Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP011006 Psychromicrobium lacuslunae strain IHBB 11108 plasmid pAG001, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP011005 Psychromicrobium lacuslunae strain IHBB 11108 chromosome, complete genome 1 crisprs csa3,DinG,WYL,DEDDh,RT 0 1 2 0

Results visualization

1. NZ_CP011005
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011005_1 750392-750469 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP011005_1 1.1|750415|32|NZ_CP011005|CRISPRCasFinder 750415-750446 32 MH536823 Microbacterium phage Musetta, complete genome 54794-54825 8 0.75
NZ_CP011005_1 1.1|750415|32|NZ_CP011005|CRISPRCasFinder 750415-750446 32 MH371108 Microbacterium phage Fork, complete genome 54548-54579 8 0.75
NZ_CP011005_1 1.1|750415|32|NZ_CP011005|CRISPRCasFinder 750415-750446 32 MH371109 Microbacterium phage Lyell, complete genome 54441-54472 8 0.75

1. spacer 1.1|750415|32|NZ_CP011005|CRISPRCasFinder matches to MH536823 (Microbacterium phage Musetta, complete genome) position: , mismatch: 8, identity: 0.75

gagctagcgaggcgtgggaggggcgatacgcg	CRISPR spacer
tcgacaacgatgcgtgggaggggcgattcgag	Protospacer
  * .*.*** **************** ** *

2. spacer 1.1|750415|32|NZ_CP011005|CRISPRCasFinder matches to MH371108 (Microbacterium phage Fork, complete genome) position: , mismatch: 8, identity: 0.75

gagctagcgaggcgtgggaggggcgatacgcg	CRISPR spacer
tcgacaacgatgcgtgggaggggcgattcgag	Protospacer
  * .*.*** **************** ** *

3. spacer 1.1|750415|32|NZ_CP011005|CRISPRCasFinder matches to MH371109 (Microbacterium phage Lyell, complete genome) position: , mismatch: 8, identity: 0.75

gagctagcgaggcgtgggaggggcgatacgcg	CRISPR spacer
tcgacaacgatgcgtgggaggggcgattcgag	Protospacer
  * .*.*** **************** ** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1511675 : 1520635 8 Bacillus_virus(16.67%) tRNA NA
DBSCAN-SWA_2 3083344 : 3094925 13 Microbacterium_phage(33.33%) capsid,portal,protease,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage