Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP004396 Celeribacter indicus strain P73 plasmid pP73C, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP004395 Celeribacter indicus strain P73 plasmid pP73B, complete sequence 0 crisprs RT 0 0 0 0
NZ_CP004397 Celeribacter indicus strain P73 plasmid pP73D, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP004394 Celeribacter indicus strain P73 plasmid pP73A, complete sequence 2 crisprs NA 0 3 0 0
NZ_CP004398 Celeribacter indicus strain P73 plasmid pP73E, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP004393 Celeribacter indicus strain P73 chromosome, complete genome 0 crisprs csa3,cas3,RT,WYL,DEDDh 0 0 5 0

Results visualization

1. NZ_CP004394
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP004394_1 3495-3575 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP004394_2 3651-3816 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP004394_1 1.1|3518|34|NZ_CP004394|CRISPRCasFinder 3518-3551 34 NZ_CP004394 Celeribacter indicus strain P73 plasmid pP73A, complete sequence 3518-3551 0 1.0
NZ_CP004394_2 2.1|3674|57|NZ_CP004394|CRISPRCasFinder 3674-3730 57 NZ_CP004394 Celeribacter indicus strain P73 plasmid pP73A, complete sequence 3674-3730 0 1.0
NZ_CP004394_2 2.2|3754|40|NZ_CP004394|CRISPRCasFinder 3754-3793 40 NZ_CP004394 Celeribacter indicus strain P73 plasmid pP73A, complete sequence 3754-3793 0 1.0

1. spacer 1.1|3518|34|NZ_CP004394|CRISPRCasFinder matches to NZ_CP004394 (Celeribacter indicus strain P73 plasmid pP73A, complete sequence) position: , mismatch: 0, identity: 1.0

tccgggggaggcgcgcggcgggaggtgctgcatc	CRISPR spacer
tccgggggaggcgcgcggcgggaggtgctgcatc	Protospacer
**********************************

2. spacer 2.1|3674|57|NZ_CP004394|CRISPRCasFinder matches to NZ_CP004394 (Celeribacter indicus strain P73 plasmid pP73A, complete sequence) position: , mismatch: 0, identity: 1.0

gatggatgagatctatttccaccgccaccccctcccggacggcccacggccggccga	CRISPR spacer
gatggatgagatctatttccaccgccaccccctcccggacggcccacggccggccga	Protospacer
*********************************************************

3. spacer 2.2|3754|40|NZ_CP004394|CRISPRCasFinder matches to NZ_CP004394 (Celeribacter indicus strain P73 plasmid pP73A, complete sequence) position: , mismatch: 0, identity: 1.0

ctccgacgaaaaatgcccacgatcgcgacgggacgacgcc	CRISPR spacer
ctccgacgaaaaatgcccacgatcgcgacgggacgacgcc	Protospacer
****************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP004396
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 73471 : 101204 25 Burkholderia_virus(25.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP004393
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1694743 : 1707594 15 Paracoccus_phage(55.56%) tail,protease,head,capsid,portal NA
DBSCAN-SWA_2 1817900 : 1851603 39 Acidithiobacillus_phage(16.67%) tail,portal,terminase NA
DBSCAN-SWA_3 1884377 : 1945006 64 Acidithiobacillus_phage(12.9%) tail,portal,terminase,transposase NA
DBSCAN-SWA_4 2434444 : 2489958 64 Enterobacteria_phage(15.0%) terminase,integrase,tRNA,tail,transposase,head,capsid,portal attL 2456870:2456916|attR 2474083:2474129
DBSCAN-SWA_5 3852837 : 3885782 35 Burkholderia_virus(28.57%) integrase,transposase attL 3852799:3852858|attR 3885763:3887078
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP004397
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 7710 8 Burkholderia_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage