Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009856 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence 0 crisprs csa3 0 0 2 0
NZ_CP009858 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pKPC-47e, complete sequence 0 crisprs NA 0 0 4 0
NZ_CP009854 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5, complete genome 3 crisprs DEDDh,csa3,WYL,DinG,cas3,c2c9_V-U4 0 0 5 0
NZ_CP009857 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-d0d, complete sequence 0 crisprs DEDDh 0 0 3 0
NZ_CP009855 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence 1 crisprs NA 0 1 1 0

Results visualization

1. NZ_CP009856
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8438 : 17878 10 Escherichia_phage(57.14%) integrase,transposase attL 3325:3340|attR 20773:20788
DBSCAN-SWA_2 35933 : 46388 11 uncultured_Caudovirales_phage(85.71%) bacteriocin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP009855
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009855_1 14545-14679 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP035636 Enterobacter cloacae strain EN3600 plasmid unnamed4, complete sequence 100226-100264 0 1.0
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP017182 Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence 1315-1353 0 1.0
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP017182 Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence 1402-1440 0 1.0
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP031569 Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence 7815-7853 0 1.0
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP050011 Citrobacter sp. Y3 plasmid unnamed2, complete sequence 27572-27610 0 1.0
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP019840 Enterobacter roggenkampii strain R11 plasmid pASM1, complete sequence 70340-70378 0 1.0
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP022149 Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence 50338-50376 0 1.0
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP009855 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence 14593-14631 0 1.0
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP008907 Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence 83191-83229 0 1.0
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP026851 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1 65584-65622 0 1.0
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_LT991956 Enterobacter hormaechei subsp. steigerwaltii isolate C309 plasmid pC309-p2 52487-52525 0 1.0
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP029719 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed1, complete sequence 1341-1379 0 1.0
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP012428 Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence 20127-20165 1 0.974
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NC_014107 Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence 48095-48133 1 0.974
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP046273 Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence 40032-40070 1 0.974
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP012169 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence 40032-40070 1 0.974
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP042541 Enterobacter hormaechei strain C4 plasmid pC4_001, complete sequence 40032-40070 1 0.974
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP031723 Enterobacter hormaechei strain WCHEH020038 plasmid p2_020038, complete sequence 50311-50349 1 0.974
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP042567 Enterobacter hormaechei strain C44 plasmid pC44_001, complete sequence 40032-40070 1 0.974
NZ_CP009855_1 1.1|14593|39|NZ_CP009855|CRISPRCasFinder 14593-14631 39 NZ_CP039454 Enterobacter bugandensis strain 220 plasmid pSurvcare220, complete sequence 72766-72804 2 0.949

1. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP035636 (Enterobacter cloacae strain EN3600 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
***************************************

2. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP017182 (Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
***************************************

3. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP017182 (Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
***************************************

4. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP031569 (Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
***************************************

5. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP050011 (Citrobacter sp. Y3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
***************************************

6. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP019840 (Enterobacter roggenkampii strain R11 plasmid pASM1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
***************************************

7. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP022149 (Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
***************************************

8. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP009855 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
***************************************

9. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP008907 (Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
***************************************

10. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP026851 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
***************************************

11. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_LT991956 (Enterobacter hormaechei subsp. steigerwaltii isolate C309 plasmid pC309-p2) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
***************************************

12. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP029719 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgcc	Protospacer
***************************************

13. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP012428 (Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgtc	Protospacer
*************************************.*

14. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NC_014107 (Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgtc	Protospacer
*************************************.*

15. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP046273 (Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgtc	Protospacer
*************************************.*

16. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP012169 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgtc	Protospacer
*************************************.*

17. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP042541 (Enterobacter hormaechei strain C4 plasmid pC4_001, complete sequence) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgtc	Protospacer
*************************************.*

18. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP031723 (Enterobacter hormaechei strain WCHEH020038 plasmid p2_020038, complete sequence) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgtc	Protospacer
*************************************.*

19. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP042567 (Enterobacter hormaechei strain C44 plasmid pC44_001, complete sequence) position: , mismatch: 1, identity: 0.974

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtgtcagaactcatccttcaaccccgtc	Protospacer
*************************************.*

20. spacer 1.1|14593|39|NZ_CP009855|CRISPRCasFinder matches to NZ_CP039454 (Enterobacter bugandensis strain 220 plasmid pSurvcare220, complete sequence) position: , mismatch: 2, identity: 0.949

ctcctacttgcgtgtcagaactcatccttcaaccccgcc	CRISPR spacer
ctcctacttgcgtttcagaactcatccgtcaaccccgcc	Protospacer
************* ************* ***********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8844 : 57648 46 Macacine_betaherpesvirus(17.65%) protease,integrase,transposase attL 7237:7251|attR 12182:12196
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP009854
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009854_1 1542004-1542117 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009854_2 3213397-3213505 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009854_3 4146733-4146818 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 937951 : 953729 15 Streptococcus_phage(16.67%) terminase,integrase,holin attL 936216:936230|attR 952864:952878
DBSCAN-SWA_2 2075494 : 2084842 10 Morganella_phage(28.57%) NA NA
DBSCAN-SWA_3 2090291 : 2099869 10 Cronobacter_phage(44.44%) tail NA
DBSCAN-SWA_4 2576940 : 2644728 57 uncultured_Caudovirales_phage(13.33%) tRNA,integrase,plate,transposase attL 2586445:2586459|attR 2602088:2602102
DBSCAN-SWA_5 2950604 : 2959853 9 Escherichia_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP009857
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 36980 46 Escherichia_phage(33.33%) protease,transposase,integrase attL 1445:1459|attR 35475:35489
DBSCAN-SWA_2 40225 : 43229 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_3 46898 : 48865 2 Pseudomonas_phage(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP009858
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 9073 10 Burkholderia_phage(50.0%) transposase,integrase attL 2606:2623|attR 9790:9807
DBSCAN-SWA_2 22119 : 22653 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_3 26670 : 34524 5 Staphylococcus_prophage(25.0%) transposase NA
DBSCAN-SWA_4 46238 : 47932 2 Morganella_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage