Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007706 Brucella abortus bv. 9 str. C68 chromosome 2, complete sequence 1 crisprs DEDDh,csa3,cas3 0 0 0 0
NZ_CP007705 Brucella abortus bv. 9 str. C68 chromosome 1, complete sequence 2 crisprs csa3,WYL,DEDDh 0 2 1 0

Results visualization

1. NZ_CP007706
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007706_1 925823-925923 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP007705
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007705_1 673531-673613 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007705_2 1808641-1808729 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007705_1 1.1|673559|27|NZ_CP007705|CRISPRCasFinder 673559-673585 27 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 45587-45613 5 0.815
NZ_CP007705_2 2.1|1808667|37|NZ_CP007705|CRISPRCasFinder 1808667-1808703 37 NZ_CP020810 Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence 75259-75295 8 0.784

1. spacer 1.1|673559|27|NZ_CP007705|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ataagatgcgcgcaaggaaagatctgt	CRISPR spacer
aacagatgctctcaaggaaagatctga	Protospacer
*  ****** * ************** 

2. spacer 2.1|1808667|37|NZ_CP007705|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

gtcgatccgaccgctgttccggccaatggcagtcttg	CRISPR spacer
atcgatccgaccgctgttcctgccgatggcgaacccg	Protospacer
.******************* ***.*****.. *..*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 888225 : 900153 13 uncultured_Mediterranean_phage(90.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage