Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP006851 Campylobacter jejuni subsp. jejuni F38011, complete genome 2 crisprs DEDDh,WYL,cas14j,cas2,cas1,cas9,csa3 0 1 2 0

Results visualization

1. NZ_CP006851
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006851_1 1503433-1503533 orTypeII NA
1 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006851_2 1529847-1529959 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP006851_1 1.1|1503468|31|NZ_CP006851|CRISPRCasFinder 1503468-1503498 31 MN530981 Campylobacter phage DA10, complete genome 5258-5288 1 0.968

1. spacer 1.1|1503468|31|NZ_CP006851|CRISPRCasFinder matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 1, identity: 0.968

tatggcagtttttaaaagagcttggcggttg	CRISPR spacer
tatggcagtttttaaaagagcttggcggtta	Protospacer
******************************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1334432 : 1394355 77 Campylobacter_phage(54.55%) terminase,tail,plate,transposase,integrase,tRNA attL 1333662:1333679|attR 1396069:1396086
DBSCAN-SWA_2 1412756 : 1417671 6 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage