Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012168 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-239.973kb, complete sequence 0 crisprs PD-DExK 0 0 1 0
NZ_CP010382 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP012167 Enterobacter hormaechei subsp. steigerwaltii strain 34998 chromosome, complete genome 1 crisprs DEDDh,csa3,WYL,DinG,cas14j,cas3 0 1 6 0
NZ_CP012169 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence 1 crisprs csa3 0 1 3 0
NZ_CP010383 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-106.409kb, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP010381 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-4.921kb, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP012168
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 132880 : 201578 62 Escherichia_phage(20.83%) transposase,integrase attL 141455:141514|attR 193609:195203
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP010383
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 58056 : 65078 10 Escherichia_phage(33.33%) integrase attL 53570:53583|attR 74353:74366
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP010382
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010382_1 22368-22465 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010382_1 1.1|22397|40|NZ_CP010382|CRISPRCasFinder 22397-22436 40 NZ_CP026279 Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence 23224-23263 0 1.0
NZ_CP010382_1 1.1|22397|40|NZ_CP010382|CRISPRCasFinder 22397-22436 40 NZ_KT148595 Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence 976-1015 0 1.0
NZ_CP010382_1 1.1|22397|40|NZ_CP010382|CRISPRCasFinder 22397-22436 40 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 169583-169622 0 1.0
NZ_CP010382_1 1.1|22397|40|NZ_CP010382|CRISPRCasFinder 22397-22436 40 NZ_CP029112 Escherichia coli strain AR436 plasmid unnamed3, complete sequence 16875-16914 0 1.0
NZ_CP010382_1 1.1|22397|40|NZ_CP010382|CRISPRCasFinder 22397-22436 40 NZ_CP026232 Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence 7925-7964 0 1.0
NZ_CP010382_1 1.1|22397|40|NZ_CP010382|CRISPRCasFinder 22397-22436 40 NZ_CP010382 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence 22397-22436 0 1.0
NZ_CP010382_1 1.1|22397|40|NZ_CP010382|CRISPRCasFinder 22397-22436 40 NZ_CP027617 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence 51791-51830 0 1.0
NZ_CP010382_1 1.1|22397|40|NZ_CP010382|CRISPRCasFinder 22397-22436 40 NZ_CP026184 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence 14118-14157 0 1.0
NZ_CP010382_1 1.1|22397|40|NZ_CP010382|CRISPRCasFinder 22397-22436 40 NZ_CP011646 Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence 74625-74664 0 1.0
NZ_CP010382_1 1.1|22397|40|NZ_CP010382|CRISPRCasFinder 22397-22436 40 NZ_CP027125 Escherichia coli strain AR_0374 plasmid unnamed3 38535-38574 0 1.0
NZ_CP010382_1 1.1|22397|40|NZ_CP010382|CRISPRCasFinder 22397-22436 40 NZ_CP026205 Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence 22855-22894 1 0.975
NZ_CP010382_1 1.1|22397|40|NZ_CP010382|CRISPRCasFinder 22397-22436 40 NZ_CP019907 Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence 8399-8438 4 0.9
NZ_CP010382_1 1.1|22397|40|NZ_CP010382|CRISPRCasFinder 22397-22436 40 NZ_CP017587 Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ06, complete sequence 38093-38132 4 0.9

1. spacer 1.1|22397|40|NZ_CP010382|CRISPRCasFinder matches to NZ_CP026279 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

2. spacer 1.1|22397|40|NZ_CP010382|CRISPRCasFinder matches to NZ_KT148595 (Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

3. spacer 1.1|22397|40|NZ_CP010382|CRISPRCasFinder matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

4. spacer 1.1|22397|40|NZ_CP010382|CRISPRCasFinder matches to NZ_CP029112 (Escherichia coli strain AR436 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

5. spacer 1.1|22397|40|NZ_CP010382|CRISPRCasFinder matches to NZ_CP026232 (Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

6. spacer 1.1|22397|40|NZ_CP010382|CRISPRCasFinder matches to NZ_CP010382 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

7. spacer 1.1|22397|40|NZ_CP010382|CRISPRCasFinder matches to NZ_CP027617 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

8. spacer 1.1|22397|40|NZ_CP010382|CRISPRCasFinder matches to NZ_CP026184 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

9. spacer 1.1|22397|40|NZ_CP010382|CRISPRCasFinder matches to NZ_CP011646 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

10. spacer 1.1|22397|40|NZ_CP010382|CRISPRCasFinder matches to NZ_CP027125 (Escherichia coli strain AR_0374 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

11. spacer 1.1|22397|40|NZ_CP010382|CRISPRCasFinder matches to NZ_CP026205 (Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence) position: , mismatch: 1, identity: 0.975

-tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
atatta-ccccccctagcaagataaattgcccccctaaccg	Protospacer
 ***** **********************************

12. spacer 1.1|22397|40|NZ_CP010382|CRISPRCasFinder matches to NZ_CP019907 (Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.9

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
aaattaccccccctagcaagataaattgcccccctaaccg	Protospacer
 * *  **********************************

13. spacer 1.1|22397|40|NZ_CP010382|CRISPRCasFinder matches to NZ_CP017587 (Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ06, complete sequence) position: , mismatch: 4, identity: 0.9

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
aaattaccccccctagcaagataaattgcccccctaaccg	Protospacer
 * *  **********************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP012167
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012167_1 1583994-1584082 Orphan I-F
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012167_1 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder 1584023-1584053 31 JF974302 Vibrio phage VBpm10, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces 21037-21067 6 0.806
NZ_CP012167_1 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder 1584023-1584053 31 MG592513 Vibrio phage 1.142.O._10N.261.49.E11, partial genome 26631-26661 7 0.774
NZ_CP012167_1 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder 1584023-1584053 31 MG592412 Vibrio phage 1.028.O._10N.286.45.B6, partial genome 26631-26661 7 0.774
NZ_CP012167_1 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder 1584023-1584053 31 MG592527 Vibrio phage 1.159.O._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP012167_1 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder 1584023-1584053 31 MG592588 Vibrio phage 1.217.O._10N.261.45.A1, partial genome 26631-26661 7 0.774
NZ_CP012167_1 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder 1584023-1584053 31 MG592589 Vibrio phage 1.219.O._10N.261.45.E2, partial genome 26631-26661 7 0.774
NZ_CP012167_1 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder 1584023-1584053 31 MG592524 Vibrio phage 1.156.O._10N.261.45.A6, partial genome 26631-26661 7 0.774
NZ_CP012167_1 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder 1584023-1584053 31 MG592669 Vibrio phage 2.159.A._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP012167_1 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder 1584023-1584053 31 MG592670 Vibrio phage 2.159.B._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP012167_1 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder 1584023-1584053 31 MG592507 Vibrio phage 1.136.O._10N.261.45.E11, partial genome 26631-26661 7 0.774
NZ_CP012167_1 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder 1584023-1584053 31 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1534665-1534695 7 0.774
NZ_CP012167_1 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder 1584023-1584053 31 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 62534-62564 8 0.742
NZ_CP012167_1 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder 1584023-1584053 31 NZ_CP035511 Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence 283146-283176 8 0.742
NZ_CP012167_1 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder 1584023-1584053 31 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 22328-22358 9 0.71
NZ_CP012167_1 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder 1584023-1584053 31 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 475099-475129 9 0.71
NZ_CP012167_1 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder 1584023-1584053 31 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 714186-714216 10 0.677

1. spacer 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder matches to JF974302 (Vibrio phage VBpm10, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces) position: , mismatch: 6, identity: 0.806

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcattgt	Protospacer
**********.** ********* *..** *

2. spacer 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder matches to MG592513 (Vibrio phage 1.142.O._10N.261.49.E11, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

3. spacer 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder matches to MG592412 (Vibrio phage 1.028.O._10N.286.45.B6, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

4. spacer 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder matches to MG592527 (Vibrio phage 1.159.O._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

5. spacer 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder matches to MG592588 (Vibrio phage 1.217.O._10N.261.45.A1, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

6. spacer 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder matches to MG592589 (Vibrio phage 1.219.O._10N.261.45.E2, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

7. spacer 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder matches to MG592524 (Vibrio phage 1.156.O._10N.261.45.A6, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

8. spacer 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder matches to MG592669 (Vibrio phage 2.159.A._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

9. spacer 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder matches to MG592670 (Vibrio phage 2.159.B._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

10. spacer 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder matches to MG592507 (Vibrio phage 1.136.O._10N.261.45.E11, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

11. spacer 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccag----cgtgtttt	CRISPR spacer
acggcgagaccgtcacgcgccaggtgccggg----	Protospacer
******* **** **********    ** *    

12. spacer 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 8, identity: 0.742

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
gcggcgacaccgacactcgcccgcgatctca	Protospacer
.*************** **** ***  .*. 

13. spacer 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 8, identity: 0.742

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
tcggcgatgccgacacgcgccagcagttcta	Protospacer
 ******..***************.  *.* 

14. spacer 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.71

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
ccggcgacatcgacacgcggcagcccaggat	Protospacer
 ********.********* **** ..   *

15. spacer 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 9, identity: 0.71

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
ccggcgacaccgacacccggcagcccaggat	Protospacer
 *************** ** **** ..   *

16. spacer 1.1|1584023|31|NZ_CP012167|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.677

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
ggggcgactccgacccgcgccagcgccgcag	Protospacer
. ****** ***** **********.  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1094956 : 1166954 86 Burkholderia_virus(39.13%) tRNA,capsid,tail,integrase,plate,protease,transposase attL 1092638:1092655|attR 1166210:1166227
DBSCAN-SWA_2 1595741 : 1667117 57 Enterobacteria_phage(17.24%) tRNA,protease,integrase,tail attL 1651869:1651885|attR 1662265:1662281
DBSCAN-SWA_3 1923180 : 1959642 42 Salmonella_phage(25.81%) tRNA,integrase,lysis,tail attL 1931404:1931423|attR 1957733:1957752
DBSCAN-SWA_4 2898629 : 2907876 9 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_5 3342171 : 3425921 95 Escherichia_phage(43.1%) tRNA,coat,tail,integrase,terminase,holin,protease attL 3361516:3361530|attR 3430039:3430053
DBSCAN-SWA_6 3986815 : 3993045 8 Escherichia_phage(33.33%) plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP012169
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012169_1 39984-40118 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP012428 Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence 20127-20165 0 1.0
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NC_014107 Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence 48095-48133 0 1.0
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP046273 Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence 40032-40070 0 1.0
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP012169 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence 40032-40070 0 1.0
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP042541 Enterobacter hormaechei strain C4 plasmid pC4_001, complete sequence 40032-40070 0 1.0
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP031723 Enterobacter hormaechei strain WCHEH020038 plasmid p2_020038, complete sequence 50311-50349 0 1.0
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP042567 Enterobacter hormaechei strain C44 plasmid pC44_001, complete sequence 40032-40070 0 1.0
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP035636 Enterobacter cloacae strain EN3600 plasmid unnamed4, complete sequence 100226-100264 1 0.974
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP017182 Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence 1315-1353 1 0.974
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP017182 Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence 1402-1440 1 0.974
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP031569 Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence 7815-7853 1 0.974
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP050011 Citrobacter sp. Y3 plasmid unnamed2, complete sequence 27572-27610 1 0.974
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP019840 Enterobacter roggenkampii strain R11 plasmid pASM1, complete sequence 70340-70378 1 0.974
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP022149 Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence 50338-50376 1 0.974
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP009855 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence 14593-14631 1 0.974
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP008907 Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence 83191-83229 1 0.974
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP026851 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1 65584-65622 1 0.974
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_LT991956 Enterobacter hormaechei subsp. steigerwaltii isolate C309 plasmid pC309-p2 52487-52525 1 0.974
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP029719 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed1, complete sequence 1341-1379 1 0.974
NZ_CP012169_1 1.1|40032|39|NZ_CP012169|CRISPRCasFinder 40032-40070 39 NZ_CP039454 Enterobacter bugandensis strain 220 plasmid pSurvcare220, complete sequence 72766-72804 3 0.923

1. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP012428 (Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgtc	Protospacer
***************************************

2. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NC_014107 (Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgtc	Protospacer
***************************************

3. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP046273 (Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgtc	Protospacer
***************************************

4. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP012169 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgtc	Protospacer
***************************************

5. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP042541 (Enterobacter hormaechei strain C4 plasmid pC4_001, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgtc	Protospacer
***************************************

6. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP031723 (Enterobacter hormaechei strain WCHEH020038 plasmid p2_020038, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgtc	Protospacer
***************************************

7. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP042567 (Enterobacter hormaechei strain C44 plasmid pC44_001, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgtc	Protospacer
***************************************

8. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP035636 (Enterobacter cloacae strain EN3600 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
*************************************.*

9. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP017182 (Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
*************************************.*

10. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP017182 (Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
*************************************.*

11. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP031569 (Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
*************************************.*

12. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP050011 (Citrobacter sp. Y3 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
*************************************.*

13. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP019840 (Enterobacter roggenkampii strain R11 plasmid pASM1, complete sequence) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
*************************************.*

14. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP022149 (Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
*************************************.*

15. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP009855 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
*************************************.*

16. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP008907 (Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
*************************************.*

17. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP026851 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
*************************************.*

18. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_LT991956 (Enterobacter hormaechei subsp. steigerwaltii isolate C309 plasmid pC309-p2) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
*************************************.*

19. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP029719 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
*************************************.*

20. spacer 1.1|40032|39|NZ_CP012169|CRISPRCasFinder matches to NZ_CP039454 (Enterobacter bugandensis strain 220 plasmid pSurvcare220, complete sequence) position: , mismatch: 3, identity: 0.923

ctcctacttgcgtgtcagaactcatccttcaaccccgtc	CRISPR spacer
ctcctacttgcgtttcagaactcatccgtcaaccccgcc	Protospacer
************* ************* *********.*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 34283 : 57016 20 Escherichia_phage(28.57%) transposase,integrase attL 45324:45383|attR 54108:54928
DBSCAN-SWA_2 60189 : 113876 60 uncultured_Caudovirales_phage(40.91%) transposase NA
DBSCAN-SWA_3 159705 : 199348 41 Escherichia_phage(23.08%) transposase,protease,integrase attL 168419:168435|attR 202484:202500
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage