Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009777 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence 0 crisprs csa3,RT,cas3 0 0 2 0
NZ_CP009775 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 chromosome, complete genome 3 crisprs cas3,DEDDh,WYL,RT,DinG,csa3 0 1 13 0
NZ_CP009778 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-c8b, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP009776 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPC-def, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP009777
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 498 : 36779 34 Escherichia_phage(38.46%) protease,transposase,integrase attL 108:119|attR 18553:18564
DBSCAN-SWA_2 156282 : 211449 41 Stx2-converting_phage(23.08%) integrase,transposase,bacteriocin attL 153131:153148|attR 192581:192598
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP009775
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009775_1 815341-815426 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009775_2 1299312-1299407 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009775_3 1686393-1686470 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009775_2 2.1|1299342|36|NZ_CP009775|CRISPRCasFinder 1299342-1299377 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
NZ_CP009775_2 2.1|1299342|36|NZ_CP009775|CRISPRCasFinder 1299342-1299377 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
NZ_CP009775_2 2.1|1299342|36|NZ_CP009775|CRISPRCasFinder 1299342-1299377 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 2.1|1299342|36|NZ_CP009775|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

2. spacer 2.1|1299342|36|NZ_CP009775|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

3. spacer 2.1|1299342|36|NZ_CP009775|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 593006 : 598831 8 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_2 1067077 : 1078731 13 Enterobacteria_phage(70.0%) integrase attL 1055211:1055225|attR 1078268:1078282
DBSCAN-SWA_3 1288286 : 1333561 65 Escherichia_phage(25.0%) holin,lysis,head,tRNA NA
DBSCAN-SWA_4 1779966 : 1817302 47 Salmonella_phage(87.18%) head,portal,terminase,tail,lysis,plate,integrase,capsid attL 1779874:1779892|attR 1817374:1817392
DBSCAN-SWA_5 1851718 : 1861182 8 Dickeya_phage(16.67%) protease,tRNA NA
DBSCAN-SWA_6 2284619 : 2356373 83 uncultured_Caudovirales_phage(35.29%) terminase,holin,transposase,plate,integrase attL 2282700:2282714|attR 2291640:2291654
DBSCAN-SWA_7 2554287 : 2565174 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_8 3220723 : 3260760 39 Tupanvirus(20.0%) transposase,plate,tRNA NA
DBSCAN-SWA_9 3663854 : 3671479 7 Escherichia_phage(28.57%) NA NA
DBSCAN-SWA_10 3708046 : 3714953 6 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_11 4014729 : 4088379 86 Salmonella_phage(40.0%) integrase,terminase,tail,holin,transposase,protease,tRNA,capsid attL 4020371:4020388|attR 4087368:4087385
DBSCAN-SWA_12 4159604 : 4241124 88 Salmonella_phage(70.59%) head,portal,integrase,terminase,tail,lysis,plate,tRNA,capsid attL 4204308:4204354|attR 4242785:4242831
DBSCAN-SWA_13 4967632 : 5016475 56 uncultured_Caudovirales_phage(68.75%) head,portal,terminase,tail,protease,tRNA,capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP009776
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 48 : 74631 69 Escherichia_phage(27.78%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage