Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010377 Enterobacter hormaechei subsp. hormaechei strain 34983 chromosome, complete genome 5 crisprs csa3,cas3,DEDDh,WYL,DinG,RT 0 5 8 0
NZ_CP010379 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-43.621kb, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP010378 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence 1 crisprs NA 0 1 1 0
NZ_CP010380 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence 0 crisprs PD-DExK,csa3 0 0 17 0

Results visualization

1. NZ_CP010377
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010377_1 1581650-1581917 Orphan I-F
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010377_2 1597096-1597249 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010377_3 1972115-1972238 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010377_4 2096450-2096558 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010377_5 3296546-3296646 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010377_3 3.1|1972158|38|NZ_CP010377|CRISPRCasFinder 1972158-1972195 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 1 0.974
NZ_CP010377_5 5.1|3296584|25|NZ_CP010377|CRISPRCasFinder 3296584-3296608 25 NZ_CP028585 Escherichia coli strain WCHEC4533 plasmid p1_000533, complete sequence 90183-90207 4 0.84
NZ_CP010377_5 5.1|3296584|25|NZ_CP010377|CRISPRCasFinder 3296584-3296608 25 NZ_CP042620 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-5, complete sequence 74756-74780 4 0.84
NZ_CP010377_5 5.1|3296584|25|NZ_CP010377|CRISPRCasFinder 3296584-3296608 25 NZ_CP034790 Escherichia coli strain ECCNB20-2 plasmid pTB423, complete sequence 80199-80223 4 0.84
NZ_CP010377_5 5.1|3296584|25|NZ_CP010377|CRISPRCasFinder 3296584-3296608 25 LT906557 Escherichia coli isolate E. coli RL465 genome assembly, plasmid: II 42817-42841 4 0.84
NZ_CP010377_5 5.1|3296584|25|NZ_CP010377|CRISPRCasFinder 3296584-3296608 25 NZ_CP032875 Escherichia coli strain WCHEC000837 plasmid p1_000837, complete sequence 24838-24862 4 0.84
NZ_CP010377_5 5.1|3296584|25|NZ_CP010377|CRISPRCasFinder 3296584-3296608 25 NZ_CP022228 Escherichia coli strain WCHEC96200 plasmid p1_000200, complete sequence 65803-65827 4 0.84
NZ_CP010377_1 1.1|1581678|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581678-1581709 32 KY271395 Klebsiella phage 2b LV-2017, complete genome 29989-30020 6 0.812
NZ_CP010377_1 1.1|1581678|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581678-1581709 32 KY271396 Klebsiella phage 2 LV-2017, complete genome 14696-14727 6 0.812
NZ_CP010377_1 1.1|1581678|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581678-1581709 32 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 30282-30313 6 0.812
NZ_CP010377_1 1.1|1581678|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581678-1581709 32 LN889992 Pseudomonas phage 15b genome assembly, chromosome: 1 115-146 7 0.781
NZ_CP010377_1 1.1|1581678|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581678-1581709 32 LN889991 Bacteriophage 15G genome assembly, chromosome: 1 46148-46179 7 0.781
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 438549-438580 7 0.781
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 319463-319494 7 0.781
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 332402-332433 7 0.781
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 378710-378741 7 0.781
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 393138-393169 7 0.781
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 NZ_CP019439 Thioclava nitratireducens strain 25B10_4 plasmid unnamed2, complete sequence 2320-2351 8 0.75
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 691442-691473 8 0.75
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 272676-272707 8 0.75
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 363699-363730 8 0.75
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 NC_013207 Alicyclobacillus acidocaldarius subsp. acidocaldarius DSM 446 plasmid pAACI02, complete sequence 49502-49533 8 0.75
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 467011-467042 8 0.75
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 297267-297298 9 0.719
NZ_CP010377_2 2.3|1597130|32|NZ_CP010377|CRISPRCasFinder 1597130-1597161 32 NC_004444 Pseudomonas resinovorans plasmid pCAR1, complete sequence 167260-167291 9 0.719
NZ_CP010377_2 2.3|1597130|32|NZ_CP010377|CRISPRCasFinder 1597130-1597161 32 NC_021506 Pseudomonas resinovorans NBRC 106553 plasmid pCAR1.3, complete sequence 167190-167221 9 0.719
NZ_CP010377_2 2.3|1597130|32|NZ_CP010377|CRISPRCasFinder 1597130-1597161 32 NC_011838 Pseudomonas putida plasmid pCAR1.2, complete sequence 168456-168487 9 0.719
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 NZ_CP053709 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence 46666-46697 10 0.688
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 NZ_CP053710 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence 79026-79057 10 0.688
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 MN310547 Mycobacterium phage Hutc2, complete genome 49098-49129 10 0.688
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 MF472893 Mycobacterium phage MissWhite, complete genome 47953-47984 10 0.688
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 MK524519 Mycobacterium phage Salz, complete genome 49020-49051 10 0.688
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 MF140410 Mycobacterium phage Et2Brutus, complete genome 50208-50239 10 0.688
NZ_CP010377_1 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT 1581738-1581769 32 KY471460 Mycobacterium phage Jabith, complete genome 50406-50437 10 0.688

1. spacer 3.1|1972158|38|NZ_CP010377|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 1, identity: 0.974

cagacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*********.****************************

2. spacer 5.1|3296584|25|NZ_CP010377|CRISPRCasFinder matches to NZ_CP028585 (Escherichia coli strain WCHEC4533 plasmid p1_000533, complete sequence) position: , mismatch: 4, identity: 0.84

attggtaccattcaggccgtcttta	CRISPR spacer
attggttccattcaggccgtctcag	Protospacer
****** ***************. .

3. spacer 5.1|3296584|25|NZ_CP010377|CRISPRCasFinder matches to NZ_CP042620 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-5, complete sequence) position: , mismatch: 4, identity: 0.84

attggtaccattcaggccgtcttta	CRISPR spacer
attggttccattcaggccgtctcag	Protospacer
****** ***************. .

4. spacer 5.1|3296584|25|NZ_CP010377|CRISPRCasFinder matches to NZ_CP034790 (Escherichia coli strain ECCNB20-2 plasmid pTB423, complete sequence) position: , mismatch: 4, identity: 0.84

attggtaccattcaggccgtcttta	CRISPR spacer
attggttccattcaggccgtctcag	Protospacer
****** ***************. .

5. spacer 5.1|3296584|25|NZ_CP010377|CRISPRCasFinder matches to LT906557 (Escherichia coli isolate E. coli RL465 genome assembly, plasmid: II) position: , mismatch: 4, identity: 0.84

attggtaccattcaggccgtcttta	CRISPR spacer
attggttccattcaggccgtctcag	Protospacer
****** ***************. .

6. spacer 5.1|3296584|25|NZ_CP010377|CRISPRCasFinder matches to NZ_CP032875 (Escherichia coli strain WCHEC000837 plasmid p1_000837, complete sequence) position: , mismatch: 4, identity: 0.84

attggtaccattcaggccgtcttta	CRISPR spacer
attggttccattcaggccgtctcag	Protospacer
****** ***************. .

7. spacer 5.1|3296584|25|NZ_CP010377|CRISPRCasFinder matches to NZ_CP022228 (Escherichia coli strain WCHEC96200 plasmid p1_000200, complete sequence) position: , mismatch: 4, identity: 0.84

attggtaccattcaggccgtcttta	CRISPR spacer
attggttccattcaggccgtctcag	Protospacer
****** ***************. .

8. spacer 1.1|1581678|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to KY271395 (Klebsiella phage 2b LV-2017, complete genome) position: , mismatch: 6, identity: 0.812

tgatggttaagaccgacattaacaacaagaag	CRISPR spacer
tgatggttaagaccgacatcaacaatcgcaaa	Protospacer
*******************.*****. . **.

9. spacer 1.1|1581678|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 6, identity: 0.812

tgatggttaagaccgacattaacaacaagaag	CRISPR spacer
tgatggttaagaccgacatcaacaatcgcaaa	Protospacer
*******************.*****. . **.

10. spacer 1.1|1581678|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 6, identity: 0.812

tgatggttaagaccgacattaacaacaagaag	CRISPR spacer
tgatggttaagaccgacatcaacaatcgcaaa	Protospacer
*******************.*****. . **.

11. spacer 1.1|1581678|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to LN889992 (Pseudomonas phage 15b genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.781

tgatggttaagaccgacattaacaacaagaag	CRISPR spacer
tgatggttaagaccgacatcaacgaccgttac	Protospacer
*******************.***.** .  * 

12. spacer 1.1|1581678|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to LN889991 (Bacteriophage 15G genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.781

tgatggttaagaccgacattaacaacaagaag	CRISPR spacer
tgatggttaagaccgacatcaacgaccgttac	Protospacer
*******************.***.** .  * 

13. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 7, identity: 0.781

ggaggccgaggcggagtggctcgacaacctgc	CRISPR spacer
gcaggccgaggcggaggggctggaccatgtgt	Protospacer
* ************** **** *** *. **.

14. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781

ggaggccgaggcggagtggctcgacaacctgc	CRISPR spacer
gcaggccgaggcggaggggctggaccgcgtgt	Protospacer
* ************** **** *** .* **.

15. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781

ggaggccgaggcggagtggctcgacaacctgc	CRISPR spacer
gcaggccgaggcggaggggctggaccgcgtgt	Protospacer
* ************** **** *** .* **.

16. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781

ggaggccgaggcggagtggctcgacaacctgc	CRISPR spacer
gcaggccgaggcggaggggctggaccgcgtgt	Protospacer
* ************** **** *** .* **.

17. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781

ggaggccgaggcggagtggctcgacaacctgc	CRISPR spacer
gcaggccgaggcggaggggctggaccgcgtgt	Protospacer
* ************** **** *** .* **.

18. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019439 (Thioclava nitratireducens strain 25B10_4 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ggaggccgaggcggagtggct--cgacaacctgc	CRISPR spacer
ggcgaccgaggcggagtggctcgcgatggccg--	Protospacer
** *.****************  ***...**   

19. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

ggaggccgaggcggagtggctcgacaacctgc	CRISPR spacer
tcaggccgaggcggaggggctggaccgcgtgt	Protospacer
  ************** **** *** .* **.

20. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75

ggaggccgaggcggagtggctcgacaacctgc	CRISPR spacer
gcaggccgaggcggaggggctggaccgtgtgt	Protospacer
* ************** **** *** .. **.

21. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.75

ggaggccgaggcggagtggctcgacaacctgc	CRISPR spacer
acaggccgaggcggaggggctggaccgcgtgt	Protospacer
. ************** **** *** .* **.

22. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to NC_013207 (Alicyclobacillus acidocaldarius subsp. acidocaldarius DSM 446 plasmid pAACI02, complete sequence) position: , mismatch: 8, identity: 0.75

ggaggccgaggcggagtggctcga---caacctgc	CRISPR spacer
caaggccgaggcggcgtgggtcgacttcaaca---	Protospacer
 .************ **** ****   ****    

23. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.75

ggaggccgaggcggagtggctcgacaacctgc	CRISPR spacer
ggaggccgaggcggagagcctcgccgcgatgg	Protospacer
**************** * **** *.   ** 

24. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719

ggaggccgaggcggagtggctcgacaacctgc	CRISPR spacer
tcaggccgaggcggaggggctggaccgcgtct	Protospacer
  ************** **** *** .* * .

25. spacer 2.3|1597130|32|NZ_CP010377|CRISPRCasFinder matches to NC_004444 (Pseudomonas resinovorans plasmid pCAR1, complete sequence) position: , mismatch: 9, identity: 0.719

cgaccgtaagcggatggattcagggcgttaag	CRISPR spacer
tttcgcgaagcggatgaattcaggccgttacg	Protospacer
.  *   *********.******* ***** *

26. spacer 2.3|1597130|32|NZ_CP010377|CRISPRCasFinder matches to NC_021506 (Pseudomonas resinovorans NBRC 106553 plasmid pCAR1.3, complete sequence) position: , mismatch: 9, identity: 0.719

cgaccgtaagcggatggattcagggcgttaag	CRISPR spacer
tttcgcgaagcggatgaattcaggccgttacg	Protospacer
.  *   *********.******* ***** *

27. spacer 2.3|1597130|32|NZ_CP010377|CRISPRCasFinder matches to NC_011838 (Pseudomonas putida plasmid pCAR1.2, complete sequence) position: , mismatch: 9, identity: 0.719

cgaccgtaagcggatggattcagggcgttaag	CRISPR spacer
tttcgcgaagcggatgaattcaggccgttacg	Protospacer
.  *   *********.******* ***** *

28. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053709 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaggccgaggcggagtggctcgacaacctgc	CRISPR spacer
actcaatcaggcggagtggctcgccatcctgc	Protospacer
.   . . *************** ** *****

29. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053710 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaggccgaggcggagtggctcgacaacctgc	CRISPR spacer
actcaatcaggcggagtggctcgccatcctgc	Protospacer
.   . . *************** ** *****

30. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to MN310547 (Mycobacterium phage Hutc2, complete genome) position: , mismatch: 10, identity: 0.688

ggaggccgaggcggagtggctcgacaacctgc	CRISPR spacer
gttcctgcaggcgcagaggctcgacaacctga	Protospacer
*    .  ***** ** ************** 

31. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to MF472893 (Mycobacterium phage MissWhite, complete genome) position: , mismatch: 10, identity: 0.688

ggaggccgaggcggagtggctcgacaacctgc	CRISPR spacer
ctacctgcaggcgcagaggctcgacaacctga	Protospacer
  *  .  ***** ** ************** 

32. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to MK524519 (Mycobacterium phage Salz, complete genome) position: , mismatch: 10, identity: 0.688

ggaggccgaggcggagtggctcgacaacctgc	CRISPR spacer
gttcctgcaggcgcagaggctcgacaacctga	Protospacer
*    .  ***** ** ************** 

33. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to MF140410 (Mycobacterium phage Et2Brutus, complete genome) position: , mismatch: 10, identity: 0.688

ggaggccgaggcggagtggctcgacaacctgc	CRISPR spacer
gttcctgcaggcgcagaggctcgacaacctga	Protospacer
*    .  ***** ** ************** 

34. spacer 1.2|1581738|32|NZ_CP010377|PILER-CR,CRISPRCasFinder,CRT matches to KY471460 (Mycobacterium phage Jabith, complete genome) position: , mismatch: 10, identity: 0.688

ggaggccgaggcggagtggctcgacaacctgc	CRISPR spacer
gttcctgcaggcgcagaggctcgacaacctga	Protospacer
*    .  ***** ** ************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 831014 : 849754 24 uncultured_Caudovirales_phage(64.29%) head,tail,integrase,terminase,protease,portal,capsid attL 830967:830985|attR 847348:847366
DBSCAN-SWA_2 1165738 : 1199996 56 Salmonella_phage(34.78%) head,lysis,holin,integrase attL 1165679:1165725|attR 1212791:1212837
DBSCAN-SWA_3 1203400 : 1212613 9 Cronobacter_phage(55.56%) tail NA
DBSCAN-SWA_4 2830552 : 2839739 9 Burkholderia_phage(33.33%) transposase NA
DBSCAN-SWA_5 2894224 : 2903080 8 Tupanvirus(28.57%) NA NA
DBSCAN-SWA_6 3720854 : 3778756 55 Salmonella_phage(57.14%) transposase,protease,integrase,tRNA attL 3716712:3716748|attR 3743838:3743874
DBSCAN-SWA_7 3786446 : 3831484 34 uncultured_Caudovirales_phage(33.33%) transposase,integrase attL 3800868:3800883|attR 3838749:3838764
DBSCAN-SWA_8 3885192 : 3907908 26 uncultured_Caudovirales_phage(68.42%) tail,head,integrase,terminase,tRNA,protease,portal,capsid attL 3891372:3891393|attR 3907958:3907979
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP010378
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010378_1 51302-51429 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP015078 Escherichia coli strain Ecol_448 plasmid pEC448_OXA163, complete sequence 32887-32909 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP034403 Escherichia coli strain CRE10 plasmid pCRE10.4, complete sequence 34726-34748 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_EF219134 Klebsiella pneumoniae isolate JIE137 plasmid pJIE137, complete sequence 51055-51077 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP022277 Citrobacter freundii strain 18-1 plasmid pD18-1, complete sequence 20150-20172 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP050010 Citrobacter sp. Y3 plasmid unnamed1, complete sequence 32455-32477 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP027617 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence 20308-20330 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP024879 Klebsiella pneumoniae strain NH25 plasmid pNH25.5, complete sequence 34833-34855 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP043856 Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid pIMPIncN3_52kb, complete sequence 276-298 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP026184 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence 39010-39032 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP011646 Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence 33130-33152 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP040826 Enterobacter cloacae strain NH77 plasmid pEcloNH77, complete sequence 29824-29846 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP043516 Enterobacter kobei strain EB_P8_L5_01.19 plasmid pIMPIncN3_57kb, complete sequence 44764-44786 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 MN583554 Escherichia coli strain M17224 plasmid p17511_70, complete sequence 39767-39789 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP027125 Escherichia coli strain AR_0374 plasmid unnamed3 3381-3403 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP026279 Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence 481-503 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_KX784503 Citrobacter freundii strain 17285 plasmid p17285-IMP, complete sequence 10869-10891 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_KX784502 Klebsiella oxytoca strain 7121 plasmid p7121-IMP, complete sequence 10854-10876 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_KT148595 Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence 31495-31517 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_KT345947 Klebsiella pneumoniae strain 2013050801 plasmid p0801-IMP, complete sequence 10976-10998 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP010378 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence 51379-51401 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 MN967025 Klebsiella pneumoniae strain KP2611 plasmid pKP2611-N, complete sequence 11482-11504 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 MK368725 Escherichia coli strain JN24 plasmid pJN24NDM1, complete sequence 10989-11011 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NC_019163 Klebsiella pneumoniae plasmid pTR4, complete sequence 10987-11009 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 139357-139379 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP029112 Escherichia coli strain AR436 plasmid unnamed3, complete sequence 52046-52068 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP026205 Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence 113-135 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_LT985223 Escherichia coli strain 711 plasmid RCS25_p, complete sequence 3799-3821 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP034398 Escherichia coli strain CRE1 plasmid pCRE1.4, complete sequence 8450-8472 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP042548 Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence 16661-16683 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NC_015872 Escherichia coli plasmid p271A, complete sequence 20552-20574 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP027137 Escherichia coli strain AR_0369 plasmid unnamed1, complete sequence 47670-47692 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP026232 Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence 47772-47794 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP019907 Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence 18732-18754 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_LT985250 Escherichia coli strain 170 plasmid RCS38_p, complete sequence 186437-186459 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NC_024954 Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence 10989-11011 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP010382 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence 52783-52805 0 1.0
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 NZ_CP035471 Escherichia coli strain U12A plasmid pU12A_D, complete sequence 8523-8545 2 0.913
NZ_CP010378_1 1.2|51391|23|NZ_CP010378|PILER-CR 51391-51413 23 KX863569 Uncultured bacterium plasmid pTRE-131 clone TRE-131, complete sequence 11643-11665 2 0.913

1. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP015078 (Escherichia coli strain Ecol_448 plasmid pEC448_OXA163, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

2. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP034403 (Escherichia coli strain CRE10 plasmid pCRE10.4, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

3. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_EF219134 (Klebsiella pneumoniae isolate JIE137 plasmid pJIE137, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

4. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP022277 (Citrobacter freundii strain 18-1 plasmid pD18-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

5. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP050010 (Citrobacter sp. Y3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

6. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP027617 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

7. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP024879 (Klebsiella pneumoniae strain NH25 plasmid pNH25.5, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

8. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP043856 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid pIMPIncN3_52kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

9. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP026184 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

10. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP011646 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

11. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP040826 (Enterobacter cloacae strain NH77 plasmid pEcloNH77, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

12. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP043516 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid pIMPIncN3_57kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

13. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to MN583554 (Escherichia coli strain M17224 plasmid p17511_70, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

14. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP027125 (Escherichia coli strain AR_0374 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

15. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP026279 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

16. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_KX784503 (Citrobacter freundii strain 17285 plasmid p17285-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

17. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_KX784502 (Klebsiella oxytoca strain 7121 plasmid p7121-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

18. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_KT148595 (Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

19. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_KT345947 (Klebsiella pneumoniae strain 2013050801 plasmid p0801-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

20. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP010378 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

21. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to MN967025 (Klebsiella pneumoniae strain KP2611 plasmid pKP2611-N, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

22. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to MK368725 (Escherichia coli strain JN24 plasmid pJN24NDM1, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

23. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NC_019163 (Klebsiella pneumoniae plasmid pTR4, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

24. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

25. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP029112 (Escherichia coli strain AR436 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

26. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP026205 (Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

27. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_LT985223 (Escherichia coli strain 711 plasmid RCS25_p, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

28. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP034398 (Escherichia coli strain CRE1 plasmid pCRE1.4, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

29. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP042548 (Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

30. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NC_015872 (Escherichia coli plasmid p271A, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

31. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP027137 (Escherichia coli strain AR_0369 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

32. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP026232 (Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

33. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP019907 (Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

34. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_LT985250 (Escherichia coli strain 170 plasmid RCS38_p, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

35. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NC_024954 (Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

36. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP010382 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

37. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to NZ_CP035471 (Escherichia coli strain U12A plasmid pU12A_D, complete sequence) position: , mismatch: 2, identity: 0.913

gtttcttctgttgctcactggct	CRISPR spacer
ttttcttttgttgctcactggct	Protospacer
 ******.***************

38. spacer 1.2|51391|23|NZ_CP010378|PILER-CR matches to KX863569 (Uncultured bacterium plasmid pTRE-131 clone TRE-131, complete sequence) position: , mismatch: 2, identity: 0.913

gtttcttctgttgctcactggct	CRISPR spacer
ttttcttttgttgctcactggct	Protospacer
 ******.***************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4384 : 43746 39 Salmonella_phage(25.0%) transposase,integrase,protease attL 9602:9615|attR 19025:19038
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP010380
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 10746 9 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_2 25634 : 26669 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_3 29916 : 30921 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_4 45682 : 54490 8 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_5 61786 : 66429 3 Wolbachia_phage(50.0%) NA NA
DBSCAN-SWA_6 71017 : 79667 11 Cronobacter_phage(25.0%) NA NA
DBSCAN-SWA_7 106901 : 110372 5 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_8 114860 : 116548 4 Cronobacter_phage(33.33%) NA NA
DBSCAN-SWA_9 120498 : 125068 7 Caulobacter_phage(66.67%) NA NA
DBSCAN-SWA_10 135227 : 137537 3 Stx2-converting_phage(100.0%) transposase NA
DBSCAN-SWA_11 141152 : 144949 4 Shigella_phage(50.0%) transposase NA
DBSCAN-SWA_12 155349 : 157975 5 Salmonella_phage(66.67%) NA NA
DBSCAN-SWA_13 165779 : 168556 3 Pectobacterium_phage(50.0%) NA NA
DBSCAN-SWA_14 172309 : 175822 4 Escherichia_phage(33.33%) transposase NA
DBSCAN-SWA_15 207625 : 263900 58 Escherichia_phage(29.41%) protease,transposase NA
DBSCAN-SWA_16 275367 : 289049 14 Wolbachia_phage(33.33%) NA NA
DBSCAN-SWA_17 294678 : 295500 1 Pithovirus(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage