346 : 3647528 52 Staphylococcus_phage(33.33%) plate,protease,transposase NA
DBSCAN-SWA_5 4604688 : 4663177 69 Escherichia_phage(31.71%) capsid,lysis,terminase,portal,tail,plate,integrase,head,protease attL 4607434:4607475|attR 4639751:4639792
DBSCAN-SWA_6 4834119 : 4894306 72 Pseudomonas_phage(36.36%) tRNA,capsid,tail,terminase,plate,integrase,transposase,head,protease attL 4829750:4829767|attR 4893691:4893708
DBSCAN-SWA_7 4956727 : 4962996 6 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_8 5077387 : 5085749 9 uncultured_Caudovirales_phage(83.33%) transposase NA
DBSCAN-SWA_9 5283258 : 5333830 51 uncultured_Caudovirales_phage(18.75%) tRNA,capsid,tail,transposase,integrase,head attL 5292425:5292471|attR 5334765:5334811
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP011132.1|WP_003030314.1|4847071_4847494_+|hypothetical-protein 4847071_4847494_+ 140 aa aa NA NA NA 4834119-4894306 yes
2. NZ_CP011133
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 178852 : 227411 49 uncultured_Caudovirales_phage(35.29%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage