Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LN829119 Candidatus Filomicrobium marinum strain strain Y chromosome 1 2 crisprs csa3,DEDDh,WYL,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas3 0 16 2 0

Results visualization

1. NZ_LN829119
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN829119_1 576837-577179 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LN829119_2 3470363-3472099 TypeI-A,TypeI-E? NA
28 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LN829119_1 1.5|577076|25|NZ_LN829119|CRISPRCasFinder 577076-577100 25 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1016634-1016658 4 0.84
NZ_LN829119_2 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR 3470697-3470728 32 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 214275-214306 6 0.812
NZ_LN829119_2 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR 3470697-3470728 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 53149-53180 7 0.781
NZ_LN829119_2 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR 3470697-3470728 32 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 62352-62383 7 0.781
NZ_LN829119_2 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR 3470697-3470728 32 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 71507-71538 7 0.781
NZ_LN829119_2 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR 3470697-3470728 32 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 54352-54383 7 0.781
NZ_LN829119_2 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR 3470697-3470728 32 NZ_CP024940 Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence 401327-401358 7 0.781
NZ_LN829119_2 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR 3470697-3470728 32 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 63683-63714 7 0.781
NZ_LN829119_2 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR 3470697-3470728 32 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 44635-44666 7 0.781
NZ_LN829119_2 2.11|3471002|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR 3471002-3471033 32 MK359302 Gordonia phage Sombrero, complete genome 13783-13814 7 0.781
NZ_LN829119_2 2.15|3471246|32|NZ_LN829119|CRISPRCasFinder,CRT 3471246-3471277 32 NZ_CP045296 Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence 238297-238328 7 0.781
NZ_LN829119_2 2.25|3471856|32|NZ_LN829119|CRISPRCasFinder,CRT 3471856-3471887 32 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1649404-1649435 7 0.781
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 MF979563 Pectobacterium phage DU_PP_IV, complete genome 100981-101012 7 0.781
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 MF979560 Pectobacterium phage DU_PP_I, complete genome 100671-100702 7 0.781
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 KC954774 Cronobacter phage CR8, complete genome 109965-109996 7 0.781
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 NC_028672 Cronobacter phage PBES 02, complete genome 14775-14806 7 0.781
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 NC_017974 Cronobacter phage CR3, complete genome 109191-109222 7 0.781
NZ_LN829119_2 2.31|3471247|32|NZ_LN829119|PILER-CR 3471247-3471278 32 NZ_CP045296 Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence 238297-238328 7 0.781
NZ_LN829119_2 2.41|3471857|32|NZ_LN829119|PILER-CR 3471857-3471888 32 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1649404-1649435 7 0.781
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 MF979563 Pectobacterium phage DU_PP_IV, complete genome 100981-101012 7 0.781
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 MF979560 Pectobacterium phage DU_PP_I, complete genome 100671-100702 7 0.781
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 KC954774 Cronobacter phage CR8, complete genome 109965-109996 7 0.781
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 NC_028672 Cronobacter phage PBES 02, complete genome 14775-14806 7 0.781
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 NC_017974 Cronobacter phage CR3, complete genome 109191-109222 7 0.781
NZ_LN829119_2 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR 3470697-3470728 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1000137-1000168 8 0.75
NZ_LN829119_2 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR 3470697-3470728 32 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 214777-214808 8 0.75
NZ_LN829119_2 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR 3470697-3470728 32 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 106410-106441 8 0.75
NZ_LN829119_2 2.27|3471978|32|NZ_LN829119|CRISPRCasFinder,CRT 3471978-3472009 32 NZ_CP041206 Rhizobium sp. NIBRBAC000502774 plasmid pMK-3, complete sequence 92756-92787 8 0.75
NZ_LN829119_2 2.43|3471979|32|NZ_LN829119|PILER-CR 3471979-3472010 32 NZ_CP041206 Rhizobium sp. NIBRBAC000502774 plasmid pMK-3, complete sequence 92756-92787 8 0.75
NZ_LN829119_2 2.20|3471551|32|NZ_LN829119|CRISPRCasFinder,CRT 3471551-3471582 32 NZ_CP014308 Burkholderia sp. PAMC 26561 plasmid unnamed1, complete sequence 275649-275680 9 0.719
NZ_LN829119_2 2.20|3471551|32|NZ_LN829119|CRISPRCasFinder,CRT 3471551-3471582 32 NZ_CP014309 Burkholderia sp. PAMC 26561 plasmid unnamed2, complete sequence 559454-559485 9 0.719
NZ_LN829119_2 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT 3471673-3471704 32 NZ_CP014052 Vibrio alginolyticus strain FDAARGOS_108 plasmid unnamed1, complete sequence 19725-19756 9 0.719
NZ_LN829119_2 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT 3471673-3471704 32 NZ_KP688397 Vibrio parahaemolyticus strain V36 plasmid pVPH1, complete sequence 41201-41232 9 0.719
NZ_LN829119_2 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT 3471673-3471704 32 NZ_KP791968 Vibrio parahaemolyticus strain 2011VPH2 plasmid pVPH2, complete sequence 92769-92800 9 0.719
NZ_LN829119_2 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT 3471673-3471704 32 NZ_CP025539 Vibrio harveyi strain 345 plasmid p345-185, complete sequence 109710-109741 9 0.719
NZ_LN829119_2 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT 3471673-3471704 32 MN865127 Vibrio alginolyticus strain C1579 plasmid pC1579, complete sequence 57775-57806 9 0.719
NZ_LN829119_2 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT 3471673-3471704 32 NC_025127 Vibrio sp. 04Ya090 plasmid pAQU2 DNA, complete sequence 44833-44864 9 0.719
NZ_LN829119_2 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT 3471673-3471704 32 NC_016983 Photobacterium damselae subsp. damselae plasmid pAQU1, complete sequence 53190-53221 9 0.719
NZ_LN829119_2 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT 3471673-3471704 32 NZ_CP034301 Vibrio parahaemolyticus strain 20160303005-1 plasmid pVPSD2016-2, complete sequence 165826-165857 9 0.719
NZ_LN829119_2 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT 3471673-3471704 32 KX957970 Vibrio parahaemolyticus plasmid pVPS43, complete sequence 4797-4828 9 0.719
NZ_LN829119_2 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT 3471673-3471704 32 KX957971 Vibrio parahaemolyticus plasmid pVPS62, complete sequence 4797-4828 9 0.719
NZ_LN829119_2 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT 3471673-3471704 32 KX957972 Vibrio parahaemolyticus plasmid pVPS91, complete sequence 4797-4828 9 0.719
NZ_LN829119_2 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT 3471673-3471704 32 KX957968 Vibrio alginolyticus plasmid pVAS19, complete sequence 4797-4828 9 0.719
NZ_LN829119_2 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT 3471673-3471704 32 KX957969 Vibrio alginolyticus plasmid pVAS114, complete sequence 4797-4828 9 0.719
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 320009-320040 9 0.719
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 364258-364289 9 0.719
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 325528-325559 9 0.719
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 746608-746639 9 0.719
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 156069-156100 9 0.719
NZ_LN829119_2 2.27|3471978|32|NZ_LN829119|CRISPRCasFinder,CRT 3471978-3472009 32 MK977696 Gordonia phage SCentae, complete genome 98900-98931 9 0.719
NZ_LN829119_2 2.27|3471978|32|NZ_LN829119|CRISPRCasFinder,CRT 3471978-3472009 32 MK977695 Gordonia phage Pupper, complete genome 98749-98780 9 0.719
NZ_LN829119_2 2.36|3471552|32|NZ_LN829119|PILER-CR 3471552-3471583 32 NZ_CP014308 Burkholderia sp. PAMC 26561 plasmid unnamed1, complete sequence 275649-275680 9 0.719
NZ_LN829119_2 2.36|3471552|32|NZ_LN829119|PILER-CR 3471552-3471583 32 NZ_CP014309 Burkholderia sp. PAMC 26561 plasmid unnamed2, complete sequence 559454-559485 9 0.719
NZ_LN829119_2 2.38|3471674|32|NZ_LN829119|PILER-CR 3471674-3471705 32 NZ_CP014052 Vibrio alginolyticus strain FDAARGOS_108 plasmid unnamed1, complete sequence 19725-19756 9 0.719
NZ_LN829119_2 2.38|3471674|32|NZ_LN829119|PILER-CR 3471674-3471705 32 NZ_KP688397 Vibrio parahaemolyticus strain V36 plasmid pVPH1, complete sequence 41201-41232 9 0.719
NZ_LN829119_2 2.38|3471674|32|NZ_LN829119|PILER-CR 3471674-3471705 32 NZ_KP791968 Vibrio parahaemolyticus strain 2011VPH2 plasmid pVPH2, complete sequence 92769-92800 9 0.719
NZ_LN829119_2 2.38|3471674|32|NZ_LN829119|PILER-CR 3471674-3471705 32 NZ_CP025539 Vibrio harveyi strain 345 plasmid p345-185, complete sequence 109710-109741 9 0.719
NZ_LN829119_2 2.38|3471674|32|NZ_LN829119|PILER-CR 3471674-3471705 32 MN865127 Vibrio alginolyticus strain C1579 plasmid pC1579, complete sequence 57775-57806 9 0.719
NZ_LN829119_2 2.38|3471674|32|NZ_LN829119|PILER-CR 3471674-3471705 32 NC_025127 Vibrio sp. 04Ya090 plasmid pAQU2 DNA, complete sequence 44833-44864 9 0.719
NZ_LN829119_2 2.38|3471674|32|NZ_LN829119|PILER-CR 3471674-3471705 32 NC_016983 Photobacterium damselae subsp. damselae plasmid pAQU1, complete sequence 53190-53221 9 0.719
NZ_LN829119_2 2.38|3471674|32|NZ_LN829119|PILER-CR 3471674-3471705 32 NZ_CP034301 Vibrio parahaemolyticus strain 20160303005-1 plasmid pVPSD2016-2, complete sequence 165826-165857 9 0.719
NZ_LN829119_2 2.38|3471674|32|NZ_LN829119|PILER-CR 3471674-3471705 32 KX957970 Vibrio parahaemolyticus plasmid pVPS43, complete sequence 4797-4828 9 0.719
NZ_LN829119_2 2.38|3471674|32|NZ_LN829119|PILER-CR 3471674-3471705 32 KX957971 Vibrio parahaemolyticus plasmid pVPS62, complete sequence 4797-4828 9 0.719
NZ_LN829119_2 2.38|3471674|32|NZ_LN829119|PILER-CR 3471674-3471705 32 KX957972 Vibrio parahaemolyticus plasmid pVPS91, complete sequence 4797-4828 9 0.719
NZ_LN829119_2 2.38|3471674|32|NZ_LN829119|PILER-CR 3471674-3471705 32 KX957968 Vibrio alginolyticus plasmid pVAS19, complete sequence 4797-4828 9 0.719
NZ_LN829119_2 2.38|3471674|32|NZ_LN829119|PILER-CR 3471674-3471705 32 KX957969 Vibrio alginolyticus plasmid pVAS114, complete sequence 4797-4828 9 0.719
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 320009-320040 9 0.719
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 364258-364289 9 0.719
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 325528-325559 9 0.719
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 746608-746639 9 0.719
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 156069-156100 9 0.719
NZ_LN829119_2 2.43|3471979|32|NZ_LN829119|PILER-CR 3471979-3472010 32 MK977696 Gordonia phage SCentae, complete genome 98900-98931 9 0.719
NZ_LN829119_2 2.43|3471979|32|NZ_LN829119|PILER-CR 3471979-3472010 32 MK977695 Gordonia phage Pupper, complete genome 98749-98780 9 0.719
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 463372-463403 10 0.688
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 NZ_CP050081 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence 148108-148139 10 0.688
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 148506-148537 10 0.688
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 603741-603772 10 0.688
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 285896-285927 10 0.688
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 NZ_CP021127 Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence 56105-56136 10 0.688
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 27130-27161 10 0.688
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 NC_012848 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence 139674-139705 10 0.688
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 57713-57744 10 0.688
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 987564-987595 10 0.688
NZ_LN829119_2 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT 3471917-3471948 32 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 146591-146622 10 0.688
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 463372-463403 10 0.688
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 NZ_CP050081 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence 148108-148139 10 0.688
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 148506-148537 10 0.688
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 603741-603772 10 0.688
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 285896-285927 10 0.688
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 NZ_CP021127 Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence 56105-56136 10 0.688
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 27130-27161 10 0.688
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 NC_012848 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence 139674-139705 10 0.688
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 57713-57744 10 0.688
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 987564-987595 10 0.688
NZ_LN829119_2 2.42|3471918|32|NZ_LN829119|PILER-CR 3471918-3471949 32 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 146591-146622 10 0.688
NZ_LN829119_2 2.5|3470636|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR 3470636-3470667 32 NC_025128 Vibrio vulnificus 48/10 plasmid p48/10 complete sequence 26406-26437 11 0.656
NZ_LN829119_2 2.25|3471856|32|NZ_LN829119|CRISPRCasFinder,CRT 3471856-3471887 32 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1297717-1297748 11 0.656
NZ_LN829119_2 2.41|3471857|32|NZ_LN829119|PILER-CR 3471857-3471888 32 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1297717-1297748 11 0.656

1. spacer 1.5|577076|25|NZ_LN829119|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84

agaacgtccgaacgggcgaacgcag	CRISPR spacer
ggaacgcccgaacgggcggacgcaa	Protospacer
.*****.***********.*****.

2. spacer 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 6, identity: 0.812

ggtggagcgggaaaagctgcccgtt---gatcgtg	CRISPR spacer
gctgaagccggaaaagctgcccgttctcgatc---	Protospacer
* **.*** ****************   ****   

3. spacer 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggtggagcgggaaaagctgcccgttgatcgtg	CRISPR spacer
ggtcgagcgggaaaaggtgcccgtcaggcgcg	Protospacer
*** ************ *******... **.*

4. spacer 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.781

ggtggagcgggaaaagctgcccgttgatcgtg	CRISPR spacer
cgttaagcgggaaaatccgcccgttgattttg	Protospacer
 ** .********** *.**********. **

5. spacer 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.781

ggtggagcgggaaaagctgcccgttgatcgtg	CRISPR spacer
cgttaagcgggaaaatccgcccgttgattttg	Protospacer
 ** .********** *.**********. **

6. spacer 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 7, identity: 0.781

ggtggagcgggaaaagctgcccgttgatcgtg	CRISPR spacer
cgttaagcgggaaaatccgcccgttgattttg	Protospacer
 ** .********** *.**********. **

7. spacer 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 7, identity: 0.781

ggtggagcgggaaaagctgcccgtt--gatcgtg	CRISPR spacer
cttggagcgggaaaagccgccggttccgatca--	Protospacer
  ***************.*** ***  ****.  

8. spacer 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.781

ggtggagcgggaaaagctgcccgttgatcgtg	CRISPR spacer
cgttaagcgggaaaatccgcccgttgattttg	Protospacer
 ** .********** *.**********. **

9. spacer 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.781

ggtggagcgggaaaagctgcccgttgatcgtg	CRISPR spacer
cgttaagcgggaaaatccgcccgttgattttg	Protospacer
 ** .********** *.**********. **

10. spacer 2.11|3471002|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 7, identity: 0.781

acctcgcgcagtggaatgctgatgga-gacata	CRISPR spacer
gcttcgcgcagtggaaggctcatggagggcgt-	Protospacer
.*.************* *** ***** *.*.* 

11. spacer 2.15|3471246|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP045296 (Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

cgccaatgcaatcgctggaggtgttacgggag	CRISPR spacer
cttcgatgcaatcgctggaggagttccggatg	Protospacer
* .*.**************** *** ***. *

12. spacer 2.25|3471856|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ttcctcgtagtggctgagatagcgcgtccgtg-	CRISPR spacer
tttctcgtagtggctgagatcgc-cgagcacgg	Protospacer
**.***************** ** **  *..* 

13. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to MF979563 (Pectobacterium phage DU_PP_IV, complete genome) position: , mismatch: 7, identity: 0.781

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
gatgaagccaagaacggcaccaaccaatgatc	Protospacer
******* ***** ***********  *  .*

14. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to MF979560 (Pectobacterium phage DU_PP_I, complete genome) position: , mismatch: 7, identity: 0.781

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
gatgaagccaagaacggcaccaaccaatgatc	Protospacer
******* ***** ***********  *  .*

15. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to KC954774 (Cronobacter phage CR8, complete genome) position: , mismatch: 7, identity: 0.781

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
gatgaagccaagaacggcaccaaccaatgatc	Protospacer
******* ***** ***********  *  .*

16. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NC_028672 (Cronobacter phage PBES 02, complete genome) position: , mismatch: 7, identity: 0.781

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
gatgaagccaagaacggcaccaaccaatgatc	Protospacer
******* ***** ***********  *  .*

17. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NC_017974 (Cronobacter phage CR3, complete genome) position: , mismatch: 7, identity: 0.781

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
gatgaagccaagaacggcaccaaccaatgatc	Protospacer
******* ***** ***********  *  .*

18. spacer 2.31|3471247|32|NZ_LN829119|PILER-CR matches to NZ_CP045296 (Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

cgccaatgcaatcgctggaggtgttacgggag	CRISPR spacer
cttcgatgcaatcgctggaggagttccggatg	Protospacer
* .*.**************** *** ***. *

19. spacer 2.41|3471857|32|NZ_LN829119|PILER-CR matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ttcctcgtagtggctgagatagcgcgtccgtg-	CRISPR spacer
tttctcgtagtggctgagatcgc-cgagcacgg	Protospacer
**.***************** ** **  *..* 

20. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to MF979563 (Pectobacterium phage DU_PP_IV, complete genome) position: , mismatch: 7, identity: 0.781

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
gatgaagccaagaacggcaccaaccaatgatc	Protospacer
******* ***** ***********  *  .*

21. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to MF979560 (Pectobacterium phage DU_PP_I, complete genome) position: , mismatch: 7, identity: 0.781

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
gatgaagccaagaacggcaccaaccaatgatc	Protospacer
******* ***** ***********  *  .*

22. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to KC954774 (Cronobacter phage CR8, complete genome) position: , mismatch: 7, identity: 0.781

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
gatgaagccaagaacggcaccaaccaatgatc	Protospacer
******* ***** ***********  *  .*

23. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to NC_028672 (Cronobacter phage PBES 02, complete genome) position: , mismatch: 7, identity: 0.781

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
gatgaagccaagaacggcaccaaccaatgatc	Protospacer
******* ***** ***********  *  .*

24. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to NC_017974 (Cronobacter phage CR3, complete genome) position: , mismatch: 7, identity: 0.781

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
gatgaagccaagaacggcaccaaccaatgatc	Protospacer
******* ***** ***********  *  .*

25. spacer 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.75

ggtggagcgggaaaagctgcccgttgatcgtg	CRISPR spacer
cgatgagcgggagaagctgcccggtgatggcc	Protospacer
 *  ********.********** **** *. 

26. spacer 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

ggtggagcgggaaaagctgcccg-----ttgatcgtg	CRISPR spacer
ggtggtgctggaaaagctgcccgagtccttgg-----	Protospacer
***** ** **************     ***.     

27. spacer 2.6|3470697|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 8, identity: 0.75

ggtggagcgggaaaagctgcccg-----ttgatcgtg	CRISPR spacer
ggtggtgctggaaaagctgcccgagtccttgg-----	Protospacer
***** ** **************     ***.     

28. spacer 2.27|3471978|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP041206 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-3, complete sequence) position: , mismatch: 8, identity: 0.75

gatccggtcaatgtcaagcttgacgacgccgg	CRISPR spacer
cttccggtcgatggcaagcttgacgcagacgt	Protospacer
  *******.*** ***********  * ** 

29. spacer 2.43|3471979|32|NZ_LN829119|PILER-CR matches to NZ_CP041206 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-3, complete sequence) position: , mismatch: 8, identity: 0.75

gatccggtcaatgtcaagcttgacgacgccgg	CRISPR spacer
cttccggtcgatggcaagcttgacgcagacgt	Protospacer
  *******.*** ***********  * ** 

30. spacer 2.20|3471551|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP014308 (Burkholderia sp. PAMC 26561 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gatgcctcctagagcctcctgaactggggtag	CRISPR spacer
aagcgcatctagagcctcctgaacagggttac	Protospacer
.*   * .**************** *** ** 

31. spacer 2.20|3471551|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP014309 (Burkholderia sp. PAMC 26561 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gatgcctcctagagcctcctgaactggggtag	CRISPR spacer
aagcgcatctagagcctcctgaacagggttac	Protospacer
.*   * .**************** *** ** 

32. spacer 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP014052 (Vibrio alginolyticus strain FDAARGOS_108 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

33. spacer 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_KP688397 (Vibrio parahaemolyticus strain V36 plasmid pVPH1, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

34. spacer 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_KP791968 (Vibrio parahaemolyticus strain 2011VPH2 plasmid pVPH2, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

35. spacer 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP025539 (Vibrio harveyi strain 345 plasmid p345-185, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

36. spacer 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT matches to MN865127 (Vibrio alginolyticus strain C1579 plasmid pC1579, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

37. spacer 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NC_025127 (Vibrio sp. 04Ya090 plasmid pAQU2 DNA, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

38. spacer 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NC_016983 (Photobacterium damselae subsp. damselae plasmid pAQU1, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

39. spacer 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP034301 (Vibrio parahaemolyticus strain 20160303005-1 plasmid pVPSD2016-2, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

40. spacer 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT matches to KX957970 (Vibrio parahaemolyticus plasmid pVPS43, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

41. spacer 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT matches to KX957971 (Vibrio parahaemolyticus plasmid pVPS62, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

42. spacer 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT matches to KX957972 (Vibrio parahaemolyticus plasmid pVPS91, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

43. spacer 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT matches to KX957968 (Vibrio alginolyticus plasmid pVAS19, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

44. spacer 2.22|3471673|32|NZ_LN829119|CRISPRCasFinder,CRT matches to KX957969 (Vibrio alginolyticus plasmid pVAS114, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

45. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 9, identity: 0.719

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgctgc	Protospacer
 ****************** * ** .. .* *

46. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 9, identity: 0.719

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacattgccgc	Protospacer
 ****************** * ** .* .. *

47. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 9, identity: 0.719

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgctgc	Protospacer
 ****************** * ** .. .* *

48. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
gccgacgacaagaccggcagcaacccgccgtc	Protospacer
* .** ************* ****** .. .*

49. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
gccgacgacaagaccggcagcaacccgccgtc	Protospacer
* .** ************* ****** .. .*

50. spacer 2.27|3471978|32|NZ_LN829119|CRISPRCasFinder,CRT matches to MK977696 (Gordonia phage SCentae, complete genome) position: , mismatch: 9, identity: 0.719

gatccggtcaatgtcaagcttgacgacgccgg	CRISPR spacer
gaggaggtccatgtcgagcttgacgacggtct	Protospacer
**   **** *****.************ .  

51. spacer 2.27|3471978|32|NZ_LN829119|CRISPRCasFinder,CRT matches to MK977695 (Gordonia phage Pupper, complete genome) position: , mismatch: 9, identity: 0.719

gatccggtcaatgtcaagcttgacgacgccgg	CRISPR spacer
gaggaggtccatgtcgagcttgacgacggtct	Protospacer
**   **** *****.************ .  

52. spacer 2.36|3471552|32|NZ_LN829119|PILER-CR matches to NZ_CP014308 (Burkholderia sp. PAMC 26561 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gatgcctcctagagcctcctgaactggggtag	CRISPR spacer
aagcgcatctagagcctcctgaacagggttac	Protospacer
.*   * .**************** *** ** 

53. spacer 2.36|3471552|32|NZ_LN829119|PILER-CR matches to NZ_CP014309 (Burkholderia sp. PAMC 26561 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gatgcctcctagagcctcctgaactggggtag	CRISPR spacer
aagcgcatctagagcctcctgaacagggttac	Protospacer
.*   * .**************** *** ** 

54. spacer 2.38|3471674|32|NZ_LN829119|PILER-CR matches to NZ_CP014052 (Vibrio alginolyticus strain FDAARGOS_108 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

55. spacer 2.38|3471674|32|NZ_LN829119|PILER-CR matches to NZ_KP688397 (Vibrio parahaemolyticus strain V36 plasmid pVPH1, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

56. spacer 2.38|3471674|32|NZ_LN829119|PILER-CR matches to NZ_KP791968 (Vibrio parahaemolyticus strain 2011VPH2 plasmid pVPH2, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

57. spacer 2.38|3471674|32|NZ_LN829119|PILER-CR matches to NZ_CP025539 (Vibrio harveyi strain 345 plasmid p345-185, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

58. spacer 2.38|3471674|32|NZ_LN829119|PILER-CR matches to MN865127 (Vibrio alginolyticus strain C1579 plasmid pC1579, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

59. spacer 2.38|3471674|32|NZ_LN829119|PILER-CR matches to NC_025127 (Vibrio sp. 04Ya090 plasmid pAQU2 DNA, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

60. spacer 2.38|3471674|32|NZ_LN829119|PILER-CR matches to NC_016983 (Photobacterium damselae subsp. damselae plasmid pAQU1, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

61. spacer 2.38|3471674|32|NZ_LN829119|PILER-CR matches to NZ_CP034301 (Vibrio parahaemolyticus strain 20160303005-1 plasmid pVPSD2016-2, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

62. spacer 2.38|3471674|32|NZ_LN829119|PILER-CR matches to KX957970 (Vibrio parahaemolyticus plasmid pVPS43, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

63. spacer 2.38|3471674|32|NZ_LN829119|PILER-CR matches to KX957971 (Vibrio parahaemolyticus plasmid pVPS62, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

64. spacer 2.38|3471674|32|NZ_LN829119|PILER-CR matches to KX957972 (Vibrio parahaemolyticus plasmid pVPS91, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

65. spacer 2.38|3471674|32|NZ_LN829119|PILER-CR matches to KX957968 (Vibrio alginolyticus plasmid pVAS19, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

66. spacer 2.38|3471674|32|NZ_LN829119|PILER-CR matches to KX957969 (Vibrio alginolyticus plasmid pVAS114, complete sequence) position: , mismatch: 9, identity: 0.719

ttgttgccgctgcgttctcatgacgtaaggac	CRISPR spacer
attttggccctgcgttctcatgacgtagttca	Protospacer
 * *** * ******************.    

67. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 9, identity: 0.719

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgctgc	Protospacer
 ****************** * ** .. .* *

68. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 9, identity: 0.719

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacattgccgc	Protospacer
 ****************** * ** .* .. *

69. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 9, identity: 0.719

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgctgc	Protospacer
 ****************** * ** .. .* *

70. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
gccgacgacaagaccggcagcaacccgccgtc	Protospacer
* .** ************* ****** .. .*

71. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
gccgacgacaagaccggcagcaacccgccgtc	Protospacer
* .** ************* ****** .. .*

72. spacer 2.43|3471979|32|NZ_LN829119|PILER-CR matches to MK977696 (Gordonia phage SCentae, complete genome) position: , mismatch: 9, identity: 0.719

gatccggtcaatgtcaagcttgacgacgccgg	CRISPR spacer
gaggaggtccatgtcgagcttgacgacggtct	Protospacer
**   **** *****.************ .  

73. spacer 2.43|3471979|32|NZ_LN829119|PILER-CR matches to MK977695 (Gordonia phage Pupper, complete genome) position: , mismatch: 9, identity: 0.719

gatccggtcaatgtcaagcttgacgacgccgg	CRISPR spacer
gaggaggtccatgtcgagcttgacgacggtct	Protospacer
**   **** *****.************ .  

74. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

75. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

76. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

77. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

78. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

79. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

80. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

81. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgcggc	Protospacer
 ****************** * ** .. .  *

82. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

83. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

84. spacer 2.26|3471917|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

85. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

86. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

87. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

88. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

89. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

90. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

91. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

92. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgcggc	Protospacer
 ****************** * ** .. .  *

93. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

94. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

95. spacer 2.42|3471918|32|NZ_LN829119|PILER-CR matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 10, identity: 0.688

gatgaagacaagaccggcaccaacccttttcc	CRISPR spacer
tatgaagacaagaccggcaaccacatcgccgc	Protospacer
 ****************** * ** .. .. *

96. spacer 2.5|3470636|32|NZ_LN829119|CRISPRCasFinder,CRT,PILER-CR matches to NC_025128 (Vibrio vulnificus 48/10 plasmid p48/10 complete sequence) position: , mismatch: 11, identity: 0.656

cctgttgggtggttgcgattatcacatcgatc	CRISPR spacer
ttatctgggtgcttgagattatcacatcttca	Protospacer
..  .****** *** ************  . 

97. spacer 2.25|3471856|32|NZ_LN829119|CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 11, identity: 0.656

ttcctcgtagtggctgagatagcgcgtccgtg	CRISPR spacer
aggctcgtaggggctgagatcgcgcggatacc	Protospacer
   ******* ********* *****  ... 

98. spacer 2.41|3471857|32|NZ_LN829119|PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 11, identity: 0.656

ttcctcgtagtggctgagatagcgcgtccgtg	CRISPR spacer
aggctcgtaggggctgagatcgcgcggatacc	Protospacer
   ******* ********* *****  ... 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2536939 : 2546656 10 uncultured_Mediterranean_phage(75.0%) tRNA NA
DBSCAN-SWA_2 3381070 : 3396287 16 Salmonella_phage(18.18%) protease,tail,portal,capsid,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage