Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010429 Spirosoma radiotolerans strain DG5A chromosome, complete genome 4 crisprs cas3,cas4,cas2,cas1,cas6,cas5,cas7b,cas8b1,WYL,DEDDh,csa3,PD-DExK,Cas9_archaeal 1 0 1 0

Results visualization

1. NZ_CP010429
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010429_1 131565-131640 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010429_2 717855-717953 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010429_3 1472362-1475569 TypeI-B ?
43 spacers
cas4,cas2,cas1,cas6,cas3,cas5,cas7b,cas8b1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010429_4 3856298-3856399 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP010429_4 4.1|3856329|40|NZ_CP010429|CRISPRCasFinder 3856329-3856368 40 NZ_CP010429.1 3856391-3856430 0 1.0

1. spacer 4.1|3856329|40|NZ_CP010429|CRISPRCasFinder matches to position: 3856391-3856430, mismatch: 0, identity: 1.0

acttaaaaccttggactgttcggttttgagaaacctcacc	CRISPR spacer
acttaaaaccttggactgttcggttttgagaaacctcacc	Protospacer
****************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5075512 : 5135848 42 uncultured_Mediterranean_phage(25.0%) tRNA,transposase,integrase attL 5079259:5079311|attR 5135997:5136049
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage