Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009874 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence 0 crisprs NA 0 0 4 0
NZ_CP009873 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-294, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP009875 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKpQIL-531, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP009872 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 chromosome, complete genome 3 crisprs cas3,DEDDh,WYL,RT,DinG,csa3 0 1 11 0

Results visualization

1. NZ_CP009872
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009872_1 813115-813200 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009872_2 1278078-1278173 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009872_3 1663864-1663941 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009872_2 2.1|1278108|36|NZ_CP009872|CRISPRCasFinder 1278108-1278143 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
NZ_CP009872_2 2.1|1278108|36|NZ_CP009872|CRISPRCasFinder 1278108-1278143 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
NZ_CP009872_2 2.1|1278108|36|NZ_CP009872|CRISPRCasFinder 1278108-1278143 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 2.1|1278108|36|NZ_CP009872|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

2. spacer 2.1|1278108|36|NZ_CP009872|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

3. spacer 2.1|1278108|36|NZ_CP009872|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 590780 : 596605 8 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_2 1267052 : 1312327 65 Escherichia_phage(25.0%) tRNA,holin,head,lysis NA
DBSCAN-SWA_3 1757437 : 1794773 47 Salmonella_phage(87.18%) portal,tail,lysis,head,integrase,terminase,plate,capsid attL 1757345:1757363|attR 1794845:1794863
DBSCAN-SWA_4 1829189 : 1838653 8 Dickeya_phage(16.67%) tRNA,protease NA
DBSCAN-SWA_5 1939237 : 1961893 33 Pectobacterium_phage(28.57%) tail,head,integrase attL 1938140:1938154|attR 1971100:1971114
DBSCAN-SWA_6 1967009 : 1983089 14 Salmonella_phage(50.0%) holin NA
DBSCAN-SWA_7 2307464 : 2379218 83 uncultured_Caudovirales_phage(35.29%) holin,transposase,integrase,terminase,plate attL 2305545:2305559|attR 2314485:2314499
DBSCAN-SWA_8 2574732 : 2585619 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_9 3234597 : 3277697 41 Microcystis_virus(25.0%) tRNA,plate,transposase NA
DBSCAN-SWA_10 3584898 : 3591805 6 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_11 4755319 : 4825897 73 uncultured_Caudovirales_phage(60.0%) capsid,protease,portal,head,transposase,integrase,tRNA,terminase,tail attL 4791078:4791095|attR 4808273:4808290
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP009875
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10758 : 42817 31 Escherichia_phage(25.0%) transposase,integrase attL 17251:17268|attR 52015:52032
DBSCAN-SWA_2 47392 : 59484 12 Enterobacteria_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP009874
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 14855 10 Bodo_saltans_virus(16.67%) integrase,transposase attL 2480:2492|attR 11787:11799
DBSCAN-SWA_2 28092 : 28626 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_3 38407 : 38641 1 Klebsiella_phage(100.0%) NA NA
DBSCAN-SWA_4 45956 : 47650 2 Morganella_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage