Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007457 Bifidobacterium pseudolongum PV8-2 chromosome, complete genome 2 crisprs WYL,cas3,DEDDh,csb3,csb2gr5,csb1gr7,cas2,cas1,csa3 0 2 0 0

Results visualization

1. NZ_CP007457
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007457_1 512742-512824 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007457_2 1597021-1599312 Unclear NA
31 spacers
cas1,cas2,csb1gr7,csb2gr5,cas3,csb3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007457_2 2.25|1598804|35|NZ_CP007457|CRISPRCasFinder,CRT,PILER-CR 1598804-1598838 35 NZ_CP049159 Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence 356444-356478 8 0.771
NZ_CP007457_2 2.25|1598804|35|NZ_CP007457|CRISPRCasFinder,CRT,PILER-CR 1598804-1598838 35 NZ_CP049320 Caballeronia sp. SBC2 plasmid pSBC2-4, complete sequence 285910-285944 8 0.771
NZ_CP007457_2 2.21|1598513|35|NZ_CP007457|CRISPRCasFinder,CRT,PILER-CR 1598513-1598547 35 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 128224-128258 10 0.714

1. spacer 2.25|1598804|35|NZ_CP007457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049159 (Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence) position: , mismatch: 8, identity: 0.771

aatgccc--cgccgcgttgcgcgcggacgtccggcgg	CRISPR spacer
--tgctcgacgccgcgttgcgcgcgggcgtgcggatt	Protospacer
  ***.*  *****************.*** ***   

2. spacer 2.25|1598804|35|NZ_CP007457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049320 (Caballeronia sp. SBC2 plasmid pSBC2-4, complete sequence) position: , mismatch: 8, identity: 0.771

aatgccc--cgccgcgttgcgcgcggacgtccggcgg	CRISPR spacer
--tgctcgacgccgcgttgcgcgcgggcgtgcggatt	Protospacer
  ***.*  *****************.*** ***   

3. spacer 2.21|1598513|35|NZ_CP007457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714

cgcatcgcggtctcgtgccgttcgcggatacgcag	CRISPR spacer
ttcatcgcgttttcgtgccgttcgcggcgggggcg	Protospacer
. ******* *.***************  . *  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage