Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP036553 Bacteroides fragilis strain DCMOUH0067B chromosome, complete genome 2 crisprs PrimPol,PD-DExK,RT,csa3,DEDDh,WYL 0 2 0 5
NZ_CP036554 Bacteroides fragilis strain DCMOUH0067B plasmid pBFO67_1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP036553
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP036553_1 3135989-3136309 Orphan NA
4 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP036553_2 5128363-5128449 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP036553_1 1.3|3136166|35|NZ_CP036553|CRT 3136166-3136200 35 AY133112 Vibrio harveyi bacteriophage VHML, complete genome 22186-22220 9 0.743
NZ_CP036553_1 1.3|3136166|35|NZ_CP036553|CRT 3136166-3136200 35 NC_004456 Vibrio phage VHML, complete genome 22186-22220 9 0.743
NZ_CP036553_1 1.3|3136166|35|NZ_CP036553|CRT 3136166-3136200 35 NC_019722 Vibrio phage vB_VpaM_MAR, complete genome 6668-6702 9 0.743
NZ_CP036553_1 1.7|3136168|35|NZ_CP036553|PILER-CR 3136168-3136202 35 AY133112 Vibrio harveyi bacteriophage VHML, complete genome 22186-22220 9 0.743
NZ_CP036553_1 1.7|3136168|35|NZ_CP036553|PILER-CR 3136168-3136202 35 NC_004456 Vibrio phage VHML, complete genome 22186-22220 9 0.743
NZ_CP036553_1 1.7|3136168|35|NZ_CP036553|PILER-CR 3136168-3136202 35 NC_019722 Vibrio phage vB_VpaM_MAR, complete genome 6668-6702 9 0.743

1. spacer 1.3|3136166|35|NZ_CP036553|CRT matches to AY133112 (Vibrio harveyi bacteriophage VHML, complete genome) position: , mismatch: 9, identity: 0.743

gtgttatcggcaaagaaggtgtcggtggtgccagc	CRISPR spacer
gccaaggcggtaaagaaggtgttggtggtgccagt	Protospacer
*.   . ***.***********.***********.

2. spacer 1.3|3136166|35|NZ_CP036553|CRT matches to NC_004456 (Vibrio phage VHML, complete genome) position: , mismatch: 9, identity: 0.743

gtgttatcggcaaagaaggtgtcggtggtgccagc	CRISPR spacer
gccaaggcggtaaagaaggtgttggtggtgccagt	Protospacer
*.   . ***.***********.***********.

3. spacer 1.3|3136166|35|NZ_CP036553|CRT matches to NC_019722 (Vibrio phage vB_VpaM_MAR, complete genome) position: , mismatch: 9, identity: 0.743

gtgttatcggcaaagaaggtgtcggtggtgccagc	CRISPR spacer
gccaaggcggtaaagaaggtgttggtggtgccagt	Protospacer
*.   . ***.***********.***********.

4. spacer 1.7|3136168|35|NZ_CP036553|PILER-CR matches to AY133112 (Vibrio harveyi bacteriophage VHML, complete genome) position: , mismatch: 9, identity: 0.743

gtgttatcggcaaagaaggtgtcggtggtgccagc	CRISPR spacer
gccaaggcggtaaagaaggtgttggtggtgccagt	Protospacer
*.   . ***.***********.***********.

5. spacer 1.7|3136168|35|NZ_CP036553|PILER-CR matches to NC_004456 (Vibrio phage VHML, complete genome) position: , mismatch: 9, identity: 0.743

gtgttatcggcaaagaaggtgtcggtggtgccagc	CRISPR spacer
gccaaggcggtaaagaaggtgttggtggtgccagt	Protospacer
*.   . ***.***********.***********.

6. spacer 1.7|3136168|35|NZ_CP036553|PILER-CR matches to NC_019722 (Vibrio phage vB_VpaM_MAR, complete genome) position: , mismatch: 9, identity: 0.743

gtgttatcggcaaagaaggtgtcggtggtgccagc	CRISPR spacer
gccaaggcggtaaagaaggtgttggtggtgccagt	Protospacer
*.   . ***.***********.***********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP036553.1|WP_004310304.1|2283677_2284097_+|hypothetical-protein 2283677_2284097_+ 139 aa aa 40 NA NA No NA
NZ_CP036553.1|WP_032530416.1|2933399_2933816_-|PcfK-like-protein 2933399_2933816_- 138 aa aa 40 NA NA No NA
NZ_CP036553.1|WP_004289410.1|3063393_3063819_+|hypothetical-protein 3063393_3063819_+ 141 aa aa 40 NA NA No NA
NZ_CP036553.1|WP_004310304.1|4534706_4535126_+|hypothetical-protein 4534706_4535126_+ 139 aa aa 40 NA NA No NA
NZ_CP036553.1|WP_004310304.1|5454951_5455371_-|hypothetical-protein 5454951_5455371_- 139 aa aa 40 NA NA No NA