Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007572 Streptococcus agalactiae strain GBS6 chromosome, complete genome 3 crisprs RT,cas3,DinG,cas9,cas1,cas2,csn2,csm6,DEDDh,csa3 1 7 9 0

Results visualization

1. NZ_CP007572
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007572_1 998542-998766 TypeII II-A
3 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007572_2 1141304-1141374 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007572_3 2078857-2079330 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP007572_3 3.7|2079211|18|NZ_CP007572|CRT 2079211-2079228 18 NZ_CP007572.1 2078851-2078868 1 0.944

1. spacer 3.7|2079211|18|NZ_CP007572|CRT matches to position: 2078851-2078868, mismatch: 1, identity: 0.944

ttggcttctggtttggcc	CRISPR spacer
ttggcttctggtttagcc	Protospacer
**************.***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007572_1 1.2|998645|29|NZ_CP007572|CRISPRCasFinder 998645-998673 29 MK448729 Streptococcus phage Javan31, complete genome 33403-33431 0 1.0
NZ_CP007572_1 1.2|998645|29|NZ_CP007572|CRISPRCasFinder 998645-998673 29 MK448691 Streptococcus phage Javan17, complete genome 33403-33431 0 1.0
NZ_CP007572_1 1.2|998645|29|NZ_CP007572|CRISPRCasFinder 998645-998673 29 MK448948 Streptococcus phage Javan46, complete genome 33347-33375 0 1.0
NZ_CP007572_1 1.2|998645|29|NZ_CP007572|CRISPRCasFinder 998645-998673 29 MK448768 Streptococcus phage Javan47, complete genome 35055-35083 0 1.0
NZ_CP007572_2 2.1|1141327|25|NZ_CP007572|CRISPRCasFinder 1141327-1141351 25 AP013358 Uncultured Mediterranean phage uvMED DNA, complete genome, group G1, isolate: uvMED-CGR-U-MedDCM-OCT-S27-C45 25656-25680 3 0.88
NZ_CP007572_2 2.1|1141327|25|NZ_CP007572|CRISPRCasFinder 1141327-1141351 25 MG711463 Faecalibacterium phage FP_oengus, complete genome 52130-52154 4 0.84
NZ_CP007572_1 1.1|998579|29|NZ_CP007572|CRISPRCasFinder 998579-998607 29 NZ_CP024772 Bacillus thuringiensis LM1212 plasmid pLM1, complete sequence 40319-40347 6 0.793
NZ_CP007572_1 1.1|998579|29|NZ_CP007572|CRISPRCasFinder 998579-998607 29 NZ_LN906635 Lactobacillus reuteri plasmid p53608_1, complete genome, strain ATCC 53608 48868-48896 6 0.793
NZ_CP007572_1 1.4|998635|39|NZ_CP007572|CRT 998635-998673 39 MK448729 Streptococcus phage Javan31, complete genome 33393-33431 6 0.846
NZ_CP007572_1 1.4|998635|39|NZ_CP007572|CRT 998635-998673 39 MK448691 Streptococcus phage Javan17, complete genome 33393-33431 6 0.846
NZ_CP007572_1 1.4|998635|39|NZ_CP007572|CRT 998635-998673 39 MK448948 Streptococcus phage Javan46, complete genome 33337-33375 6 0.846
NZ_CP007572_1 1.4|998635|39|NZ_CP007572|CRT 998635-998673 39 MK448768 Streptococcus phage Javan47, complete genome 35045-35083 6 0.846
NZ_CP007572_1 1.1|998579|29|NZ_CP007572|CRISPRCasFinder 998579-998607 29 NC_020879 Aeromonas phage Aes012, complete genome 134557-134585 7 0.759
NZ_CP007572_1 1.1|998579|29|NZ_CP007572|CRISPRCasFinder 998579-998607 29 MH179477 Aeromonas phage 60AhydR15PP, complete genome 133527-133555 7 0.759
NZ_CP007572_1 1.1|998579|29|NZ_CP007572|CRISPRCasFinder 998579-998607 29 NC_008208 Aeromonas phage 25, complete genome 134599-134627 7 0.759
NZ_CP007572_1 1.1|998579|29|NZ_CP007572|CRISPRCasFinder 998579-998607 29 NC_014635 Aeromonas phage phiAS4, complete genome 33180-33208 7 0.759
NZ_CP007572_1 1.1|998579|29|NZ_CP007572|CRISPRCasFinder 998579-998607 29 DQ529280 Aeromonas salmonicida bacteriophage 25, complete genome 134599-134627 7 0.759
NZ_CP007572_1 1.1|998579|29|NZ_CP007572|CRISPRCasFinder 998579-998607 29 MF479730 Aeromonas phage AS-gz, complete genome 51898-51926 7 0.759
NZ_CP007572_1 1.1|998579|29|NZ_CP007572|CRISPRCasFinder 998579-998607 29 JX306041 Stenotrophomonas phage IME13, complete genome 139584-139612 7 0.759
NZ_CP007572_1 1.1|998579|29|NZ_CP007572|CRISPRCasFinder 998579-998607 29 MH179476 Aeromonas phage 50AhydR13PP, complete genome 93640-93668 7 0.759
NZ_CP007572_1 1.1|998579|29|NZ_CP007572|CRISPRCasFinder 998579-998607 29 NC_019543 Aeromonas phage Aes508, complete genome 133764-133792 7 0.759
NZ_CP007572_1 1.1|998579|29|NZ_CP007572|CRISPRCasFinder 998579-998607 29 CP016197 Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-3, complete sequence 84106-84134 7 0.759
NZ_CP007572_1 1.1|998579|29|NZ_CP007572|CRISPRCasFinder 998579-998607 29 MF417965 Uncultured Caudovirales phage clone 3S_17, partial genome 3160-3188 7 0.759
NZ_CP007572_3 3.5|2079103|30|NZ_CP007572|CRT 2079103-2079132 30 NC_028835 Lactobacillus phage CL2, complete genome 3497-3526 7 0.767
NZ_CP007572_3 3.5|2079103|30|NZ_CP007572|CRT 2079103-2079132 30 KR905066 Lactobacillus phage CL1, complete genome 2482-2511 7 0.767
NZ_CP007572_3 3.5|2079103|30|NZ_CP007572|CRT 2079103-2079132 30 NC_028911 Lactobacillus phage iLp1308, complete genome 2578-2607 7 0.767
NZ_CP007572_3 3.8|2079247|30|NZ_CP007572|CRT 2079247-2079276 30 NC_048797 Bacillus phage vB_BmeM-Goe8, complete genome 33781-33810 7 0.767
NZ_CP007572_3 3.3|2078995|30|NZ_CP007572|CRT 2078995-2079024 30 MN855875 Bacteriophage sp. isolate 328, complete genome 1403-1432 9 0.7

1. spacer 1.2|998645|29|NZ_CP007572|CRISPRCasFinder matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 0, identity: 1.0

aatacaatagtcgcacaaacagcgaacag	CRISPR spacer
aatacaatagtcgcacaaacagcgaacag	Protospacer
*****************************

2. spacer 1.2|998645|29|NZ_CP007572|CRISPRCasFinder matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 0, identity: 1.0

aatacaatagtcgcacaaacagcgaacag	CRISPR spacer
aatacaatagtcgcacaaacagcgaacag	Protospacer
*****************************

3. spacer 1.2|998645|29|NZ_CP007572|CRISPRCasFinder matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 0, identity: 1.0

aatacaatagtcgcacaaacagcgaacag	CRISPR spacer
aatacaatagtcgcacaaacagcgaacag	Protospacer
*****************************

4. spacer 1.2|998645|29|NZ_CP007572|CRISPRCasFinder matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

aatacaatagtcgcacaaacagcgaacag	CRISPR spacer
aatacaatagtcgcacaaacagcgaacag	Protospacer
*****************************

5. spacer 2.1|1141327|25|NZ_CP007572|CRISPRCasFinder matches to AP013358 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G1, isolate: uvMED-CGR-U-MedDCM-OCT-S27-C45) position: , mismatch: 3, identity: 0.88

accttggcttctgttttctgcatcg	CRISPR spacer
agcttgacttctgttttctgcatct	Protospacer
* ****.***************** 

6. spacer 2.1|1141327|25|NZ_CP007572|CRISPRCasFinder matches to MG711463 (Faecalibacterium phage FP_oengus, complete genome) position: , mismatch: 4, identity: 0.84

accttggcttctgttttctgcatcg	CRISPR spacer
gccttggcttcttttttctgcttca	Protospacer
.*********** ******** **.

7. spacer 1.1|998579|29|NZ_CP007572|CRISPRCasFinder matches to NZ_CP024772 (Bacillus thuringiensis LM1212 plasmid pLM1, complete sequence) position: , mismatch: 6, identity: 0.793

tgcaatgttatttgatgatggaacaacat	CRISPR spacer
tgatatgttatttgatgatgtaacattag	Protospacer
**  **************** **** .* 

8. spacer 1.1|998579|29|NZ_CP007572|CRISPRCasFinder matches to NZ_LN906635 (Lactobacillus reuteri plasmid p53608_1, complete genome, strain ATCC 53608) position: , mismatch: 6, identity: 0.793

tgcaatgttatttgatgatggaacaacat-	CRISPR spacer
tgcaactttatttgatgatggaa-agtaca	Protospacer
*****. **************** *..*. 

9. spacer 1.4|998635|39|NZ_CP007572|CRT matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 6, identity: 0.846

-attccaaaacaatacaatagtcgcacaaacagcgaacag	CRISPR spacer
tactgc-gattaatacaatagtcgcacaaacagcgaacag	Protospacer
 *.* * .* .*****************************

10. spacer 1.4|998635|39|NZ_CP007572|CRT matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 6, identity: 0.846

-attccaaaacaatacaatagtcgcacaaacagcgaacag	CRISPR spacer
tactgc-gattaatacaatagtcgcacaaacagcgaacag	Protospacer
 *.* * .* .*****************************

11. spacer 1.4|998635|39|NZ_CP007572|CRT matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 6, identity: 0.846

-attccaaaacaatacaatagtcgcacaaacagcgaacag	CRISPR spacer
tactgc-gattaatacaatagtcgcacaaacagcgaacag	Protospacer
 *.* * .* .*****************************

12. spacer 1.4|998635|39|NZ_CP007572|CRT matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 6, identity: 0.846

-attccaaaacaatacaatagtcgcacaaacagcgaacag	CRISPR spacer
tactgc-gattaatacaatagtcgcacaaacagcgaacag	Protospacer
 *.* * .* .*****************************

13. spacer 1.1|998579|29|NZ_CP007572|CRISPRCasFinder matches to NC_020879 (Aeromonas phage Aes012, complete genome) position: , mismatch: 7, identity: 0.759

tgcaatgttatttgatgatggaacaacat	CRISPR spacer
ttatgctttatttgatgatgaaacaacat	Protospacer
*   .. *************.********

14. spacer 1.1|998579|29|NZ_CP007572|CRISPRCasFinder matches to MH179477 (Aeromonas phage 60AhydR15PP, complete genome) position: , mismatch: 7, identity: 0.759

tgcaatgttatttgatgatggaacaacat	CRISPR spacer
ttatgctttatttgatgatgaaacaacat	Protospacer
*   .. *************.********

15. spacer 1.1|998579|29|NZ_CP007572|CRISPRCasFinder matches to NC_008208 (Aeromonas phage 25, complete genome) position: , mismatch: 7, identity: 0.759

tgcaatgttatttgatgatggaacaacat	CRISPR spacer
ttatgctttatttgatgatgaaacaacat	Protospacer
*   .. *************.********

16. spacer 1.1|998579|29|NZ_CP007572|CRISPRCasFinder matches to NC_014635 (Aeromonas phage phiAS4, complete genome) position: , mismatch: 7, identity: 0.759

tgcaatgttatttgatgatggaacaacat	CRISPR spacer
ttatgctttatttgatgatgaaacaacat	Protospacer
*   .. *************.********

17. spacer 1.1|998579|29|NZ_CP007572|CRISPRCasFinder matches to DQ529280 (Aeromonas salmonicida bacteriophage 25, complete genome) position: , mismatch: 7, identity: 0.759

tgcaatgttatttgatgatggaacaacat	CRISPR spacer
ttatgctttatttgatgatgaaacaacat	Protospacer
*   .. *************.********

18. spacer 1.1|998579|29|NZ_CP007572|CRISPRCasFinder matches to MF479730 (Aeromonas phage AS-gz, complete genome) position: , mismatch: 7, identity: 0.759

tgcaatgttatttgatgatggaacaacat	CRISPR spacer
ttatgctttatttgatgatgaaacaacat	Protospacer
*   .. *************.********

19. spacer 1.1|998579|29|NZ_CP007572|CRISPRCasFinder matches to JX306041 (Stenotrophomonas phage IME13, complete genome) position: , mismatch: 7, identity: 0.759

tgcaatgttatttgatgatggaacaacat	CRISPR spacer
ttatgctttatttgatgatgaaacaacat	Protospacer
*   .. *************.********

20. spacer 1.1|998579|29|NZ_CP007572|CRISPRCasFinder matches to MH179476 (Aeromonas phage 50AhydR13PP, complete genome) position: , mismatch: 7, identity: 0.759

tgcaatgttatttgatgatggaacaacat	CRISPR spacer
ttatgctttatttgatgatgaaacaacat	Protospacer
*   .. *************.********

21. spacer 1.1|998579|29|NZ_CP007572|CRISPRCasFinder matches to NC_019543 (Aeromonas phage Aes508, complete genome) position: , mismatch: 7, identity: 0.759

tgcaatgttatttgatgatggaacaacat	CRISPR spacer
ttatgctttatttgatgatgaaacaacat	Protospacer
*   .. *************.********

22. spacer 1.1|998579|29|NZ_CP007572|CRISPRCasFinder matches to CP016197 (Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-3, complete sequence) position: , mismatch: 7, identity: 0.759

tgcaatgttatttgatgatggaacaacat	CRISPR spacer
tgatatgttatttgatgatgtaacattgg	Protospacer
**  **************** **** .. 

23. spacer 1.1|998579|29|NZ_CP007572|CRISPRCasFinder matches to MF417965 (Uncultured Caudovirales phage clone 3S_17, partial genome) position: , mismatch: 7, identity: 0.759

tgcaatgttatttgatgatggaacaacat	CRISPR spacer
ctcattggtatttgatgatggaacataaa	Protospacer
. ** ** *****************  * 

24. spacer 3.5|2079103|30|NZ_CP007572|CRT matches to NC_028835 (Lactobacillus phage CL2, complete genome) position: , mismatch: 7, identity: 0.767

-ttaacgtctggtttggcttctggcttaacg	CRISPR spacer
attcat-tctggtttgccttctggcttagta	Protospacer
 ** *. ********* ***********...

25. spacer 3.5|2079103|30|NZ_CP007572|CRT matches to KR905066 (Lactobacillus phage CL1, complete genome) position: , mismatch: 7, identity: 0.767

-ttaacgtctggtttggcttctggcttaacg	CRISPR spacer
attcat-tctggtttgccttctggcttagta	Protospacer
 ** *. ********* ***********...

26. spacer 3.5|2079103|30|NZ_CP007572|CRT matches to NC_028911 (Lactobacillus phage iLp1308, complete genome) position: , mismatch: 7, identity: 0.767

-ttaacgtctggtttggcttctggcttaacg	CRISPR spacer
attcat-tctggtttgccttctggcttagta	Protospacer
 ** *. ********* ***********...

27. spacer 3.8|2079247|30|NZ_CP007572|CRT matches to NC_048797 (Bacillus phage vB_BmeM-Goe8, complete genome) position: , mismatch: 7, identity: 0.767

ttagcttctggcttaacgtctggcttaaca	CRISPR spacer
tctgcttctggcttaacctctggctctgct	Protospacer
*. ************** *******. .* 

28. spacer 3.3|2078995|30|NZ_CP007572|CRT matches to MN855875 (Bacteriophage sp. isolate 328, complete genome) position: , mismatch: 9, identity: 0.7

ctggcctctggcttaacgtctggtttaatt	CRISPR spacer
gtggcctctggctcaacgtctgcgccatcc	Protospacer
 ************.********  ..* ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 44006 : 52213 7 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 184236 : 263493 75 Streptococcus_phage(48.15%) tRNA,holin,integrase,protease,transposase attL 243803:243821|attR 263918:263936
DBSCAN-SWA_3 326618 : 334140 7 Bacillus_virus(50.0%) transposase NA
DBSCAN-SWA_4 590139 : 653270 83 Streptococcus_phage(73.44%) portal,capsid,terminase,holin,integrase,transposase,tail attL 590222:590281|attR 649045:650541
DBSCAN-SWA_5 1277661 : 1349535 53 Enterobacteria_phage(16.67%) protease,transposase,tRNA,integrase attL 1316076:1316094|attR 1358450:1358468
DBSCAN-SWA_6 1622470 : 1638196 17 Streptococcus_phage(86.67%) transposase NA
DBSCAN-SWA_7 1857589 : 1883871 25 Streptococcus_phage(85.71%) integrase,transposase attL 1848917:1848933|attR 1873016:1873032
DBSCAN-SWA_8 2168823 : 2178305 16 Streptococcus_phage(81.82%) NA NA
DBSCAN-SWA_9 2194189 : 2206268 12 Streptococcus_phage(44.44%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage