Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007588 Weissella ceti strain WS08 chromosome, complete genome 3 crisprs cas3,DEDDh,DinG,csa3 0 1 2 0

Results visualization

1. NZ_CP007588
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007588_1 20104-20209 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007588_2 84100-84191 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007588_3 1313645-1313822 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007588_2 2.1|84132|28|NZ_CP007588|CRISPRCasFinder 84132-84159 28 KY499642 Vibrio phage pVa-21, complete genome 167841-167868 6 0.786

1. spacer 2.1|84132|28|NZ_CP007588|CRISPRCasFinder matches to KY499642 (Vibrio phage pVa-21, complete genome) position: , mismatch: 6, identity: 0.786

tggcggaaaccgtaatggtggacgcggt	CRISPR spacer
atgcggaaaccgcaatggtggaagccat	Protospacer
  **********.********* ** .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 562687 : 570034 6 Caulobacter_phage(16.67%) NA NA
DBSCAN-SWA_2 759433 : 768053 9 Prochlorococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage