Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009962 Collimonas arenae strain Cal35 chromosome, complete genome 1 crisprs WYL,cas3,RT,csa3,DEDDh,DinG 1 0 5 0
NZ_CP009963 Collimonas arenae strain Cal35 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP009962
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009962_1 2851766-2851851 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP009962_1 1.1|2851789|40|NZ_CP009962|CRISPRCasFinder 2851789-2851828 40 NZ_CP009962.1 2849236-2849275 0 1.0
NZ_CP009962_1 1.1|2851789|40|NZ_CP009962|CRISPRCasFinder 2851789-2851828 40 NZ_CP009962.1 2852422-2852461 2 0.95

1. spacer 1.1|2851789|40|NZ_CP009962|CRISPRCasFinder matches to position: 2849236-2849275, mismatch: 0, identity: 1.0

cgtcacgtcgctatcgactggcattacgtcgctatcgacg	CRISPR spacer
cgtcacgtcgctatcgactggcattacgtcgctatcgacg	Protospacer
****************************************

2. spacer 1.1|2851789|40|NZ_CP009962|CRISPRCasFinder matches to position: 2852422-2852461, mismatch: 2, identity: 0.95

cgtcacgtcgctatcgactggcattacgtcgctatcgacg	CRISPR spacer
cgtcacatcgctatcgactggcattacgtcgttatcgacg	Protospacer
******.************************.********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1134510 : 1147623 23 Burkholderia_virus(27.27%) terminase NA
DBSCAN-SWA_2 1160494 : 1180066 15 Pseudomonas_phage(22.22%) integrase attL 1158461:1158475|attR 1179584:1179598
DBSCAN-SWA_3 1375468 : 1383143 7 Phage_21(16.67%) protease NA
DBSCAN-SWA_4 3049217 : 3055989 7 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_5 4277044 : 4362326 104 Burkholderia_phage(42.86%) portal,head,tail,plate,protease,terminase,transposase,capsid,integrase,holin attL 4322019:4322035|attR 4363129:4363145
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage