Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007742 Brucella pinnipedialis strain 6/566 chromosome 2, complete sequence 0 crisprs DEDDh,csa3,cas3 0 0 0 0
NZ_CP007743 Brucella pinnipedialis strain 6/566 chromosome 1, complete sequence 2 crisprs csa3,WYL 1 1 3 0

Results visualization

1. NZ_CP007743
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007743_1 708603-708685 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007743_2 1702392-1702559 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP007743_2 2.2|1702522|15|NZ_CP007743|PILER-CR 1702522-1702536 15 NZ_CP007743.1 1766090-1766104 0 1.0

1. spacer 2.2|1702522|15|NZ_CP007743|PILER-CR matches to position: 1766090-1766104, mismatch: 0, identity: 1.0

gccaatgccaagggc	CRISPR spacer
gccaatgccaagggc	Protospacer
***************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007743_1 1.1|708631|27|NZ_CP007743|CRISPRCasFinder 708631-708657 27 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 45587-45613 5 0.815

1. spacer 1.1|708631|27|NZ_CP007743|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

acagatctttccttgcgcgcatcttat	CRISPR spacer
tcagatctttccttgagagcatctgtt	Protospacer
 ************** * ******  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 398888 : 407239 10 Brucella_phage(33.33%) transposase NA
DBSCAN-SWA_2 477966 : 490672 13 uncultured_Mediterranean_phage(80.0%) tRNA,transposase NA
DBSCAN-SWA_3 717803 : 888317 156 Paenibacillus_phage(13.89%) tail,holin,capsid,integrase,transposase,portal,protease,head attL 708610:708624|attR 722046:722060
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage