Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007641 Rhizobium etli bv. phaseoli str. IE4803 chromosome RetIE4803, complete sequence 2 crisprs WYL,cas3,csa3,DEDDh 0 1 4 0
NZ_CP007643 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 0 crisprs csa3,DEDDh 0 0 0 0
NZ_CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. NZ_CP007641
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007641_1 1958769-1958861 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007641_2 1959123-1959199 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007641_2 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder 1959146-1959176 31 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 350211-350241 7 0.774
NZ_CP007641_2 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder 1959146-1959176 31 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 597559-597589 7 0.774
NZ_CP007641_2 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder 1959146-1959176 31 MH910042 Mycobacterium phage Scarlett, complete genome 24420-24450 7 0.774
NZ_CP007641_2 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder 1959146-1959176 31 MH910038 Mycobacterium phage LeMond, complete genome 24418-24448 7 0.774
NZ_CP007641_2 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder 1959146-1959176 31 MH910039 Mycobacterium phage Oscar, complete genome 24419-24449 7 0.774
NZ_CP007641_2 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder 1959146-1959176 31 MK376955 Mycobacterium phage KiSi, complete genome 24347-24377 7 0.774
NZ_CP007641_2 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder 1959146-1959176 31 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 1056711-1056741 8 0.742
NZ_CP007641_2 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder 1959146-1959176 31 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 1406014-1406044 8 0.742
NZ_CP007641_2 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder 1959146-1959176 31 NZ_LN831788 Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE1, complete sequence 59724-59754 9 0.71
NZ_CP007641_2 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder 1959146-1959176 31 NZ_CP046611 Burkholderia contaminans strain XL73 plasmid unnamed2, complete sequence 7594-7624 9 0.71
NZ_CP007641_2 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder 1959146-1959176 31 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 37526-37556 10 0.677

1. spacer 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

gcggccaggctggcatcaagggccacgtgac	CRISPR spacer
gaggccaggcgggcagcaagggccacggcct	Protospacer
* ******** **** ***********   .

2. spacer 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.774

gcggccaggctggcatcaagggccacgtgac	CRISPR spacer
gaggccaggcgggcagcaagggccacggcct	Protospacer
* ******** **** ***********   .

3. spacer 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder matches to MH910042 (Mycobacterium phage Scarlett, complete genome) position: , mismatch: 7, identity: 0.774

gcggccaggctggcatcaagggccacgtgac	CRISPR spacer
tcgagtcggctggcagcaagggcctcgtgac	Protospacer
 **. . ******** ******** ******

4. spacer 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder matches to MH910038 (Mycobacterium phage LeMond, complete genome) position: , mismatch: 7, identity: 0.774

gcggccaggctggcatcaagggccacgtgac	CRISPR spacer
tcgagtcggctggcagcaagggcctcgtgac	Protospacer
 **. . ******** ******** ******

5. spacer 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder matches to MH910039 (Mycobacterium phage Oscar, complete genome) position: , mismatch: 7, identity: 0.774

gcggccaggctggcatcaagggccacgtgac	CRISPR spacer
tcgagtcggctggcagcaagggcctcgtgac	Protospacer
 **. . ******** ******** ******

6. spacer 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder matches to MK376955 (Mycobacterium phage KiSi, complete genome) position: , mismatch: 7, identity: 0.774

gcggccaggctggcatcaagggccacgtgac	CRISPR spacer
tcgagtcggctggcagcaagggcctcgtgac	Protospacer
 **. . ******** ******** ******

7. spacer 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 8, identity: 0.742

gcggccaggctggcatcaagggccacgtgac	CRISPR spacer
agggccaggctggcagcaagggcccggacgc	Protospacer
. ************* ********  *  .*

8. spacer 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 8, identity: 0.742

gcggccaggctggcatcaagggccacgtgac	CRISPR spacer
agggccaggctggcagcaagggcccggacgc	Protospacer
. ************* ********  *  .*

9. spacer 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder matches to NZ_LN831788 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE1, complete sequence) position: , mismatch: 9, identity: 0.71

gcggccaggctggcatcaagggccacgtgac	CRISPR spacer
tccaccaggccggcatcaacggccacgacga	Protospacer
 * .******.******** *******  . 

10. spacer 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder matches to NZ_CP046611 (Burkholderia contaminans strain XL73 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

gcggccaggctggcatcaagggccacgtgac	CRISPR spacer
tcgtccaggctggcaccaagggccgaaagca	Protospacer
 ** ***********.********. . *  

11. spacer 2.1|1959146|31|NZ_CP007641|CRISPRCasFinder matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 10, identity: 0.677

gcggccaggctggcatcaagggccacgtgac	CRISPR spacer
atccgcaggatggcatcgagggccacgtctg	Protospacer
..   **** *******.**********   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1527665 : 1536848 9 Aeromonas_phage(14.29%) NA NA
DBSCAN-SWA_2 1848567 : 1861626 13 uncultured_Mediterranean_phage(90.91%) tRNA NA
DBSCAN-SWA_3 2111018 : 2121182 9 uncultured_Mediterranean_phage(83.33%) NA NA
DBSCAN-SWA_4 4157824 : 4168063 9 Mycobacterium_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP007643
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 75060 : 121144 35 Lactococcus_phage(25.0%) transposase NA
DBSCAN-SWA_2 289485 : 321586 18 Corynebacterium_phage(100.0%) transposase,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP007645
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 88584 : 148515 37 Bacillus_phage(20.0%) transposase,integrase attL 100797:100811|attR 120655:120669
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage