Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_HG813242 Staphylococcus epidermidis PM221 4 crisprs csa3,cas3,DEDDh,DinG,RT,WYL 0 1 8 0
NZ_HG813244 Staphylococcus epidermidis PM221 plasmid 3, complete sequence 0 crisprs NA 0 0 0 0
NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 0 crisprs NA 0 0 0 0
NZ_HG813245 Staphylococcus epidermidis PM221 plasmid 2, complete sequence 0 crisprs NA 0 0 0 0
NZ_HG813243 Staphylococcus epidermidis PM221 plasmid 4, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_HG813242
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_HG813242_1 531285-531380 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_HG813242_2 890237-890330 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_HG813242_3 898258-898348 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_HG813242_4 2002721-2002803 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_HG813242_1 1.1|531318|30|NZ_HG813242|CRISPRCasFinder 531318-531347 30 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1051845-1051874 6 0.8

1. spacer 1.1|531318|30|NZ_HG813242|CRISPRCasFinder matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8

aaaaagaggaacgcctgagcaaagctcaag	CRISPR spacer
aacaacaggaacgcctgagcaaaaagcaaa	Protospacer
** ** *****************.  ***.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 32749 : 80860 47 Streptococcus_phage(30.0%) transposase,protease NA
DBSCAN-SWA_2 414321 : 424197 12 Hokovirus(12.5%) transposase NA
DBSCAN-SWA_3 445620 : 456054 9 uncultured_Caudovirales_phage(62.5%) NA NA
DBSCAN-SWA_4 539205 : 601755 83 uncultured_Caudovirales_phage(80.6%) integrase,head,terminase,plate,portal,holin,transposase,tail,capsid,protease attL 533098:533118|attR 596235:596255
DBSCAN-SWA_5 735455 : 743925 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 964048 : 1016845 60 Staphylococcus_phage(55.56%) integrase,head,terminase,plate,holin,tRNA,tail,capsid,portal attL 984306:984365|attR 1017033:1017097
DBSCAN-SWA_7 1489304 : 1537344 38 Staphylococcus_phage(81.82%) integrase,transposase,tRNA attL 1480537:1480553|attR 1540152:1540168
DBSCAN-SWA_8 1668368 : 1682378 21 uncultured_Caudovirales_phage(70.0%) integrase,terminase attL 1663035:1663053|attR 1680418:1680436
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage