Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009903 Yersinia pestis Antiqua plasmid pPCP, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP009906 Yersinia pestis Antiqua chromosome, complete genome 6 crisprs DEDDh,cas3,cas6f,cas7f,cas5f,cas8f,cas3f,cas1,csa3,DinG 5 12 11 1
NZ_CP009904 Yersinia pestis Antiqua plasmid pMT, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP009905 Yersinia pestis Antiqua plasmid pCD, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP009906
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009906_1 588099-588488 TypeI-F I-F
6 spacers
cas1,cas3f,cas8f,cas5f,cas7f,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009906_2 1202130-1202340 Orphan I-F
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009906_3 1877218-1877297 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009906_4 3203879-3203991 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009906_5 3953770-3953891 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009906_6 4080798-4081005 Orphan I-F
3 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP009906_1 1.5|588367|32|NZ_CP009906|CRISPRCasFinder,CRT 588367-588398 32 NZ_CP009906.1 699306-699337 0 1.0
NZ_CP009906_1 1.10|588367|29|NZ_CP009906|PILER-CR 588367-588395 29 NZ_CP009906.1 699309-699337 0 1.0
NZ_CP009906_2 2.1|1202158|32|NZ_CP009906|CRISPRCasFinder 1202158-1202189 32 NZ_CP009906.1 39422-39453 0 1.0
NZ_CP009906_2 2.4|1202159|31|NZ_CP009906|CRT 1202159-1202189 31 NZ_CP009906.1 39422-39452 0 1.0
NZ_CP009906_2 2.7|1202163|31|NZ_CP009906|PILER-CR 1202163-1202193 31 NZ_CP009906.1 39422-39452 0 1.0

1. spacer 1.5|588367|32|NZ_CP009906|CRISPRCasFinder,CRT matches to position: 699306-699337, mismatch: 0, identity: 1.0

acatcactagcggtatcgaacaattgagcgag	CRISPR spacer
acatcactagcggtatcgaacaattgagcgag	Protospacer
********************************

2. spacer 1.10|588367|29|NZ_CP009906|PILER-CR matches to position: 699309-699337, mismatch: 0, identity: 1.0

acatcactagcggtatcgaacaattgagc	CRISPR spacer
acatcactagcggtatcgaacaattgagc	Protospacer
*****************************

3. spacer 2.1|1202158|32|NZ_CP009906|CRISPRCasFinder matches to position: 39422-39453, mismatch: 0, identity: 1.0

tctgtacgcataccgccatcttgcatcagtct	CRISPR spacer
tctgtacgcataccgccatcttgcatcagtct	Protospacer
********************************

4. spacer 2.4|1202159|31|NZ_CP009906|CRT matches to position: 39422-39452, mismatch: 0, identity: 1.0

ctgtacgcataccgccatcttgcatcagtct	CRISPR spacer
ctgtacgcataccgccatcttgcatcagtct	Protospacer
*******************************

5. spacer 2.7|1202163|31|NZ_CP009906|PILER-CR matches to position: 39422-39452, mismatch: 0, identity: 1.0

ctgtacgcataccgccatcttgcatcagtct	CRISPR spacer
ctgtacgcataccgccatcttgcatcagtct	Protospacer
*******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009906_2 2.1|1202158|32|NZ_CP009906|CRISPRCasFinder 1202158-1202189 32 MT374852 Yersinia phage vB_YpM_3, complete genome 12-43 0 1.0
NZ_CP009906_2 2.4|1202159|31|NZ_CP009906|CRT 1202159-1202189 31 MT374852 Yersinia phage vB_YpM_3, complete genome 12-42 0 1.0
NZ_CP009906_2 2.7|1202163|31|NZ_CP009906|PILER-CR 1202163-1202193 31 MT374852 Yersinia phage vB_YpM_3, complete genome 12-42 0 1.0
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 MK820641 Gordonia phage EnalisNailo, complete genome 34088-34119 6 0.812
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 MK878898 Gordonia phage Zameen, complete genome 34513-34544 6 0.812
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 MK919483 Gordonia phage Suscepit, complete genome 34514-34545 6 0.812
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 MK284520 Gordonia phage Lilas, complete genome 35799-35830 6 0.812
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 MK016492 Gordonia phage Bialota, complete genome 35265-35296 6 0.812
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 MK820642 Gordonia phage Polly, complete genome 33956-33987 6 0.812
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 NC_041883 Gordonia phage Attis, complete genome 31646-31677 6 0.812
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 MK814755 Gordonia phage Antonio, complete genome 34513-34544 6 0.812
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 MK875796 Gordonia phage Tayonia, complete genome 34513-34544 6 0.812
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 MK801734 Gordonia phage LordFarquaad, complete genome 31627-31658 6 0.812
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 MK433274 Gordonia phage Bradissa, complete genome 34554-34585 6 0.812
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 KU963257 Gordonia phage Kita, complete genome 34522-34553 6 0.812
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 NC_031251 Gordonia phage SoilAssassin, complete genome 31645-31676 6 0.812
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 NC_031097 Gordonia phage Zirinka, complete genome 35253-35284 6 0.812
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 NZ_CP005086 Sphingobium sp. TKS plasmid pTK2, complete sequence 138555-138586 6 0.812
NZ_CP009906_1 1.1|588127|32|NZ_CP009906|CRISPRCasFinder,CRT 588127-588158 32 CP049262 Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence 69636-69667 7 0.781
NZ_CP009906_1 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT 588247-588278 32 JF974294 Aeromonas phage pIS4-A genomic sequence 21965-21996 7 0.781
NZ_CP009906_1 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT 588247-588278 32 NC_021534 Vibrio phage pYD38-A genomic sequence 3299-3330 7 0.781
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 440819-440850 7 0.781
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 282870-282901 7 0.781
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 KJ433975 Mycobacterium phage 40BC, complete genome 23231-23262 7 0.781
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 KJ433973 Mycobacterium phage 39HC, complete genome 23231-23262 7 0.781
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 NC_024145 Mycobacterium phage Hosp, complete genome 21427-21458 7 0.781
NZ_CP009906_1 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT 588427-588460 34 MT133560 Pseudomonas phage fnug, complete genome 23366-23399 7 0.794
NZ_CP009906_1 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT 588427-588460 34 KU521356 Pseudomonas phage KTN4, complete genome 24115-24148 7 0.794
NZ_CP009906_1 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT 588427-588460 34 MW057919 Pseudomonas phage vB_PaeM_kmuB, complete genome 24251-24284 7 0.794
NZ_CP009906_1 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT 588427-588460 34 NC_004629 Pseudomonas phage phiKZ, complete genome 22484-22517 7 0.794
NZ_CP009906_1 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT 588427-588460 34 MN871480 UNVERIFIED: Pseudomonas phage PaSz-1_45_270k, complete genome 259590-259623 7 0.794
NZ_CP009906_1 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT 588427-588460 34 MN871489 UNVERIFIED: Pseudomonas phage PaZh_1, complete genome 12439-12472 7 0.794
NZ_CP009906_1 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT 588427-588460 34 NC_042081 Pseudomonas phage SL2, complete genome 262490-262523 7 0.794
NZ_CP009906_1 1.8|588247|29|NZ_CP009906|PILER-CR 588247-588275 29 MF679145 Escherichia coli plasmid pBJ114-96, complete sequence 37586-37614 7 0.759
NZ_CP009906_1 1.8|588247|29|NZ_CP009906|PILER-CR 588247-588275 29 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 60831-60859 7 0.759
NZ_CP009906_1 1.8|588247|29|NZ_CP009906|PILER-CR 588247-588275 29 NZ_CP021340 Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence 67671-67699 7 0.759
NZ_CP009906_1 1.8|588247|29|NZ_CP009906|PILER-CR 588247-588275 29 NZ_CP021336 Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence 67672-67700 7 0.759
NZ_CP009906_1 1.8|588247|29|NZ_CP009906|PILER-CR 588247-588275 29 NZ_CP040920 Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence 33438-33466 7 0.759
NZ_CP009906_1 1.8|588247|29|NZ_CP009906|PILER-CR 588247-588275 29 NZ_CP024832 Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence 33830-33858 7 0.759
NZ_CP009906_1 1.8|588247|29|NZ_CP009906|PILER-CR 588247-588275 29 NZ_CP024817 Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence 62769-62797 7 0.759
NZ_CP009906_1 1.8|588247|29|NZ_CP009906|PILER-CR 588247-588275 29 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 15616-15644 7 0.759
NZ_CP009906_1 1.8|588247|29|NZ_CP009906|PILER-CR 588247-588275 29 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 112580-112608 7 0.759
NZ_CP009906_1 1.8|588247|29|NZ_CP009906|PILER-CR 588247-588275 29 NZ_CP023961 Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence 16858-16886 7 0.759
NZ_CP009906_1 1.8|588247|29|NZ_CP009906|PILER-CR 588247-588275 29 AP023222 Escherichia coli M505 plasmid pM505-b DNA, complete genome 93737-93765 7 0.759
NZ_CP009906_1 1.8|588247|29|NZ_CP009906|PILER-CR 588247-588275 29 AP023233 Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome 47570-47598 7 0.759
NZ_CP009906_1 1.8|588247|29|NZ_CP009906|PILER-CR 588247-588275 29 NZ_CP019075 Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence 16520-16548 7 0.759
NZ_CP009906_1 1.8|588247|29|NZ_CP009906|PILER-CR 588247-588275 29 NZ_CP015837 Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence 3287-3315 7 0.759
NZ_CP009906_1 1.8|588247|29|NZ_CP009906|PILER-CR 588247-588275 29 NZ_CP011063 Escherichia coli str. Sanji plasmid pSJ_98, complete sequence 37637-37665 7 0.759
NZ_CP009906_1 1.8|588247|29|NZ_CP009906|PILER-CR 588247-588275 29 JF974294 Aeromonas phage pIS4-A genomic sequence 21968-21996 7 0.759
NZ_CP009906_1 1.8|588247|29|NZ_CP009906|PILER-CR 588247-588275 29 NC_021534 Vibrio phage pYD38-A genomic sequence 3299-3327 7 0.759
NZ_CP009906_1 1.9|588307|29|NZ_CP009906|PILER-CR 588307-588335 29 NZ_CP005086 Sphingobium sp. TKS plasmid pTK2, complete sequence 138555-138583 7 0.759
NZ_CP009906_6 6.2|4080886|32|NZ_CP009906|PILER-CR,CRISPRCasFinder,CRT 4080886-4080917 32 MH616963 CrAssphage sp. isolate ctbg_1, complete genome 86942-86973 7 0.781
NZ_CP009906_1 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT 588427-588460 34 DI373487 KR 1020130142837-A/1: Bacteriophage of Pseudomonas aeruginosa and uses thereof 4948-4981 8 0.765
NZ_CP009906_1 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT 588427-588460 34 NC_042060 Pseudomonas phage PA7, partial genome 4948-4981 8 0.765
NZ_CP009906_1 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT 588427-588460 34 AP019418 Pseudomonas phage PA02 DNA, nearly complete genome 200537-200570 8 0.765
NZ_CP009906_1 1.7|588187|29|NZ_CP009906|PILER-CR 588187-588215 29 AP014500 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S32-C79, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces 26489-26517 8 0.724
NZ_CP009906_6 6.2|4080886|32|NZ_CP009906|PILER-CR,CRISPRCasFinder,CRT 4080886-4080917 32 NZ_CP010358 Acinetobacter johnsonii XBB1 plasmid pXBB1-8, complete sequence 46720-46751 8 0.75
NZ_CP009906_6 6.2|4080886|32|NZ_CP009906|PILER-CR,CRISPRCasFinder,CRT 4080886-4080917 32 NC_019694 Oscillatoria acuminata PCC 6304 plasmid pOSCIL6304.02, complete sequence 20911-20942 8 0.75
NZ_CP009906_1 1.2|588187|32|NZ_CP009906|CRISPRCasFinder,CRT 588187-588218 32 NZ_CP031943 Nostoc sphaeroides strain Kutzing En plasmid p2, complete sequence 4006-4037 9 0.719
NZ_CP009906_1 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT 588247-588278 32 MF679145 Escherichia coli plasmid pBJ114-96, complete sequence 37586-37617 9 0.719
NZ_CP009906_1 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT 588247-588278 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 60831-60862 9 0.719
NZ_CP009906_1 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT 588247-588278 32 NZ_CP021340 Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence 67671-67702 9 0.719
NZ_CP009906_1 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT 588247-588278 32 NZ_CP021336 Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence 67672-67703 9 0.719
NZ_CP009906_1 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT 588247-588278 32 NZ_CP040920 Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence 33435-33466 9 0.719
NZ_CP009906_1 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT 588247-588278 32 NZ_CP024832 Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence 33830-33861 9 0.719
NZ_CP009906_1 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT 588247-588278 32 NZ_CP024817 Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence 62769-62800 9 0.719
NZ_CP009906_1 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT 588247-588278 32 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 15616-15647 9 0.719
NZ_CP009906_1 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT 588247-588278 32 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 112580-112611 9 0.719
NZ_CP009906_1 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT 588247-588278 32 NZ_CP023961 Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence 16858-16889 9 0.719
NZ_CP009906_1 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT 588247-588278 32 AP023222 Escherichia coli M505 plasmid pM505-b DNA, complete genome 93734-93765 9 0.719
NZ_CP009906_1 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT 588247-588278 32 AP023233 Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome 47570-47601 9 0.719
NZ_CP009906_1 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT 588247-588278 32 NZ_CP019075 Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence 16520-16551 9 0.719
NZ_CP009906_1 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT 588247-588278 32 NZ_CP015837 Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence 3287-3318 9 0.719
NZ_CP009906_1 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT 588247-588278 32 NZ_CP011063 Escherichia coli str. Sanji plasmid pSJ_98, complete sequence 37637-37668 9 0.719
NZ_CP009906_6 6.2|4080886|32|NZ_CP009906|PILER-CR,CRISPRCasFinder,CRT 4080886-4080917 32 MT774386 CrAssphage cr110_1, complete genome 42858-42889 9 0.719
NZ_CP009906_6 6.2|4080886|32|NZ_CP009906|PILER-CR,CRISPRCasFinder,CRT 4080886-4080917 32 NZ_CP028934 Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence 25849-25880 9 0.719
NZ_CP009906_1 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT 588307-588338 32 NZ_JX627581 Methylobacterium oryzae CBMB20 plasmid pMOC2, complete sequence 30496-30527 10 0.688

1. spacer 2.1|1202158|32|NZ_CP009906|CRISPRCasFinder matches to MT374852 (Yersinia phage vB_YpM_3, complete genome) position: , mismatch: 0, identity: 1.0

tctgtacgcataccgccatcttgcatcagtct	CRISPR spacer
tctgtacgcataccgccatcttgcatcagtct	Protospacer
********************************

2. spacer 2.4|1202159|31|NZ_CP009906|CRT matches to MT374852 (Yersinia phage vB_YpM_3, complete genome) position: , mismatch: 0, identity: 1.0

ctgtacgcataccgccatcttgcatcagtct	CRISPR spacer
ctgtacgcataccgccatcttgcatcagtct	Protospacer
*******************************

3. spacer 2.7|1202163|31|NZ_CP009906|PILER-CR matches to MT374852 (Yersinia phage vB_YpM_3, complete genome) position: , mismatch: 0, identity: 1.0

ctgtacgcataccgccatcttgcatcagtct	CRISPR spacer
ctgtacgcataccgccatcttgcatcagtct	Protospacer
*******************************

4. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to MK820641 (Gordonia phage EnalisNailo, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

5. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to MK878898 (Gordonia phage Zameen, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

6. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to MK919483 (Gordonia phage Suscepit, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

7. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to MK284520 (Gordonia phage Lilas, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

8. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to MK016492 (Gordonia phage Bialota, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

9. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to MK820642 (Gordonia phage Polly, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

10. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NC_041883 (Gordonia phage Attis, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

11. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to MK814755 (Gordonia phage Antonio, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

12. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to MK875796 (Gordonia phage Tayonia, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

13. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to MK801734 (Gordonia phage LordFarquaad, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

14. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to MK433274 (Gordonia phage Bradissa, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

15. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to KU963257 (Gordonia phage Kita, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

16. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NC_031251 (Gordonia phage SoilAssassin, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

17. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NC_031097 (Gordonia phage Zirinka, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

18. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NZ_CP005086 (Sphingobium sp. TKS plasmid pTK2, complete sequence) position: , mismatch: 6, identity: 0.812

tcgccattccgtgaacctgagcgcgttcgcga--	CRISPR spacer
tcgcctttccctgaacctga--gcgatcgtgacc	Protospacer
***** **** *********  *** ***.**  

19. spacer 1.1|588127|32|NZ_CP009906|CRISPRCasFinder,CRT matches to CP049262 (Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence) position: , mismatch: 7, identity: 0.781

tcaggggactggcgaacaatgtctttcatgat	CRISPR spacer
acgtcgcgctggcgaacaatctctttcatgat	Protospacer
 *.  * .************ ***********

20. spacer 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT matches to JF974294 (Aeromonas phage pIS4-A genomic sequence) position: , mismatch: 7, identity: 0.781

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attacctgaatggcatttgctttatgcctgat	Protospacer
****.************* ****.   * ***

21. spacer 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NC_021534 (Vibrio phage pYD38-A genomic sequence) position: , mismatch: 7, identity: 0.781

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attacctgaatggcatttgctttatgcctgat	Protospacer
****.************* ****.   * ***

22. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

----tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
cacctcgc----tcgggaacctgggcgcgttcgcga	Protospacer
    ****    .** *******.************

23. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.781

----tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
cacctcgc----tcgggaacctgggcgcgttcgcga	Protospacer
    ****    .** *******.************

24. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to KJ433975 (Mycobacterium phage 40BC, complete genome) position: , mismatch: 7, identity: 0.781

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
cccgccg-cccgtgtacccgagcgcgttcgcgc	Protospacer
 .****. .***** ***.************* 

25. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to KJ433973 (Mycobacterium phage 39HC, complete genome) position: , mismatch: 7, identity: 0.781

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
cccgccg-cccgtgtacccgagcgcgttcgcgc	Protospacer
 .****. .***** ***.************* 

26. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 7, identity: 0.781

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
cccgccg-cccgtgtacccgagcgcgttcgcgc	Protospacer
 .****. .***** ***.************* 

27. spacer 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT matches to MT133560 (Pseudomonas phage fnug, complete genome) position: , mismatch: 7, identity: 0.794

tcagtcccgttatggtgctggtgttgcccgtaag	CRISPR spacer
cgagactggttatggtgctggtggtgcccgtaac	Protospacer
. ** *. *************** ********* 

28. spacer 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT matches to KU521356 (Pseudomonas phage KTN4, complete genome) position: , mismatch: 7, identity: 0.794

tcagtcccgttatggtgctggtgttgcccgtaag	CRISPR spacer
cgagactggttatggtgctggtggtgcccgtaac	Protospacer
. ** *. *************** ********* 

29. spacer 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT matches to MW057919 (Pseudomonas phage vB_PaeM_kmuB, complete genome) position: , mismatch: 7, identity: 0.794

tcagtcccgttatggtgctggtgttgcccgtaag	CRISPR spacer
cgagactggttatggtgctggtggtgcccgtaac	Protospacer
. ** *. *************** ********* 

30. spacer 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT matches to NC_004629 (Pseudomonas phage phiKZ, complete genome) position: , mismatch: 7, identity: 0.794

tcagtcccgttatggtgctggtgttgcccgtaag	CRISPR spacer
cgagactggttatggtgctggtggtgcccgtaac	Protospacer
. ** *. *************** ********* 

31. spacer 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT matches to MN871480 (UNVERIFIED: Pseudomonas phage PaSz-1_45_270k, complete genome) position: , mismatch: 7, identity: 0.794

tcagtcccgttatggtgctggtgttgcccgtaag	CRISPR spacer
cgagactggttatggtgctggtggtgcccgtaac	Protospacer
. ** *. *************** ********* 

32. spacer 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT matches to MN871489 (UNVERIFIED: Pseudomonas phage PaZh_1, complete genome) position: , mismatch: 7, identity: 0.794

tcagtcccgttatggtgctggtgttgcccgtaag	CRISPR spacer
cgagactggttatggtgctggtggtgcccgtaac	Protospacer
. ** *. *************** ********* 

33. spacer 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT matches to NC_042081 (Pseudomonas phage SL2, complete genome) position: , mismatch: 7, identity: 0.794

tcagtcccgttatggtgctggtgttgcccgtaag	CRISPR spacer
cgagactggttatggtgctggtggtgcccgtaac	Protospacer
. ** *. *************** ********* 

34. spacer 1.8|588247|29|NZ_CP009906|PILER-CR matches to MF679145 (Escherichia coli plasmid pBJ114-96, complete sequence) position: , mismatch: 7, identity: 0.759

attatctgaatggcattttctttggcgca	CRISPR spacer
attatctgattggcagtttctttaactgt	Protospacer
********* ***** *******..*   

35. spacer 1.8|588247|29|NZ_CP009906|PILER-CR matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 7, identity: 0.759

attatctgaatggcattttctttggcgca	CRISPR spacer
attatctgattggcagtttctttaactgt	Protospacer
********* ***** *******..*   

36. spacer 1.8|588247|29|NZ_CP009906|PILER-CR matches to NZ_CP021340 (Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence) position: , mismatch: 7, identity: 0.759

attatctgaatggcattttctttggcgca	CRISPR spacer
attatctgattggcagtttctttaactgt	Protospacer
********* ***** *******..*   

37. spacer 1.8|588247|29|NZ_CP009906|PILER-CR matches to NZ_CP021336 (Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence) position: , mismatch: 7, identity: 0.759

attatctgaatggcattttctttggcgca	CRISPR spacer
attatctgattggcagtttctttaactgt	Protospacer
********* ***** *******..*   

38. spacer 1.8|588247|29|NZ_CP009906|PILER-CR matches to NZ_CP040920 (Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence) position: , mismatch: 7, identity: 0.759

attatctgaatggcattttctttggcgca	CRISPR spacer
attatctgattggcagtttctttaactgt	Protospacer
********* ***** *******..*   

39. spacer 1.8|588247|29|NZ_CP009906|PILER-CR matches to NZ_CP024832 (Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence) position: , mismatch: 7, identity: 0.759

attatctgaatggcattttctttggcgca	CRISPR spacer
attatctgattggcagtttctttaactgt	Protospacer
********* ***** *******..*   

40. spacer 1.8|588247|29|NZ_CP009906|PILER-CR matches to NZ_CP024817 (Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence) position: , mismatch: 7, identity: 0.759

attatctgaatggcattttctttggcgca	CRISPR spacer
attatctgattggcagtttctttaactgt	Protospacer
********* ***** *******..*   

41. spacer 1.8|588247|29|NZ_CP009906|PILER-CR matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 7, identity: 0.759

attatctgaatggcattttctttggcgca	CRISPR spacer
attatctgattggcagtttctttaactgt	Protospacer
********* ***** *******..*   

42. spacer 1.8|588247|29|NZ_CP009906|PILER-CR matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 7, identity: 0.759

attatctgaatggcattttctttggcgca	CRISPR spacer
attatctgattggcagtttctttaactgt	Protospacer
********* ***** *******..*   

43. spacer 1.8|588247|29|NZ_CP009906|PILER-CR matches to NZ_CP023961 (Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.759

attatctgaatggcattttctttggcgca	CRISPR spacer
attatctgattggcagtttctttaactgt	Protospacer
********* ***** *******..*   

44. spacer 1.8|588247|29|NZ_CP009906|PILER-CR matches to AP023222 (Escherichia coli M505 plasmid pM505-b DNA, complete genome) position: , mismatch: 7, identity: 0.759

attatctgaatggcattttctttggcgca	CRISPR spacer
attatctgattggcagtttctttaactgt	Protospacer
********* ***** *******..*   

45. spacer 1.8|588247|29|NZ_CP009906|PILER-CR matches to AP023233 (Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome) position: , mismatch: 7, identity: 0.759

attatctgaatggcattttctttggcgca	CRISPR spacer
attatctgattggcagtttctttaactgt	Protospacer
********* ***** *******..*   

46. spacer 1.8|588247|29|NZ_CP009906|PILER-CR matches to NZ_CP019075 (Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence) position: , mismatch: 7, identity: 0.759

attatctgaatggcattttctttggcgca	CRISPR spacer
attatctgattggcagtttctttaactgt	Protospacer
********* ***** *******..*   

47. spacer 1.8|588247|29|NZ_CP009906|PILER-CR matches to NZ_CP015837 (Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence) position: , mismatch: 7, identity: 0.759

attatctgaatggcattttctttggcgca	CRISPR spacer
attatctgattggcagtttctttaactgt	Protospacer
********* ***** *******..*   

48. spacer 1.8|588247|29|NZ_CP009906|PILER-CR matches to NZ_CP011063 (Escherichia coli str. Sanji plasmid pSJ_98, complete sequence) position: , mismatch: 7, identity: 0.759

attatctgaatggcattttctttggcgca	CRISPR spacer
attatctgattggcagtttctttaactgt	Protospacer
********* ***** *******..*   

49. spacer 1.8|588247|29|NZ_CP009906|PILER-CR matches to JF974294 (Aeromonas phage pIS4-A genomic sequence) position: , mismatch: 7, identity: 0.759

attatctgaatggcattttctttggcgca	CRISPR spacer
attacctgaatggcatttgctttatgcct	Protospacer
****.************* ****.   * 

50. spacer 1.8|588247|29|NZ_CP009906|PILER-CR matches to NC_021534 (Vibrio phage pYD38-A genomic sequence) position: , mismatch: 7, identity: 0.759

attatctgaatggcattttctttggcgca	CRISPR spacer
attacctgaatggcatttgctttatgcct	Protospacer
****.************* ****.   * 

51. spacer 1.9|588307|29|NZ_CP009906|PILER-CR matches to NZ_CP005086 (Sphingobium sp. TKS plasmid pTK2, complete sequence) position: , mismatch: 7, identity: 0.759

tcgccattccgtgaacctgagcgcgttcg	CRISPR spacer
tcgcctttccctgaacctgagcgatcgtg	Protospacer
***** **** ************  . .*

52. spacer 6.2|4080886|32|NZ_CP009906|PILER-CR,CRISPRCasFinder,CRT matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 7, identity: 0.781

atttattaaagatgctgacaaaaagaacttaa	CRISPR spacer
aattataaaagatgctgataaaaagattatta	Protospacer
* **** ***********.******* . * *

53. spacer 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT matches to DI373487 (KR 1020130142837-A/1: Bacteriophage of Pseudomonas aeruginosa and uses thereof) position: , mismatch: 8, identity: 0.765

tcagtcccgttatggtgctggtgttgcccgtaag	CRISPR spacer
cgagactggttatggtgctggtggtgcccgcaac	Protospacer
. ** *. *************** ******.** 

54. spacer 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT matches to NC_042060 (Pseudomonas phage PA7, partial genome) position: , mismatch: 8, identity: 0.765

tcagtcccgttatggtgctggtgttgcccgtaag	CRISPR spacer
cgagactggttatggtgctggtggtgcccgcaac	Protospacer
. ** *. *************** ******.** 

55. spacer 1.6|588427|34|NZ_CP009906|CRISPRCasFinder,CRT matches to AP019418 (Pseudomonas phage PA02 DNA, nearly complete genome) position: , mismatch: 8, identity: 0.765

tcagtcccgttatggtgctggtgttgcccgtaag	CRISPR spacer
cgagactggttatggtgctggtggtgcccgcaac	Protospacer
. ** *. *************** ******.** 

56. spacer 1.7|588187|29|NZ_CP009906|PILER-CR matches to AP014500 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S32-C79, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 8, identity: 0.724

gaaaaggtaagatgggcaagcttctagta	CRISPR spacer
ggttgtagaagatgtgcaagcttctagta	Protospacer
*.  . . ****** **************

57. spacer 6.2|4080886|32|NZ_CP009906|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010358 (Acinetobacter johnsonii XBB1 plasmid pXBB1-8, complete sequence) position: , mismatch: 8, identity: 0.75

atttattaaagatgctgacaaaaagaacttaa	CRISPR spacer
atttattaatgatgctgacgaaaatatggcac	Protospacer
********* *********.**** *   .* 

58. spacer 6.2|4080886|32|NZ_CP009906|PILER-CR,CRISPRCasFinder,CRT matches to NC_019694 (Oscillatoria acuminata PCC 6304 plasmid pOSCIL6304.02, complete sequence) position: , mismatch: 8, identity: 0.75

atttattaaagatgctgacaaaaagaacttaa	CRISPR spacer
atttattaaagaagctgccaaaagagcatcaa	Protospacer
************ **** *****...  *.**

59. spacer 1.2|588187|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NZ_CP031943 (Nostoc sphaeroides strain Kutzing En plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

gaaaaggtaagatgggcaagcttctagtagtt	CRISPR spacer
ttatgagaaagatgggcaagcttttagtggta	Protospacer
  * ..* ***************.****.** 

60. spacer 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT matches to MF679145 (Escherichia coli plasmid pBJ114-96, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

61. spacer 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

62. spacer 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NZ_CP021340 (Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

63. spacer 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NZ_CP021336 (Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

64. spacer 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NZ_CP040920 (Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

65. spacer 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NZ_CP024832 (Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

66. spacer 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NZ_CP024817 (Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

67. spacer 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

68. spacer 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat-----	CRISPR spacer
attatctgattggcagtttctttaac-----tgttta	Protospacer
********* ***** *******..*     *     

69. spacer 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NZ_CP023961 (Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

70. spacer 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT matches to AP023222 (Escherichia coli M505 plasmid pM505-b DNA, complete genome) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

71. spacer 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT matches to AP023233 (Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

72. spacer 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NZ_CP019075 (Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

73. spacer 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NZ_CP015837 (Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

74. spacer 1.3|588247|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NZ_CP011063 (Escherichia coli str. Sanji plasmid pSJ_98, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

75. spacer 6.2|4080886|32|NZ_CP009906|PILER-CR,CRISPRCasFinder,CRT matches to MT774386 (CrAssphage cr110_1, complete genome) position: , mismatch: 9, identity: 0.719

atttattaaagatgctgacaaaaagaacttaa	CRISPR spacer
tgctattgaagatgctgataaaaagaaacttg	Protospacer
  .****.**********.******** .* .

76. spacer 6.2|4080886|32|NZ_CP009906|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028934 (Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence) position: , mismatch: 9, identity: 0.719

atttattaaagatgctgacaaaaagaacttaa	CRISPR spacer
gcacattacagacgctgacaaaaagaaagtta	Protospacer
.. .**** ***.**************  * *

77. spacer 1.4|588307|32|NZ_CP009906|CRISPRCasFinder,CRT matches to NZ_JX627581 (Methylobacterium oryzae CBMB20 plasmid pMOC2, complete sequence) position: , mismatch: 10, identity: 0.688

tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
ctaacgagccgtgaacctcagcgcattcgcgt	Protospacer
... *.  ********** *****.****** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3098 : 63616 62 Escherichia_phage(15.15%) tail,tRNA,transposase,integrase attL 35150:35180|attR 63807:63837
DBSCAN-SWA_2 376616 : 439634 54 Tupanvirus(18.18%) protease,tRNA,transposase,coat NA
DBSCAN-SWA_3 1050085 : 1058635 7 Bacillus_virus(33.33%) transposase NA
DBSCAN-SWA_4 2084442 : 2185973 46 Escherichia_phage(30.77%) protease,transposase,plate NA
DBSCAN-SWA_5 2957154 : 3033790 57 Helicobacter_phage(13.33%) transposase,plate NA
DBSCAN-SWA_6 3386100 : 3447583 44 Escherichia_phage(42.86%) protease,transposase,plate NA
DBSCAN-SWA_7 3488010 : 3551064 53 Escherichia_phage(25.0%) protease,tRNA,transposase,integrase attL 3513909:3513923|attR 3548136:3548150
DBSCAN-SWA_8 3837228 : 3926388 61 Helicobacter_phage(10.71%) protease,tRNA,transposase NA
DBSCAN-SWA_9 3931021 : 4004256 53 Helicobacter_phage(12.5%) protease,transposase,plate NA
DBSCAN-SWA_10 4162795 : 4208113 37 Pseudomonas_phage(25.0%) protease,tail,plate NA
DBSCAN-SWA_11 4294873 : 4349729 50 Planktothrix_phage(13.33%) protease,holin,transposase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP009906.1|WP_002211705.1|53117_53285_+|hypothetical-protein 53117_53285_+ 55 aa aa NA NA NA 3098-63616 yes
2. NZ_CP009905
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 25042 : 48441 21 Enterobacteria_phage(42.86%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP009904
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 96115 88 Salmonella_phage(76.47%) integrase,tail,transposase,terminase attL 1878:1892|attR 14732:14746
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage