Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP008823 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2, complete genome 4 crisprs csa3,cas3,DEDDh,WYL,DinG 0 3 10 0
NZ_CP008826 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-f91, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP008825 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence 1 crisprs csa3 1 1 3 2
NZ_CP008824 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKEC-39c, complete sequence 0 crisprs csa3,RT,DEDDh 0 0 4 0

Results visualization

1. NZ_CP008823
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008823_1 1535864-1536140 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008823_2 1716803-1716891 Orphan I-F
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008823_3 2297099-2297260 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008823_4 2987533-2987615 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP008823_4 4.1|2987561|27|NZ_CP008823|CRISPRCasFinder 2987561-2987587 27 NZ_LR134256 Klebsiella aerogenes strain NCTC9644 plasmid 3, complete sequence 1565-1591 4 0.852
NZ_CP008823_2 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder 1716832-1716862 31 JF974302 Vibrio phage VBpm10, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces 21037-21067 6 0.806
NZ_CP008823_2 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder 1716832-1716862 31 MG592513 Vibrio phage 1.142.O._10N.261.49.E11, partial genome 26631-26661 7 0.774
NZ_CP008823_2 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder 1716832-1716862 31 MG592412 Vibrio phage 1.028.O._10N.286.45.B6, partial genome 26631-26661 7 0.774
NZ_CP008823_2 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder 1716832-1716862 31 MG592527 Vibrio phage 1.159.O._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP008823_2 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder 1716832-1716862 31 MG592588 Vibrio phage 1.217.O._10N.261.45.A1, partial genome 26631-26661 7 0.774
NZ_CP008823_2 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder 1716832-1716862 31 MG592589 Vibrio phage 1.219.O._10N.261.45.E2, partial genome 26631-26661 7 0.774
NZ_CP008823_2 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder 1716832-1716862 31 MG592524 Vibrio phage 1.156.O._10N.261.45.A6, partial genome 26631-26661 7 0.774
NZ_CP008823_2 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder 1716832-1716862 31 MG592669 Vibrio phage 2.159.A._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP008823_2 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder 1716832-1716862 31 MG592670 Vibrio phage 2.159.B._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP008823_2 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder 1716832-1716862 31 MG592507 Vibrio phage 1.136.O._10N.261.45.E11, partial genome 26631-26661 7 0.774
NZ_CP008823_2 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder 1716832-1716862 31 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1534665-1534695 7 0.774
NZ_CP008823_2 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder 1716832-1716862 31 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 62534-62564 8 0.742
NZ_CP008823_2 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder 1716832-1716862 31 NZ_CP035511 Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence 283146-283176 8 0.742
NZ_CP008823_2 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder 1716832-1716862 31 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 22328-22358 9 0.71
NZ_CP008823_2 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder 1716832-1716862 31 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 475099-475129 9 0.71
NZ_CP008823_2 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder 1716832-1716862 31 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 714186-714216 10 0.677
NZ_CP008823_3 3.1|2297151|58|NZ_CP008823|CRISPRCasFinder 2297151-2297208 58 NZ_LN868946 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence 15954-16011 12 0.793

1. spacer 4.1|2987561|27|NZ_CP008823|CRISPRCasFinder matches to NZ_LR134256 (Klebsiella aerogenes strain NCTC9644 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.852

ctccacctccacaggcattgatataac	CRISPR spacer
ctccacctccgcaggcattggtactac	Protospacer
**********.*********.**. **

2. spacer 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder matches to JF974302 (Vibrio phage VBpm10, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces) position: , mismatch: 6, identity: 0.806

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcattgt	Protospacer
**********.** ********* *..** *

3. spacer 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder matches to MG592513 (Vibrio phage 1.142.O._10N.261.49.E11, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

4. spacer 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder matches to MG592412 (Vibrio phage 1.028.O._10N.286.45.B6, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

5. spacer 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder matches to MG592527 (Vibrio phage 1.159.O._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

6. spacer 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder matches to MG592588 (Vibrio phage 1.217.O._10N.261.45.A1, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

7. spacer 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder matches to MG592589 (Vibrio phage 1.219.O._10N.261.45.E2, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

8. spacer 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder matches to MG592524 (Vibrio phage 1.156.O._10N.261.45.A6, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

9. spacer 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder matches to MG592669 (Vibrio phage 2.159.A._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

10. spacer 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder matches to MG592670 (Vibrio phage 2.159.B._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

11. spacer 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder matches to MG592507 (Vibrio phage 1.136.O._10N.261.45.E11, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

12. spacer 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccag----cgtgtttt	CRISPR spacer
acggcgagaccgtcacgcgccaggtgccggg----	Protospacer
******* **** **********    ** *    

13. spacer 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 8, identity: 0.742

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
gcggcgacaccgacactcgcccgcgatctca	Protospacer
.*************** **** ***  .*. 

14. spacer 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 8, identity: 0.742

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
tcggcgatgccgacacgcgccagcagttcta	Protospacer
 ******..***************.  *.* 

15. spacer 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.71

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
ccggcgacatcgacacgcggcagcccaggat	Protospacer
 ********.********* **** ..   *

16. spacer 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 9, identity: 0.71

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
ccggcgacaccgacacccggcagcccaggat	Protospacer
 *************** ** **** ..   *

17. spacer 2.1|1716832|31|NZ_CP008823|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.677

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
ggggcgactccgacccgcgccagcgccgcag	Protospacer
. ****** ***** **********.  .  

18. spacer 3.1|2297151|58|NZ_CP008823|CRISPRCasFinder matches to NZ_LN868946 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence) position: , mismatch: 12, identity: 0.793

atatgtagaacatgtaggccgggtaaggcgtagccgccacccggctttttatcgtttc	CRISPR spacer
tcaagcagacgatgtaggccgggtaaggcgtagccgccacccggctttttatttgcga	Protospacer
 .* *.***  *****************************************.  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 451251 : 495265 53 Enterobacteria_phage(29.55%) terminase,integrase,protease,tRNA,portal,tail attL 442838:442853|attR 500708:500723
DBSCAN-SWA_2 729403 : 736908 11 Enterobacteria_phage(85.71%) integrase attL 725550:725562|attR 731554:731566
DBSCAN-SWA_3 2391601 : 2417287 22 Bacillus_phage(25.0%) protease,transposase NA
DBSCAN-SWA_4 2840818 : 2935775 102 Salmonella_phage(12.77%) terminase,tRNA,protease,integrase,portal,holin,plate,coat,tail attL 2892154:2892169|attR 2936992:2937007
DBSCAN-SWA_5 2952524 : 3003383 76 Cronobacter_phage(28.81%) terminase,integrase,holin,head,transposase,tail attL 2981768:2981782|attR 3006579:3006593
DBSCAN-SWA_6 3086820 : 3097633 9 Bodo_saltans_virus(12.5%) NA NA
DBSCAN-SWA_7 3561380 : 3585870 30 Salmonella_phage(35.0%) integrase,transposase attL 3578930:3578943|attR 3586979:3586992
DBSCAN-SWA_8 3621801 : 3664465 41 Escherichia_phage(28.57%) tRNA,integrase,transposase,protease attL 3627147:3627166|attR 3667400:3667419
DBSCAN-SWA_9 4042914 : 4079422 26 Stx2-converting_phage(20.0%) integrase,transposase attL 4055915:4055929|attR 4083349:4083363
DBSCAN-SWA_10 4137360 : 4179752 50 Erwinia_phage(37.21%) terminase,tRNA,integrase,portal,lysis,holin,plate,head,tail,capsid attL 4130324:4130343|attR 4185209:4185228
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP008825
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008825_1 241765-241906 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008823.1 2404909-2404950 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008823.1 2409618-2409659 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008823.1 2412967-2413008 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008823.1 2417676-2417717 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008823.1 3664451-3664492 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008823.1 4048954-4048995 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008824.1 169931-169972 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825.1 25620-25661 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825.1 46141-46182 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825.1 51255-51296 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825.1 146620-146661 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825.1 168494-168535 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825.1 173906-173947 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825.1 273553-273594 0 1.0

1. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to position: 2404909-2404950, mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

2. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to position: 2409618-2409659, mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

3. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to position: 2412967-2413008, mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

4. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to position: 2417676-2417717, mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

5. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to position: 3664451-3664492, mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

6. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to position: 4048954-4048995, mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

7. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to position: 169931-169972, mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

8. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to position: 25620-25661, mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

9. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to position: 46141-46182, mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

10. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to position: 51255-51296, mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

11. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to position: 146620-146661, mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

12. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to position: 168494-168535, mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

13. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to position: 173906-173947, mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

14. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to position: 273553-273594, mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026282 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence 6222-6263 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018350 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-67, complete sequence 22426-22467 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018350 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-67, complete sequence 63902-63943 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 45035-45076 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 90425-90466 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 162404-162445 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 251273-251314 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 258720-258761 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 232312-232353 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 235403-235444 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 2746-2787 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 6866-6907 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 32672-32713 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 66889-66930 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 120386-120427 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 28621-28662 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 28786-28827 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 33679-33720 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 61705-61746 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 63264-63305 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 100805-100846 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KX710093 Leclercia adecarboxylata strain pP10164 plasmid pP10164-2, complete sequence 22187-22228 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KX710093 Leclercia adecarboxylata strain pP10164 plasmid pP10164-2, complete sequence 295908-295949 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KX710093 Leclercia adecarboxylata strain pP10164 plasmid pP10164-2, complete sequence 184545-184586 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KY296104 Enterobacter cloacae strain 13E169 plasmid pHN84KPC, complete sequence 16552-16593 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KY270852 Enterobacter cloacae strain T5282 plasmid pT5282-mphA, complete sequence 21945-21986 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KY270852 Enterobacter cloacae strain T5282 plasmid pT5282-mphA, complete sequence 119943-119984 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KY751925 Klebsiella pneumoniae strain M16-13 plasmid pM16-13, complete sequence 62378-62419 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LC511995 Enterobacter hormaechei subsp. xiangfangensis strain MY146 plasmid pMY146-rmtE, complete sequence 2266-2307 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LC511995 Enterobacter hormaechei subsp. xiangfangensis strain MY146 plasmid pMY146-rmtE, complete sequence 27713-27754 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014073 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence 59444-59485 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014073 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence 144327-144368 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014073 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence 75482-75523 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032198 Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence 16156-16197 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 314185-314226 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 335504-335545 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034757 Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p3, complete sequence 18408-18449 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 19-60 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 61589-61630 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 175608-175649 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 221212-221253 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 11390-11431 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 17534-17575 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 24112-24153 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 134426-134467 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050847 Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence 4775-4816 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050847 Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence 19763-19804 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050847 Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence 68578-68619 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050847 Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence 7338-7379 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050847 Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence 81212-81253 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP016764 Citrobacter freundii strain B38 plasmid pOZ181, complete sequence 59670-59711 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP016764 Citrobacter freundii strain B38 plasmid pOZ181, complete sequence 261220-261261 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KU665641 Klebsiella pneumoniae strain AO-15200 plasmid pG06-VIM-1, complete sequence 23460-23501 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KU665641 Klebsiella pneumoniae strain AO-15200 plasmid pG06-VIM-1, complete sequence 33364-33405 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KX839208 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence 127018-127059 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KX960110 Escherichia coli strain CREC-TJ2 plasmid pCREC-TJ2-NDM, complete sequence 46154-46195 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KX960110 Escherichia coli strain CREC-TJ2 plasmid pCREC-TJ2-NDM, complete sequence 36124-36165 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KX810825 Salmonella enterica subsp. enterica serovar Typhimurium strain MU1 plasmid pIMP4-SEM1, complete sequence 22569-22610 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KX810825 Salmonella enterica subsp. enterica serovar Typhimurium strain MU1 plasmid pIMP4-SEM1, complete sequence 145976-146017 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KX810825 Salmonella enterica subsp. enterica serovar Typhimurium strain MU1 plasmid pIMP4-SEM1, complete sequence 167837-167878 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KX810825 Salmonella enterica subsp. enterica serovar Typhimurium strain MU1 plasmid pIMP4-SEM1, complete sequence 303040-303081 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LN830952 Enterobacter sp. 247 strain 247 BMC plasmid pEB247, complete sequence 22449-22490 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 64384-64425 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 65403-65444 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 66674-66715 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 110332-110373 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 111351-111392 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 115274-115315 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 146592-146633 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 2421-2462 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 12258-12299 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 121794-121835 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 168554-168595 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KJ958927 Klebsiella pneumoniae strain Kpn-3002cz plasmid pS-3002cz, complete sequence 21370-21411 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KP975077 Enterobacter cloacae strain MRSN17626 plasmid pMRVIM0813, complete sequence 31775-31816 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KP975077 Enterobacter cloacae strain MRSN17626 plasmid pMRVIM0813, complete sequence 186072-186113 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KP975077 Enterobacter cloacae strain MRSN17626 plasmid pMRVIM0813, complete sequence 245589-245630 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_014368 Klebsiella pneumoniae plasmid pNL194, complete sequence 33409-33450 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028197 Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence 100904-100945 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028197 Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence 160419-160460 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028197 Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence 249077-249118 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP010131 Escherichia coli strain C9 plasmid B, complete genome 35152-35193 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021755 Klebsiella pneumoniae strain AR_0113 plasmid unitig_4, complete sequence 23202-23243 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP025081 Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence 214049-214090 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011839 Klebsiella pneumoniae strain KP5 plasmid pSg1-NDM, complete sequence 37980-38021 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP048368 Escherichia coli strain 163 plasmid pC-F-164_A-OXA140, complete sequence 130413-130454 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044528 Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence 111890-111931 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044528 Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence 67753-67794 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 19666-19707 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 38297-38338 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 93335-93376 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 124947-124988 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 135634-135675 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 171078-171119 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 189833-189874 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 24549-24590 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 53763-53804 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 89721-89762 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 122833-122874 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 138947-138988 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011601 Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence 99973-100014 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011601 Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence 159488-159529 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011601 Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence 247935-247976 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011601 Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence 269809-269850 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011601 Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence 275221-275262 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052163 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence 216635-216676 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 80409-80450 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 82878-82919 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 199782-199823 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 77969-78010 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP023191 Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence 261023-261064 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP019195 Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence 11082-11123 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP019195 Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence 50073-50114 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP019195 Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence 149014-149055 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 KY486279 Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence 2688-2729 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 KY000035 Agrobacterium sp. strain EHA101 plasmid pTi_EHA101, complete sequence 1883-1924 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 KY000035 Agrobacterium sp. strain EHA101 plasmid pTi_EHA101, complete sequence 761-802 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028975 Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence 325518-325559 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028975 Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence 81295-81336 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028975 Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence 103169-103210 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028975 Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence 108581-108622 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028975 Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence 272653-272694 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028975 Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence 317779-317820 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 224894-224935 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 242085-242126 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 13795-13836 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029588 Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence 193133-193174 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP048350 Raoultella ornithinolytica strain 23 plasmid p23_A-OXA140, complete sequence 22436-22477 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP048350 Raoultella ornithinolytica strain 23 plasmid p23_A-OXA140, complete sequence 45685-45726 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP048352 Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence 62926-62967 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014011 Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence 111111-111152 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP037442 Klebsiella sp. PO552 plasmid p1, complete sequence 38496-38537 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP037442 Klebsiella sp. PO552 plasmid p1, complete sequence 101774-101815 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP037442 Klebsiella sp. PO552 plasmid p1, complete sequence 144008-144049 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP019900 Raoultella planticola strain GODA plasmid unnamed1, complete sequence 44864-44905 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP019900 Raoultella planticola strain GODA plasmid unnamed1, complete sequence 72163-72204 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 22875-22916 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 88767-88808 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 196432-196473 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 212546-212587 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 19261-19302 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 92549-92590 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 145404-145445 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 164301-164342 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 199745-199786 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 210432-210473 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP037743 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence 211678-211719 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KX646543 Shigella boydii strain 2246 plasmid p2246-CTXM, complete sequence 79149-79190 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028588 Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence 18960-19001 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 94667-94708 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 121983-122024 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 181939-181980 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 203531-203572 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 14483-14524 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 29548-29589 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP035215 Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence 69887-69928 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052159 Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence 213463-213504 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MT035874 Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence 212592-212633 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 128114-128155 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 220876-220917 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 150875-150916 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 68662-68703 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 100276-100317 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 211723-211764 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 143655-143696 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543579 Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence 63498-63539 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543579 Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence 69637-69678 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543579 Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence 77436-77477 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543579 Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence 81677-81718 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543579 Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence 7233-7274 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543579 Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence 57499-57540 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543579 Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence 65748-65789 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543581 Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence 63499-63540 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543581 Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence 69638-69679 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543581 Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence 77437-77478 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543581 Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence 81679-81720 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543581 Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence 7233-7274 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543581 Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence 57500-57541 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543581 Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence 65749-65790 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 21728-21769 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 7231-7272 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 17330-17371 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 18114-18155 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 27120-27161 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 57935-57976 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP027678 Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-1, complete sequence 65348-65389 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP027678 Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-1, complete sequence 133785-133826 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP027678 Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-1, complete sequence 268061-268102 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP033961 Klebsiella pneumoniae strain L482 plasmid p2_L382, complete sequence 128207-128248 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029447 Serratia marcescens strain CAV1761 plasmid pCAV1761-73, complete sequence 38152-38193 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029448 Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence 75984-76025 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029448 Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence 95493-95534 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 266374-266415 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 269068-269109 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 348465-348506 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 221272-221313 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 98833-98874 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029729 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence 249663-249704 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP035634 Enterobacter cloacae strain EN3600 plasmid unnamed2, complete sequence 24880-24921 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP035634 Enterobacter cloacae strain EN3600 plasmid unnamed2, complete sequence 245223-245264 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN539017 Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence 14742-14783 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KJ958926 Klebsiella pneumoniae strain Kpn-3002cz plasmid pB-3002cz, complete sequence 16282-16323 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042506 Leclercia adecarboxylata strain E1 plasmid pE1_001, complete sequence 298892-298933 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042506 Leclercia adecarboxylata strain E1 plasmid pE1_001, complete sequence 23488-23529 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042506 Leclercia adecarboxylata strain E1 plasmid pE1_001, complete sequence 151340-151381 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042506 Leclercia adecarboxylata strain E1 plasmid pE1_001, complete sequence 284422-284463 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 58945-58986 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 186329-186370 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 188798-188839 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 183889-183930 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 96133-96174 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 91224-91265 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 93693-93734 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 221077-221118 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018724 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-4, complete sequence 6402-6443 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018724 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-4, complete sequence 16307-16348 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 76576-76617 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 71667-71708 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 74136-74177 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 201520-201561 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 21727-21768 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 7230-7271 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 17329-17370 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 18113-18154 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 27119-27160 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 57934-57975 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 92335-92376 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 102288-102329 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 4049-4090 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 18958-18999 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 51796-51837 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 30030-30071 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 238930-238971 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LN824135 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671 60710-60751 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP033955 Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence 182521-182562 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026237 Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence 137094-137135 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026237 Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence 177842-177883 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP039717 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence 227907-227948 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP039717 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence 40157-40198 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MT077884 Escherichia coli plasmid p33, complete sequence 223017-223058 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MT077884 Escherichia coli plasmid p33, complete sequence 24265-24306 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MT077884 Escherichia coli plasmid p33, complete sequence 264826-264867 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MT077888 Escherichia coli plasmid p65, complete sequence 97155-97196 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP051432 Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence 20585-20626 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052432 Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence 163863-163904 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052144 Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence 213963-214004 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052363 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence 202963-203004 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_009838 Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence 229567-229608 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_009838 Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence 116787-116828 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_009838 Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence 205031-205072 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP048293 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence 36110-36151 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP048293 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence 146859-146900 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP048293 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence 243941-243982 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_021576 Klebsiella pneumoniae plasmid pKP1780, complete sequence 12274-12315 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_021576 Klebsiella pneumoniae plasmid pKP1780, complete sequence 22177-22218 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_023314 Klebsiella pneumoniae plasmid pKPS30, complete sequence 11655-11696 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP046002 Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence 32197-32238 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP037875 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence 19992-20033 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP037875 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence 80721-80762 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008789 Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence 87015-87056 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP036302 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence 183867-183908 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN423361 Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence 137186-137227 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN423361 Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence 187911-187952 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN423361 Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence 210694-210735 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN423361 Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence 258902-258943 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN423361 Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence 23488-23529 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN423361 Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence 243493-243534 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN915010 Escherichia coli strain TJ-33 plasmid pNDM-TJ33, complete sequence 92810-92851 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN915011 Escherichia coli strain GD-33 plasmid pNDM33-1, complete sequence 92814-92855 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN915013 Escherichia coli strain TD-33 plasmid pNDM-TD33, complete sequence 20260-20301 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044204 Salmonella enterica subsp. enterica serovar Senftenberg strain AR-0405 plasmid pAR-0405, complete sequence 51432-51473 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020529 Enterobacter cloacae strain 174 plasmid unnamed1, complete sequence 255366-255407 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020529 Enterobacter cloacae strain 174 plasmid unnamed1, complete sequence 393092-393133 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020529 Enterobacter cloacae strain 174 plasmid unnamed1, complete sequence 140191-140232 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020529 Enterobacter cloacae strain 174 plasmid unnamed1, complete sequence 240896-240937 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 90348-90389 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 189833-189874 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 192341-192382 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347226 Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence 160761-160802 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347227 Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence 161032-161073 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347228 Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence 161508-161549 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347228 Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence 162517-162558 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347229 Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence 160308-160349 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347229 Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence 24127-24168 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347229 Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence 61993-62034 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347230 Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence 26941-26982 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347230 Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence 58941-58982 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347230 Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence 159893-159934 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347230 Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence 24124-24165 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347230 Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence 61991-62032 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347231 Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence 58940-58981 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347231 Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence 159398-159439 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347232 Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence 161006-161047 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347233 Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence 58938-58979 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347233 Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence 160000-160041 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347233 Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence 24122-24163 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347233 Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence 62191-62232 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347235 Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence 58953-58994 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347235 Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence 160224-160265 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347235 Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence 24137-24178 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347235 Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence 62007-62048 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347236 Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence 58935-58976 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347236 Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence 160940-160981 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347237 Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence 26941-26982 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347237 Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence 58941-58982 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347237 Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence 160142-160183 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347237 Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence 24124-24165 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347237 Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence 61991-62032 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347238 Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence 160674-160715 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 213801-213842 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034776 Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence 2905-2946 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_021238 Klebsiella pneumoniae strain Kpn-1433 plasmid pKP1433, complete sequence 667-708 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_021238 Klebsiella pneumoniae strain Kpn-1433 plasmid pKP1433, complete sequence 50392-50433 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 76114-76155 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020843 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence 47598-47639 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044302 Escherichia coli strain P59A plasmid pP59A-4, complete sequence 12011-12052 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032832 Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence 15105-15146 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032832 Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence 11670-11711 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032832 Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence 16165-16206 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 67070-67111 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 70161-70202 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 71374-71415 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK312248 Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence 6701-6742 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052357 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence 215587-215628 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 22644-22685 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 36104-36145 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 36758-36799 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 65039-65080 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 69954-69995 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 100754-100795 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 136532-136573 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 174394-174435 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 232275-232316 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 19286-19327 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 32965-33006 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 51480-51521 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 102674-102715 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 142806-142847 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 155009-155050 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 235160-235201 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041949 Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence 154848-154889 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031566 Enterobacter hormaechei strain 2013_1a plasmid pIncLM-1301491, complete sequence 42579-42620 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031567 Enterobacter hormaechei strain 2013_1a plasmid pIncHI2-1301491, complete sequence 96320-96361 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031567 Enterobacter hormaechei strain 2013_1a plasmid pIncHI2-1301491, complete sequence 155833-155874 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031568 Enterobacter hormaechei strain 2013_1a plasmid pSHV12-1301491, complete sequence 91527-91568 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031568 Enterobacter hormaechei strain 2013_1a plasmid pSHV12-1301491, complete sequence 103601-103642 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 74626-74667 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 81204-81245 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 125859-125900 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 37149-37190 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 91292-91333 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 108041-108082 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 151925-151966 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 161878-161919 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP035776 Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence 114492-114533 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 183345-183386 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040888 Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_1, complete sequence 134658-134699 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040888 Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_1, complete sequence 54875-54916 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040888 Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_1, complete sequence 157173-157214 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014009 Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence 45661-45702 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023479 Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence 4538-4579 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023479 Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence 25744-25785 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023479 Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence 31425-31466 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 60168-60209 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 13220-13261 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032878 Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence 18441-18482 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN158991 Escherichia coli strain TREC8 plasmid pTREC8, complete sequence 22478-22519 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049605 Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence 110820-110861 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049605 Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence 123790-123831 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MH909331 Leclercia adecarboxylata plasmid p707804-NDM, complete sequence 23254-23295 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MH909331 Leclercia adecarboxylata plasmid p707804-NDM, complete sequence 205653-205694 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 67593-67634 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 276488-276529 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 6369-6410 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 254722-254763 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP039559 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence 226059-226100 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP039559 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence 39881-39922 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP012989 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence 66485-66526 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP012989 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence 81321-81362 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 267846-267887 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 305967-306008 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 246168-246209 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 304811-304852 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 308348-308389 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 336377-336418 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023841 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.2, complete sequence 23800-23841 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038139 Escherichia coli strain G3X16-2 plasmid pG3X16-2-2, complete sequence 188342-188383 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 99429-99470 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030080 Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence 264232-264273 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030080 Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence 174923-174964 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030080 Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence 185908-185949 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041084 Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence 132020-132061 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042616 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-1, complete sequence 133115-133156 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042616 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-1, complete sequence 48150-48191 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026272 Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence 77991-78032 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026272 Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence 90245-90286 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026272 Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence 99150-99191 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 182729-182770 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 6031-6072 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 8533-8574 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 57657-57698 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 95313-95354 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 106304-106345 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 197328-197369 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 45222-45263 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP036337 Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence 99145-99186 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 61643-61684 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 91427-91468 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 202874-202915 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 134806-134847 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 15030-15071 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 208048-208089 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 123288-123329 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 155280-155321 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008824 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKEC-39c, complete sequence 169931-169972 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence 273553-273594 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence 25620-25661 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence 46141-46182 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence 51255-51296 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence 146620-146661 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence 168494-168535 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence 173906-173947 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence 241815-241856 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 24489-24530 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 44826-44867 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 41468-41509 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 50266-50307 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041374 Klebsiella pneumoniae strain KP58 plasmid pKP58-1, complete sequence 181849-181890 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 9887-9928 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 11158-11199 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 49446-49487 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 58594-58635 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 15011-15052 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 91031-91072 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 7044-7085 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 8076-8117 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 14654-14695 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 114775-114816 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 31102-31143 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 47851-47892 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 94209-94250 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 196230-196271 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 219389-219430 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 35390-35431 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 101919-101960 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 11644-11685 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 22945-22986 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 105367-105408 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 142925-142966 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP025213 Klebsiella pneumoniae strain HZW25 plasmid unnamed2, complete sequence 1404-1445 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP025213 Klebsiella pneumoniae strain HZW25 plasmid unnamed2, complete sequence 84688-84729 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP025213 Klebsiella pneumoniae strain HZW25 plasmid unnamed2, complete sequence 88137-88178 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP025213 Klebsiella pneumoniae strain HZW25 plasmid unnamed2, complete sequence 26935-26976 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP022696 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-1, complete sequence 159679-159720 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP022696 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-1, complete sequence 181553-181594 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP022696 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-1, complete sequence 23538-23579 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP022696 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-1, complete sequence 292968-293009 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052232 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence 203248-203289 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052232 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence 187255-187296 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 66550-66591 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 97387-97428 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 156874-156915 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 170024-170065 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044153 Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence 22612-22653 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044153 Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence 8127-8168 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 25238-25279 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 64769-64810 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 102780-102821 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 4888-4929 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 33939-33980 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 1977-2018 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 94958-94999 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021962 Klebsiella pneumoniae strain AR_0139 plasmid tig00000008, complete sequence 98561-98602 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040546 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence 1538-1579 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040929 Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence 56151-56192 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032241 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence 293-334 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029586 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-96, complete sequence 9437-9478 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP049311 Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N53023 plasmid pN53023, complete sequence 238542-238583 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP049311 Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N53023 plasmid pN53023, complete sequence 37665-37706 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LR134207 Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2 24794-24835 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LR134207 Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2 173633-173674 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LR134207 Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2 179770-179811 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LR134207 Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2 187568-187609 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LR134207 Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2 191807-191848 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LR134207 Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2 18408-18449 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LR134207 Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2 117423-117464 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LR134207 Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2 167644-167685 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LR134207 Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2 175884-175925 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029037 Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 plasmid unnamed, complete sequence 54382-54423 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029037 Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 plasmid unnamed, complete sequence 228613-228654 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043855 Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid unnamed2, complete sequence 147599-147640 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044215 Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence 279506-279547 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044215 Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence 55012-55053 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044215 Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence 329398-329439 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045217 Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence 19995-20036 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026203 Escherichia coli strain ECONIH5 plasmid pECO-a7e8, complete sequence 33654-33695 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018887 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence 79922-79963 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP039809 Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence 183867-183908 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 32998-33039 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 107670-107711 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 178202-178243 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 31044-31085 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 85944-85985 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052376 Klebsiella pneumoniae strain D16KP0025 plasmid pD16KP0025-1, complete sequence 54231-54272 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 187691-187732 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 122223-122264 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 153078-153119 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_024960 Escherichia coli plasmid pIS04_68, strain ISO4, complete sequence 12870-12911 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_024960 Escherichia coli plasmid pIS04_68, strain ISO4, complete sequence 29771-29812 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP007735 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence 25424-25465 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP007735 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence 27510-27551 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP007735 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence 83546-83587 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP007735 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence 65452-65493 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP007735 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence 68707-68748 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP007735 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence 84671-84712 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026174 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence 17733-17774 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026180 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence 50857-50898 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026180 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence 66462-66503 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026180 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence 47537-47578 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026182 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence 17986-18027 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026182 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence 20061-20102 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026182 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence 51288-51329 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026184 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence 21406-21447 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 161023-161064 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031815 Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence 22644-22685 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031815 Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence 19286-19327 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031815 Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence 32965-33006 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP033402 Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence 186503-186544 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP049309 Salmonella enterica subsp. enterica serovar Johannesburg strain CVM N58011 plasmid p58011, complete sequence 131559-131600 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP049309 Salmonella enterica subsp. enterica serovar Johannesburg strain CVM N58011 plasmid p58011, complete sequence 300290-300331 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_010870 Klebsiella pneumoniae plasmid pK29, complete sequence 208686-208727 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_010870 Klebsiella pneumoniae plasmid pK29, complete sequence 118725-118766 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021547 Klebsiella pneumoniae strain AR_0112 plasmid tig00000003, complete sequence 7118-7159 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024813 Enterobacter sp. CRENT-193 plasmid pCRENT-193_1, complete sequence 44030-44071 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP043751 Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence 1635-1676 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029598 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence 21479-21520 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029598 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence 88594-88635 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029598 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence 104632-104673 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 166624-166665 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP047338 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-50kb, complete sequence 47731-47772 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP049307 Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N58631 plasmid p58631, complete sequence 154812-154853 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP049307 Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N58631 plasmid p58631, complete sequence 226695-226736 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 2637-2678 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021687 Klebsiella pneumoniae strain AR_0146 plasmid tig00001186, complete sequence 84768-84809 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021720 Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence 6061-6102 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024857 Escherichia coli strain AR_0011 plasmid tig00001069_pilon, complete sequence 46813-46854 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP043545 Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence 89899-89940 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052563 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence 212580-212621 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 22644-22685 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 36104-36145 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 107120-107161 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 146085-146126 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 19286-19327 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 32965-33006 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 50825-50866 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 113388-113429 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 125591-125632 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026110 Paraburkholderia hospita strain DSM 17164 plasmid pEMT1, complete sequence 28110-28151 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026110 Paraburkholderia hospita strain DSM 17164 plasmid pEMT1, complete sequence 26988-27029 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 JX469827 Uncultured bacterium plasmid pEMT3, complete sequence 10022-10063 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 JX469827 Uncultured bacterium plasmid pEMT3, complete sequence 8900-8941 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030186 Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence 18979-19020 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030186 Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence 77837-77878 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030186 Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence 249658-249699 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030186 Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence 271531-271572 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030186 Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence 274869-274910 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030066 Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence 15555-15596 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 21921-21962 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 18486-18527 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 61794-61835 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028549 Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence 231381-231422 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028549 Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence 237189-237230 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 57015-57056 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 4947-4988 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 84880-84921 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 144034-144075 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 155071-155112 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008798 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPC-484, complete sequence 76567-76608 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 12946-12987 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 15448-15489 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 87787-87828 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 125719-125760 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042494 Leclercia adecarboxylata strain E61 plasmid pE61_001, complete sequence 298892-298933 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042494 Leclercia adecarboxylata strain E61 plasmid pE61_001, complete sequence 23488-23529 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042494 Leclercia adecarboxylata strain E61 plasmid pE61_001, complete sequence 151340-151381 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042494 Leclercia adecarboxylata strain E61 plasmid pE61_001, complete sequence 284422-284463 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP043753 Escherichia coli strain CVM N56639 plasmid pN56639, complete sequence 46162-46203 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030224 Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence 23370-23411 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040730 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed1 20479-20520 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040730 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed1 60176-60217 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040731 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed2 18080-18121 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 7911-7952 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 25490-25531 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 41146-41187 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 7231-7272 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 18396-18437 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 20208-20249 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 21876-21917 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 30882-30923 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 71026-71067 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 105427-105468 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 115380-115421 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011587 Enterobacter asburiae strain CAV1043 plasmid pCAV1043-51, complete sequence 40299-40340 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026404 Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence 33568-33609 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008899 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-8a4, complete sequence 145768-145809 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008899 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-8a4, complete sequence 147502-147543 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008899 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-8a4, complete sequence 169376-169417 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008899 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-8a4, complete sequence 23488-23529 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008899 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-8a4, complete sequence 223972-224013 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008906 Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-08e, complete sequence 145768-145809 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008906 Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-08e, complete sequence 23488-23529 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029140 Klebsiella michiganensis strain AR375 plasmid unnamed1, complete sequence 107182-107223 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029140 Klebsiella michiganensis strain AR375 plasmid unnamed1, complete sequence 67345-67386 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030920 Escherichia coli strain KL53 plasmid pKL53-L, complete sequence 8735-8776 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026397 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence 215723-215764 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026397 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence 191494-191535 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP039328 Citrobacter portucalensis strain Effluent_1 plasmid unnamed1, complete sequence 10511-10552 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP039328 Citrobacter portucalensis strain Effluent_1 plasmid unnamed1, complete sequence 12586-12627 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041248 Raoultella electrica strain DSM 102253 plasmid unnamed1, complete sequence 133757-133798 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041250 Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence 56147-56188 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052547 Klebsiella pneumoniae strain B16KP0089 plasmid pB16KP0089-1, complete sequence 52146-52187 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 167048-167089 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP036447 Klebsiella pneumoniae strain KPNIH45 plasmid unnamed2, complete sequence 75675-75716 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_019122 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH163_120, complete sequence 99152-99193 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_011281 Klebsiella variicola strain 342 plasmid pKP91, complete sequence 14087-14128 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_011282 Klebsiella variicola strain 342 plasmid pKP187, complete sequence 133002-133043 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020062 Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence 129665-129706 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP022155 Escherichia coli strain ABWA45 plasmid pABWA45_1, complete sequence 10607-10648 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP019074 Escherichia coli strain CRE1493 plasmid p1493-3, complete sequence 32403-32444 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP047193 Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence 165735-165776 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015386 Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence 3093-3134 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015386 Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence 33206-33247 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 324682-324723 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 250884-250925 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 273826-273867 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 296777-296818 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 378646-378687 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 404750-404791 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN256759 Escherichia coli strain 4M9F plasmid p4M9F, complete sequence 251844-251885 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN256759 Escherichia coli strain 4M9F plasmid p4M9F, complete sequence 205134-205175 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN256759 Escherichia coli strain 4M9F plasmid p4M9F, complete sequence 228085-228126 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP039271 Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.1, complete sequence 23785-23826 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP039271 Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.1, complete sequence 165751-165792 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 100369-100410 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 103460-103501 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 214161-214202 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 141727-141768 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038275 Raoultella ornithinolytica strain WLK218 plasmid pWLK-101716, complete sequence 11882-11923 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038275 Raoultella ornithinolytica strain WLK218 plasmid pWLK-101716, complete sequence 17888-17929 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038276 Raoultella ornithinolytica strain WLK218 plasmid pWLK-107717, complete sequence 67422-67463 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP016526 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence 128651-128692 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP016526 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence 150525-150566 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP016526 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence 223355-223396 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP016526 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence 59328-59369 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP016526 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence 120068-120109 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP010155 Escherichia coli strain D9 plasmid C, complete genome 11357-11398 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031575 Enterobacter hormaechei strain A1 plasmid pIncHI2-1502264, complete sequence 215-256 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031575 Enterobacter hormaechei strain A1 plasmid pIncHI2-1502264, complete sequence 52451-52492 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031575 Enterobacter hormaechei strain A1 plasmid pIncHI2-1502264, complete sequence 187444-187485 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031575 Enterobacter hormaechei strain A1 plasmid pIncHI2-1502264, complete sequence 200821-200862 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032988 Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence 18893-18934 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 126393-126434 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 151686-151727 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 181298-181339 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP050163 Escherichia coli plasmid Carbapenemase(KPC-2)_IncHI2, complete sequence 173062-173103 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP050163 Escherichia coli plasmid Carbapenemase(KPC-2)_IncHI2, complete sequence 23488-23529 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP050163 Escherichia coli plasmid Carbapenemase(KPC-2)_IncHI2, complete sequence 253240-253281 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP025516 Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence 7784-7825 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 71752-71793 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 77164-77205 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 99038-99079 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 12224-12265 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 65034-65075 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032164 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence 184170-184211 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP039170 Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence 12724-12765 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP043758 Escherichia coli strain CVM N55972 plasmid pN55972-2, complete sequence 20401-20442 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP043758 Escherichia coli strain CVM N55972 plasmid pN55972-2, complete sequence 22465-22506 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP046008 Escherichia coli strain 1919D62 plasmid p1919D62-2, complete sequence 28107-28148 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034416 Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence 200384-200425 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034130 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence 4003-4044 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034130 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence 9684-9725 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034130 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence 16354-16395 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034130 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence 30370-30411 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034130 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence 153736-153777 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034132 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_81.9Kb, complete sequence 30745-30786 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034679 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_83kb, complete sequence 65491-65532 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034679 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_83kb, complete sequence 54804-54845 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034679 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_83kb, complete sequence 62658-62699 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 100738-100779 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 194239-194280 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 198539-198580 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 182077-182118 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 167539-167580 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024430 Klebsiella pneumoniae strain DA48896 plasmid p48896_1, complete sequence 36786-36827 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024431 Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence 58294-58335 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023570 Enterobacter hormaechei strain BW plasmid unnamed2, complete sequence 73874-73915 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023570 Enterobacter hormaechei strain BW plasmid unnamed2, complete sequence 255369-255410 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP022610 Escherichia coli strain ATCC 700415 plasmid unnamed, complete sequence 107440-107481 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041114 Escherichia coli strain ECCTRSRTH03 plasmid unnamed4, complete sequence 43667-43708 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 53381-53422 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 104864-104905 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 19377-19418 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 41251-41292 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 46663-46704 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 96063-96104 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 223215-223256 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK933279 Enterobacter hormaechei strain SCNJ07 plasmid pMCR-SCNJ07, complete sequence 117833-117874 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK933279 Enterobacter hormaechei strain SCNJ07 plasmid pMCR-SCNJ07, complete sequence 212029-212070 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK933279 Enterobacter hormaechei strain SCNJ07 plasmid pMCR-SCNJ07, complete sequence 4511-4552 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC532224 Enterobacter hormaechei subsp. xiangfangensis A2483 plasmid pA2483mcr-9 DNA, complete sequence 22436-22477 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC532224 Enterobacter hormaechei subsp. xiangfangensis A2483 plasmid pA2483mcr-9 DNA, complete sequence 30405-30446 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC532224 Enterobacter hormaechei subsp. xiangfangensis A2483 plasmid pA2483mcr-9 DNA, complete sequence 192177-192218 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC532226 Enterobacter hormaechei subsp. xiangfangensis A2504 plasmid pA2504mcr-9 DNA, complete sequence 22436-22477 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC532226 Enterobacter hormaechei subsp. xiangfangensis A2504 plasmid pA2504mcr-9 DNA, complete sequence 30405-30446 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC532226 Enterobacter hormaechei subsp. xiangfangensis A2504 plasmid pA2504mcr-9 DNA, complete sequence 180408-180449 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP048299 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence 67116-67157 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP048299 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence 137624-137665 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052190 Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence 214006-214047 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052387 Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence 31961-32002 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052387 Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence 52758-52799 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052387 Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence 148051-148092 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052387 Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence 8930-8971 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052387 Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence 165410-165451 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_021198 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence 32670-32711 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026661 Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence 22436-22477 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026661 Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence 155522-155563 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018669 Klebsiella pneumoniae strain CAV1042 plasmid pKPC_CAV1042-89, complete sequence 45915-45956 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045065 Enterobacter roggenkampii strain WCHER090065 plasmid pMCR10_090065, complete sequence 2139-2180 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045065 Enterobacter roggenkampii strain WCHER090065 plasmid pMCR10_090065, complete sequence 31238-31279 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045065 Enterobacter roggenkampii strain WCHER090065 plasmid pMCR10_090065, complete sequence 50626-50667 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 342330-342371 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 22603-22644 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 32556-32597 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 66957-66998 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 99542-99583 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 108548-108589 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 110216-110257 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 112028-112069 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 122126-122167 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 297905-297946 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 104934-104975 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 40988-41029 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 78920-78961 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 117360-117401 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 119862-119903 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040540 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence 160678-160719 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_013507 Escherichia coli ETEC H10407 plasmid pEntH10407, complete sequence 31590-31631 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LN794248 Salmonella enterica subsp. enterica serovar Typhimurium plasmid incHI2, complete sequence 139162-139203 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029387 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence 205325-205366 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029248 Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_D, complete sequence 27741-27782 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029248 Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_D, complete sequence 299381-299422 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029248 Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_D, complete sequence 198585-198626 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP017452 Klebsiella sp. LTGPAF-6F plasmid unnamed2, complete sequence 46255-46296 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043927 Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence 22436-22477 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043927 Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence 306859-306900 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043927 Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence 437364-437405 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043927 Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence 441313-441354 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011641 Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence 19990-20031 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 22388-22429 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 53650-53691 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 74510-74551 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 45126-45167 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 49763-49804 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 58350-58391 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 69463-69504 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 50189-50230 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 56767-56808 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 179620-179661 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 12712-12753 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 73215-73256 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 91338-91379 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 138409-138450 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045678 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence 35221-35262 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MH061383 Pseudomonas aeruginosa plasmid pP6qnrS1, complete sequence 7-48 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031102 Leclercia sp. W17 plasmid pW17-1, complete sequence 109540-109581 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031102 Leclercia sp. W17 plasmid pW17-1, complete sequence 46316-46357 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031102 Leclercia sp. W17 plasmid pW17-1, complete sequence 211723-211764 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP017187 Enterobacter hormaechei subsp. hoffmannii strain DSM 14563 plasmid pDSMZ14563, complete sequence 46049-46090 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP017187 Enterobacter hormaechei subsp. hoffmannii strain DSM 14563 plasmid pDSMZ14563, complete sequence 41438-41479 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LR025093 Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence 83292-83333 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 171013-171054 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 226978-227019 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 330488-330529 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 331507-331548 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 182923-182964 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 189501-189542 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 356578-356619 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 373327-373368 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP022226 Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence 18433-18474 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042589 Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence 33112-33153 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP013340 Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL2, complete sequence 137420-137461 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP046613 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence 26952-26993 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP046613 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence 53828-53869 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP046613 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence 99432-99473 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP046613 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence 116181-116222 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP046613 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence 176685-176726 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP046613 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence 132630-132671 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP046613 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence 139208-139249 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP046614 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence 97631-97672 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP046614 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence 104819-104860 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP012170 Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence 86902-86943 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP012170 Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence 92314-92355 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP012170 Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence 114188-114229 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP012170 Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence 168803-168844 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP012170 Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence 228318-228359 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 81529-81570 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034138 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence 4003-4044 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034138 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence 9682-9723 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034138 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence 16352-16393 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034138 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence 30365-30406 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034140 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_84.1Kb, complete sequence 30741-30782 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC542971 Escherichia coli IOMTU413 plasmid pIOMTU413 DNA, complete sequence 22436-22477 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC542971 Escherichia coli IOMTU413 plasmid pIOMTU413 DNA, complete sequence 202192-202233 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC542971 Escherichia coli IOMTU413 plasmid pIOMTU413 DNA, complete sequence 48671-48712 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC542971 Escherichia coli IOMTU413 plasmid pIOMTU413 DNA, complete sequence 159427-159468 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 22187-22228 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 48420-48461 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 152348-152389 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP048303 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence 205482-205523 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP048303 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence 275990-276031 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052304 Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence 215096-215137 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_024983 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTm-A54650, strain A54560, complete sequence 22436-22477 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026578 Escherichia coli strain WCHEC005237 plasmid pQnrS1_005237, complete sequence 55075-55116 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011635 Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence 115715-115756 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011635 Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence 277556-277597 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011635 Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence 219417-219458 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044968 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence 27429-27470 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044968 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence 88028-88069 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044958 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence 207229-207270 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044958 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence 20256-20297 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 54244-54285 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 193313-193354 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 122842-122883 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 26658-26699 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 29127-29168 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 146031-146072 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 24218-24259 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018316 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-4, complete sequence 28450-28491 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018316 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-4, complete sequence 38355-38396 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015916 Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy4, complete sequence 71573-71614 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015916 Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy4, complete sequence 70224-70265 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 10496-10537 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 23734-23775 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 74848-74889 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 111577-111618 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 129283-129324 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 142320-142361 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 144009-144050 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 150094-150135 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 185732-185773 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 198960-199001 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 201791-201832 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 216108-216149 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 4289-4330 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 8299-8340 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 19024-19065 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 122385-122426 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 209112-209153 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 220846-220887 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 229508-229549 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 201032-201073 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 116908-116949 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 245818-245859 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032189 Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence 19618-19659 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP027150 Klebsiella pneumoniae strain AR_0363 plasmid unnamed3 28865-28906 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP037959 Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence 266555-266596 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014697 Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence 64656-64697 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014697 Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence 131774-131815 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014697 Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence 147812-147853 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN816373 Escherichia coli strain A127 plasmid pA127-X1, complete sequence 33112-33153 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN865122 Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence 34002-34043 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_011743 Escherichia fergusonii ATCC 35469 plasmid pEFER, complete sequence 9638-9679 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP032292 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 plasmid unnamed1, complete sequence 99147-99188 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP032292 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 plasmid unnamed1, complete sequence 101211-101252 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 70425-70466 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 75837-75878 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 97711-97752 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 12224-12265 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 63707-63748 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043767 Enterobacter hormaechei strain EB_P9_L5_03.19 plasmid pIMPIncH12_331kb, complete sequence 295010-295051 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043767 Enterobacter hormaechei strain EB_P9_L5_03.19 plasmid pIMPIncH12_331kb, complete sequence 46677-46718 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 97018-97059 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 100781-100822 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP039861 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence 183571-183612 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP033379 Escherichia coli strain L73 plasmid pL73-2, complete sequence 96657-96698 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP033379 Escherichia coli strain L73 plasmid pL73-2, complete sequence 109279-109320 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP033379 Escherichia coli strain L73 plasmid pL73-2, complete sequence 28591-28632 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP027606 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed2, complete sequence 18861-18902 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034390 Escherichia coli strain RS571 plasmid pRS571-MCR-1.1, complete sequence 95188-95229 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034390 Escherichia coli strain RS571 plasmid pRS571-MCR-1.1, complete sequence 138585-138626 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP013215 Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence 195887-195928 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP013215 Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence 210121-210162 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP013215 Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence 1474-1515 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP013215 Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence 60989-61030 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052204 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence 213997-214038 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052373 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence 6031-6072 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052373 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence 8533-8574 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052373 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence 179429-179470 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052373 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence 184298-184339 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 37262-37303 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP027144 Enterobacter hormaechei subsp. hoffmannii strain AR_0365 plasmid unnamed1, complete sequence 4053-4094 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP027144 Enterobacter hormaechei subsp. hoffmannii strain AR_0365 plasmid unnamed1, complete sequence 273409-273450 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP027144 Enterobacter hormaechei subsp. hoffmannii strain AR_0365 plasmid unnamed1, complete sequence 73570-73611 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP027144 Enterobacter hormaechei subsp. hoffmannii strain AR_0365 plasmid unnamed1, complete sequence 95444-95485 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP027145 Enterobacter hormaechei subsp. hoffmannii strain AR_0365 plasmid unnamed2, complete sequence 59337-59378 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011622 Klebsiella pneumoniae strain CAV1344 plasmid pKPC_CAV1344, complete sequence 131368-131409 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 217346-217387 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 234537-234578 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 13795-13836 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014758 Klebsiella pneumoniae strain AATZP plasmid pKPN-041, complete sequence 23755-23796 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011644 Klebsiella pneumoniae strain CAV1596 plasmid pCAV1596-41, complete sequence 19894-19935 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 80763-80804 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP027162 Klebsiella pneumoniae strain AR_0361 plasmid unnamed3 20197-20238 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034789 Escherichia coli strain ECCNB20-2 plasmid pTB422, complete sequence 40027-40068 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034789 Escherichia coli strain ECCNB20-2 plasmid pTB422, complete sequence 42102-42143 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021463 Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence 177860-177901 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021463 Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence 90091-90132 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042579 Enterobacter kobei strain C16 plasmid pC16_001, complete sequence 190266-190307 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042579 Enterobacter kobei strain C16 plasmid pC16_001, complete sequence 212140-212181 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042579 Enterobacter kobei strain C16 plasmid pC16_001, complete sequence 23867-23908 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042579 Enterobacter kobei strain C16 plasmid pC16_001, complete sequence 238548-238589 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP035201 Klebsiella pneumoniae strain LH375 plasmid pLH375-5, complete sequence 51-92 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP035201 Klebsiella pneumoniae strain LH375 plasmid pLH375-5, complete sequence 14020-14061 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 117732-117773 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP033636 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb4, complete sequence 98517-98558 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034124 Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence 182739-182780 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 13150-13191 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 160538-160579 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 35529-35570 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 50565-50606 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 65330-65371 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 117694-117735 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 120196-120237 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052178 Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence 216256-216297 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP048776 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence 299796-299837 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023948 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence 85341-85382 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043515 Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence 72906-72947 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042883 Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence 174981-175022 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 48551-48592 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 51020-51061 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 167924-167965 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 46111-46152 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018691 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-4, complete sequence 28777-28818 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018691 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-4, complete sequence 38682-38723 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT883141 Escherichia coli isolate 6666666.257727.embl plasmid III 101327-101368 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP047574 Escherichia coli strain 2EC1 plasmid p2EC1-3, complete sequence 34349-34390 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_019114 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence 215789-215830 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_019117 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH696_117, complete sequence 95772-95813 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041936 Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence 57268-57309 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041936 Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence 9617-9658 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041936 Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence 60678-60719 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041936 Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence 64233-64274 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041937 Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence 55125-55166 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032170 Klebsiella pneumoniae strain AR_0076 plasmid unnamed3, complete sequence 11444-11485 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 319082-319123 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 272371-272412 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 295322-295363 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 390316-390357 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 416420-416461 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052435 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence 130602-130643 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP023198 Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence 261023-261064 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043223 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence 180401-180442 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP035212 Klebsiella pneumoniae strain TH164 plasmid pTH164-1, complete sequence 19914-19955 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031883 Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence 5088-5129 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031883 Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence 39284-39325 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049193 Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence 10794-10835 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049193 Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence 175394-175435 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049193 Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence 180806-180847 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049193 Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence 202678-202719 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049193 Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence 260175-260216 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049193 Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence 252436-252477 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 81095-81136 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 24140-24181 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052366 Klebsiella pneumoniae strain D16KP0109 plasmid pD16KP0109-1, complete sequence 17065-17106 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044337 Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence 51377-51418 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 90450-90491 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 184990-185031 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054751 Klebsiella pneumoniae strain KP20194c3 plasmid pKP20194c3-p1, complete sequence 177552-177593 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054781 Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p1, complete sequence 177555-177596 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 1089-1130 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 84773-84814 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 117854-117895 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 132006-132047 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 148755-148796 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 55105-55146 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 64191-64232 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 110839-110880 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 162276-162317 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021698 Klebsiella pneumoniae strain AR_0158 plasmid tig00000183, complete sequence 15368-15409 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021698 Klebsiella pneumoniae strain AR_0158 plasmid tig00000183, complete sequence 17443-17484 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021698 Klebsiella pneumoniae strain AR_0158 plasmid tig00000183, complete sequence 61353-61394 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 64256-64297 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 140674-140715 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 163527-163568 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034083 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence 214082-214123 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026720 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 plasmid unitig_2_pilon, complete sequence 55590-55631 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026720 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 plasmid unitig_2_pilon, complete sequence 32077-32118 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049189 Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence 281657-281698 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049189 Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence 28083-28124 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049189 Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence 49948-49989 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049189 Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence 55358-55399 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049189 Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence 219958-219999 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049189 Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence 262985-263026 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049189 Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence 273918-273959 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054763 Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p1, complete sequence 177602-177643 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038456 Escherichia coli strain EC-129 plasmid pEC129_3 6146-6187 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038456 Escherichia coli strain EC-129 plasmid pEC129_3 37422-37463 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP029383 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence 163304-163345 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018105 Escherichia coli strain MRSN352231 plasmid pMR0716_PSE, complete sequence 13643-13684 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 8137-8178 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 9156-9197 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 10426-10467 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 51377-51418 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 52389-52430 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 56312-56353 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 85367-85408 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 136766-136807 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 60562-60603 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 107257-107298 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 107349-107390 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 124596-124637 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 16848-16889 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 122706-122747 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 143501-143542 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041444 Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence 68273-68314 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041444 Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence 34344-34385 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026012 Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence 79504-79545 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026024 Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence 115158-115199 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045998 Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence 32199-32240 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 137044-137085 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042525 Citrobacter freundii strain E11 plasmid pE11_001, complete sequence 280795-280836 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042525 Citrobacter freundii strain E11 plasmid pE11_001, complete sequence 23488-23529 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042525 Citrobacter freundii strain E11 plasmid pE11_001, complete sequence 151340-151381 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042525 Citrobacter freundii strain E11 plasmid pE11_001, complete sequence 266325-266366 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 108558-108599 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 21692-21733 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 34062-34103 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 51566-51607 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 79540-79581 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 129219-129260 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 139285-139326 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 142206-142247 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 152469-152510 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP018352 Enterobacter hormaechei strain TUM11043 plasmid pMTY11043_IncHI2, complete sequence 89628-89669 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP018352 Enterobacter hormaechei strain TUM11043 plasmid pMTY11043_IncHI2, complete sequence 333055-333096 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 100369-100410 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 103460-103501 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 220179-220220 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 141199-141240 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054745 Klebsiella pneumoniae strain KP20194c4 plasmid pKP20194c4-p1, complete sequence 177554-177595 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054727 Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p1, complete sequence 177552-177593 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054739 Klebsiella pneumoniae strain KP20194c5 plasmid pKP20194c5-p1, complete sequence 177558-177599 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP020502 Serratia marcescens strain BWH-23 plasmid unnamed, complete sequence 53702-53743 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044369 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence 85425-85466 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044371 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-3, complete sequence 10674-10715 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038654 Citrobacter freundii strain 154 plasmid p154_1, complete sequence 72341-72382 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038654 Citrobacter freundii strain 154 plasmid p154_1, complete sequence 131857-131898 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038654 Citrobacter freundii strain 154 plasmid p154_1, complete sequence 229705-229746 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038657 Citrobacter freundii strain 565 plasmid p565_1, complete sequence 74458-74499 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038657 Citrobacter freundii strain 565 plasmid p565_1, complete sequence 136419-136460 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038657 Citrobacter freundii strain 565 plasmid p565_1, complete sequence 234267-234308 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 209048-209089 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 122222-122263 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 153292-153333 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054775 Klebsiella pneumoniae strain KP20194a2 plasmid pKP20194a2-p1, complete sequence 177555-177596 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054733 Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p1, complete sequence 177551-177592 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054721 Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p1, complete sequence 177554-177595 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054757 Klebsiella pneumoniae strain KP20194c plasmid pKP20194c-p1, complete sequence 177550-177591 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054769 Klebsiella pneumoniae strain KP20194b plasmid pKP20194b-p1, complete sequence 177558-177599 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_019256 Shigella sp. LN126 plasmid pLN126_33, complete sequence 28282-28323 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_019256 Shigella sp. LN126 plasmid pLN126_33, complete sequence 31527-31568 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MH884649 Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence 23047-23088 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MH884651 Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence 74491-74532 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021761 Klebsiella pneumoniae strain AR_0138 plasmid tig00000004, complete sequence 11336-11377 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP050276 Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence 205557-205598 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MH229869 Escherichia coli plasmid pKANJ7, complete sequence 27092-27133 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK649826 Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence 84193-84234 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP018145 Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence 138228-138269 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP018145 Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence 143640-143681 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052259 Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-1, complete sequence 221302-221343 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029717 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed4, complete sequence 280916-280957 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029717 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed4, complete sequence 292992-293033 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029717 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed4, complete sequence 55751-55792 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029717 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed4, complete sequence 115266-115307 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029720 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed2, complete sequence 14437-14478 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024910 Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L plasmid pOSUKPC4, complete sequence 27741-27782 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024910 Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L plasmid pOSUKPC4, complete sequence 296931-296972 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024910 Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L plasmid pOSUKPC4, complete sequence 196135-196176 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 57404-57445 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 225591-225632 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 111163-111204 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 196088-196129 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 208431-208472 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 213248-213289 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT994837 Klebsiella pneumoniae isolate CNR132 plasmid CNR132, complete sequence 11508-11549 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT994839 Klebsiella pneumoniae isolate CNR95 plasmid CNR95, complete sequence 11351-11392 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT994834 Klebsiella pneumoniae isolate CNR3 plasmid CNR3, complete sequence 4984-5025 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT994836 Klebsiella pneumoniae isolate CNR339 plasmid CNR339, complete sequence 11405-11446 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT994840 Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence 68648-68689 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026587 Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence 135837-135878 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN937241 Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence 146679-146720 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN937241 Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence 160733-160774 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN937241 Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence 23488-23529 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN937241 Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence 243568-243609 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 173713-173754 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 51900-51941 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 168804-168845 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 171273-171314 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023978 Klebsiella variicola strain X39 plasmid pX39-1, complete sequence 97572-97613 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023978 Klebsiella variicola strain X39 plasmid pX39-1, complete sequence 149925-149966 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023978 Klebsiella variicola strain X39 plasmid pX39-1, complete sequence 152427-152468 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023978 Klebsiella variicola strain X39 plasmid pX39-1, complete sequence 157212-157253 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023978 Klebsiella variicola strain X39 plasmid pX39-1, complete sequence 163986-164027 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023978 Klebsiella variicola strain X39 plasmid pX39-1, complete sequence 168541-168582 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LR745046 Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166 211121-211162 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LR745043 Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154 200056-200097 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_004429 Escherichia coli plasmid pIS2, complete sequence 2599-2640 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_004429 Escherichia coli plasmid pIS2, complete sequence 1477-1518 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044051 Klebsiella variicola strain FDAARGOS_627 plasmid unnamed2, complete sequence 141234-141275 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044051 Klebsiella variicola strain FDAARGOS_627 plasmid unnamed2, complete sequence 271705-271746 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT882698 Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence 240519-240560 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT985322 Escherichia coli strain 727 plasmid RCS55TR727_p, complete sequence 33850-33891 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT985322 Escherichia coli strain 727 plasmid RCS55TR727_p, complete sequence 35925-35966 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT985306 Escherichia coli strain ECOR 37 plasmid RCS88_p, complete sequence 60834-60875 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT985306 Escherichia coli strain ECOR 37 plasmid RCS88_p, complete sequence 59476-59517 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT985249 Escherichia coli strain 195 plasmid RCS46_p, complete sequence 44727-44768 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT985249 Escherichia coli strain 195 plasmid RCS46_p, complete sequence 199087-199128 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT985249 Escherichia coli strain 195 plasmid RCS46_p, complete sequence 27978-28019 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT985249 Escherichia coli strain 195 plasmid RCS46_p, complete sequence 210966-211007 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN604267 Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence 163459-163500 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP047634 Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence 36351-36392 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 126231-126272 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 4418-4459 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 121322-121363 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 123791-123832 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052495 Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-1, complete sequence 215519-215560 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK461931 Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence 2530-2571 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK461931 Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence 90479-90520 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK731977 Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence 19015-19056 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK262711 Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence 35392-35433 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK104259 Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence 38344-38385 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK167989 Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence 25934-25975 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 47749-47790 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 95683-95724 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 10272-10313 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 62135-62176 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 120374-120415 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 182636-182677 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MN540571 Escherichia coli strain E.coli4feg plasmid pIV_IncHI2_CTX_M_15, complete sequence 99897-99938 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_017541 Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence 141552-141593 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP025683 Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence 14158-14199 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP025683 Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence 129404-129445 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH829594 Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence 22436-22477 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH829594 Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence 223466-223507 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH829594 Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence 125071-125112 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH829594 Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence 127003-127044 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH829594 Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence 278040-278081 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH917279 Klebsiella pneumoniae strain A1706 plasmid pA1706-NDM, complete sequence 71793-71834 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH287085 Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence 89975-90016 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH909349 Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence 87647-87688 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH909349 Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence 190145-190186 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK079573 Klebsiella pneumoniae strain LDH4-2 plasmid pHNLDH4-2, complete sequence 15100-15141 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK248692 Klebsiella pneumoniae strain KP18-29 plasmid p18-29tetA, complete sequence 61862-61903 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH287084 Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence 89973-90014 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH263653 Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence 7148-7189 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH341574 Klebsiella pneumoniae strain MYKLB95 plasmid MYKLB95-1, complete sequence 93368-93409 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH341574 Klebsiella pneumoniae strain MYKLB95 plasmid MYKLB95-1, complete sequence 95431-95472 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH477636 Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence 11695-11736 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 191796-191837 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK413720 Enterobacter cloacae strain 12949 plasmid p12949-HI2, complete sequence 274096-274137 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK413720 Enterobacter cloacae strain 12949 plasmid p12949-HI2, complete sequence 190354-190395 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK736669 Enterobacter cloacae strain EclC2185 plasmid pEclC2185CTXM15, complete sequence 149498-149539 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038858 Escherichia coli strain PigCaeca_2 plasmid unnamed, complete sequence 59442-59483 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 87303-87344 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MT219826 Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence 49661-49702 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MT090959 Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_KPC, complete sequence 169087-169128 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014778 Pluralibacter gergoviae strain FB2 plasmid pFB2.3, complete sequence 30760-30801 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014778 Pluralibacter gergoviae strain FB2 plasmid pFB2.3, complete sequence 36461-36502 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014778 Pluralibacter gergoviae strain FB2 plasmid pFB2.3, complete sequence 89218-89259 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014778 Pluralibacter gergoviae strain FB2 plasmid pFB2.3, complete sequence 93338-93379 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014778 Pluralibacter gergoviae strain FB2 plasmid pFB2.3, complete sequence 35192-35233 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014778 Pluralibacter gergoviae strain FB2 plasmid pFB2.3, complete sequence 52247-52288 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 87317-87358 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 104699-104740 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 29437-29478 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MG557997 Citrobacter freundii strain Cfr-36808cz plasmid pCfr-36808cz, complete sequence 14344-14385 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MG904992 Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence 72933-72974 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MG904992 Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence 149770-149811 0 1.0
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026282 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence 122551-122592 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018350 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-67, complete sequence 60836-60877 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018350 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-67, complete sequence 20350-20391 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 47943-47984 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 25194-25235 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KY296104 Enterobacter cloacae strain 13E169 plasmid pHN84KPC, complete sequence 14477-14518 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 33513-33554 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KX960110 Escherichia coli strain CREC-TJ2 plasmid pCREC-TJ2-NDM, complete sequence 38199-38240 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028197 Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence 249480-249521 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028197 Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence 261710-261751 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021755 Klebsiella pneumoniae strain AR_0113 plasmid unitig_4, complete sequence 21126-21167 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 43647-43688 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 130460-130501 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011601 Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence 215980-216021 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011601 Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence 274818-274859 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 KY486279 Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence 613-654 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028975 Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence 108178-108219 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 217948-217989 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 212268-212309 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029588 Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence 993-1034 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 204919-204960 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KX646543 Shigella boydii strain 2246 plasmid p2246-CTXM, complete sequence 28108-28149 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 44085-44126 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 6322-6363 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP035215 Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence 318987-319028 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP035215 Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence 326497-326538 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP035215 Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence 334005-334046 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP035215 Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence 279191-279232 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP035634 Enterobacter cloacae strain EN3600 plasmid unnamed2, complete sequence 187426-187467 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KJ958926 Klebsiella pneumoniae strain Kpn-3002cz plasmid pB-3002cz, complete sequence 94923-94964 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 1973-2014 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LN824135 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671 25314-25355 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP033955 Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence 23112-23153 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026237 Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence 204709-204750 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MT077884 Escherichia coli plasmid p33, complete sequence 212809-212850 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MT077888 Escherichia coli plasmid p65, complete sequence 205080-205121 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_023314 Klebsiella pneumoniae plasmid pKPS30, complete sequence 9580-9621 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP036302 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence 4935-4976 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN423361 Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence 188314-188355 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044204 Salmonella enterica subsp. enterica serovar Senftenberg strain AR-0405 plasmid pAR-0405, complete sequence 49357-49398 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347230 Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence 161831-161872 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK347232 Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence 121359-121400 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 4935-4976 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 17010-17051 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MK312248 Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence 41640-41681 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041949 Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence 4935-4976 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031568 Enterobacter hormaechei strain 2013_1a plasmid pSHV12-1301491, complete sequence 91930-91971 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 109060-109101 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 4935-4976 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040888 Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_1, complete sequence 217365-217406 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 259517-259558 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038139 Escherichia coli strain G3X16-2 plasmid pG3X16-2-2, complete sequence 168818-168859 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 1223-1264 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 97354-97395 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041084 Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence 4935-4976 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026272 Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence 108844-108885 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026272 Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence 125870-125911 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 159928-159969 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 177859-177900 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 91706-91747 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 103029-103070 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 1548-1589 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP036337 Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence 125865-125906 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence 8004-8045 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence 24357-24398 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence 173503-173544 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence 241723-241764 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008825 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence 271548-271589 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041374 Klebsiella pneumoniae strain KP58 plasmid pKP58-1, complete sequence 23112-23153 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 141954-141995 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 107332-107373 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP025213 Klebsiella pneumoniae strain HZW25 plasmid unnamed2, complete sequence 23386-23427 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029037 Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 plasmid unnamed, complete sequence 87439-87480 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045217 Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence 15518-15559 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045217 Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence 18453-18494 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045217 Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence 60282-60323 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045217 Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence 74519-74560 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045217 Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence 11169-11210 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045217 Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence 29741-29782 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045217 Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence 67698-67739 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP039809 Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence 4935-4976 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 65795-65836 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052376 Klebsiella pneumoniae strain D16KP0025 plasmid pD16KP0025-1, complete sequence 52155-52196 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_024960 Escherichia coli plasmid pIS04_68, strain ISO4, complete sequence 10796-10837 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_024960 Escherichia coli plasmid pIS04_68, strain ISO4, complete sequence 45179-45220 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026180 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence 24489-24530 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 128175-128216 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP033402 Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence 4935-4976 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_010870 Klebsiella pneumoniae plasmid pK29, complete sequence 21287-21328 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021547 Klebsiella pneumoniae strain AR_0112 plasmid tig00000003, complete sequence 5042-5083 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP043751 Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence 81477-81518 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 29867-29908 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 295482-295523 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP047338 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-50kb, complete sequence 45655-45696 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021687 Klebsiella pneumoniae strain AR_0146 plasmid tig00001186, complete sequence 66596-66637 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021720 Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence 187968-188009 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024857 Escherichia coli strain AR_0011 plasmid tig00001069_pilon, complete sequence 75848-75889 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024857 Escherichia coli strain AR_0011 plasmid tig00001069_pilon, complete sequence 44738-44779 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP043545 Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence 117904-117945 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP043545 Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence 190737-190778 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 67996-68037 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030186 Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence 278219-278260 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030066 Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence 65748-65789 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028549 Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence 106671-106712 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 56081-56122 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 7826-7867 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008798 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPC-484, complete sequence 74491-74532 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 80071-80112 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 91394-91435 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030224 Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence 29366-29407 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP030224 Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence 41207-41248 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040730 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed1 58102-58143 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040731 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed2 16009-16050 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040731 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed2 55667-55708 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008899 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-8a4, complete sequence 146171-146212 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP008906 Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-08e, complete sequence 146171-146212 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052547 Klebsiella pneumoniae strain B16KP0089 plasmid pB16KP0089-1, complete sequence 50070-50111 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 4936-4977 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 64581-64622 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP036447 Klebsiella pneumoniae strain KPNIH45 plasmid unnamed2, complete sequence 73599-73640 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020062 Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence 3028-3069 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP020062 Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence 67510-67551 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP022155 Escherichia coli strain ABWA45 plasmid pABWA45_1, complete sequence 68725-68766 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015386 Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence 6001-6042 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP015386 Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence 120581-120622 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 174678-174719 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN256759 Escherichia coli strain 4M9F plasmid p4M9F, complete sequence 150456-150497 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038275 Raoultella ornithinolytica strain WLK218 plasmid pWLK-101716, complete sequence 37997-38038 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP016526 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence 218346-218387 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031575 Enterobacter hormaechei strain A1 plasmid pIncHI2-1502264, complete sequence 187847-187888 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032988 Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence 16818-16859 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 10946-10987 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 124654-124695 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP050163 Escherichia coli plasmid Carbapenemase(KPC-2)_IncHI2, complete sequence 199941-199982 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 72155-72196 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 66733-66774 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP046008 Escherichia coli strain 1919D62 plasmid p1919D62-2, complete sequence 24322-24363 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034132 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_81.9Kb, complete sequence 34295-34336 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP024431 Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence 22898-22939 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 51682-51723 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 46260-46301 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052387 Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence 4936-4977 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_021198 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence 96754-96795 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NC_021198 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence 247718-247759 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 33272-33313 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 44595-44636 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029387 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence 4935-4976 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP017452 Klebsiella sp. LTGPAF-6F plasmid unnamed2, complete sequence 20432-20473 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 8165-8206 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LR025093 Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence 108102-108143 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 125520-125561 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 67995-68036 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 110810-110851 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 374346-374387 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP012170 Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence 87305-87346 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034138 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence 153701-153742 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034140 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_84.1Kb, complete sequence 34288-34329 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011635 Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence 299059-299100 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 21833-21874 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 210381-210422 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 235082-235123 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP027150 Klebsiella pneumoniae strain AR_0363 plasmid unnamed3 26789-26830 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 70828-70869 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 65406-65447 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP013215 Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence 196290-196331 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052373 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence 171760-171801 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 132440-132481 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 217607-217648 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 35186-35227 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 210400-210441 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 204720-204761 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014758 Klebsiella pneumoniae strain AATZP plasmid pKPN-041, complete sequence 21680-21721 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP011644 Klebsiella pneumoniae strain CAV1596 plasmid pCAV1596-41, complete sequence 17818-17859 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 80594-80635 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP027162 Klebsiella pneumoniae strain AR_0361 plasmid unnamed3 18121-18162 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034124 Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence 23112-23153 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 8309-8350 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 37927-37968 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP048776 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence 142828-142869 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP048776 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence 174580-174621 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043515 Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence 84004-84045 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP043515 Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence 84097-84138 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP042883 Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence 4935-4976 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT883141 Escherichia coli isolate 6666666.257727.embl plasmid III 22395-22436 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041936 Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence 6260-6301 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041936 Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence 81563-81604 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 174678-174719 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052435 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence 4935-4976 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP035212 Klebsiella pneumoniae strain TH164 plasmid pTH164-1, complete sequence 17839-17880 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031883 Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence 57603-57644 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP031883 Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence 37209-37250 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049193 Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence 175797-175838 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049193 Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence 271104-271145 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049193 Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence 18708-18749 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052366 Klebsiella pneumoniae strain D16KP0109 plasmid pD16KP0109-1, complete sequence 14989-15030 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044337 Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence 51780-51821 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054751 Klebsiella pneumoniae strain KP20194c3 plasmid pKP20194c3-p1, complete sequence 23112-23153 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054781 Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p1, complete sequence 23112-23153 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 130987-131028 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049189 Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence 212042-212083 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049189 Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence 54955-54996 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054763 Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p1, complete sequence 23112-23153 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP038456 Escherichia coli strain EC-129 plasmid pEC129_3 35973-36014 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP041444 Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence 66198-66239 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054745 Klebsiella pneumoniae strain KP20194c4 plasmid pKP20194c4-p1, complete sequence 23112-23153 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054727 Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p1, complete sequence 23112-23153 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054739 Klebsiella pneumoniae strain KP20194c5 plasmid pKP20194c5-p1, complete sequence 23112-23153 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP044371 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-3, complete sequence 8597-8638 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054775 Klebsiella pneumoniae strain KP20194a2 plasmid pKP20194a2-p1, complete sequence 23112-23153 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054733 Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p1, complete sequence 23112-23153 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054721 Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p1, complete sequence 23112-23153 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054757 Klebsiella pneumoniae strain KP20194c plasmid pKP20194c-p1, complete sequence 23112-23153 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP054769 Klebsiella pneumoniae strain KP20194b plasmid pKP20194b-p1, complete sequence 23112-23153 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MH884649 Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence 20972-21013 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MH884651 Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence 72416-72457 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP050276 Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence 298301-298342 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP050276 Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence 373988-374029 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_AP018145 Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence 138631-138672 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029717 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed4, complete sequence 281319-281360 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT994837 Klebsiella pneumoniae isolate CNR132 plasmid CNR132, complete sequence 9432-9473 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT994839 Klebsiella pneumoniae isolate CNR95 plasmid CNR95, complete sequence 9275-9316 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT994836 Klebsiella pneumoniae isolate CNR339 plasmid CNR339, complete sequence 9329-9370 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_LT994840 Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence 93458-93499 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN937241 Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence 141670-141711 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023978 Klebsiella variicola strain X39 plasmid pX39-1, complete sequence 28089-28130 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP023978 Klebsiella variicola strain X39 plasmid pX39-1, complete sequence 203831-203872 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MN604267 Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence 126912-126953 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK461931 Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence 118484-118525 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK104259 Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence 4202-4243 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK167989 Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence 6618-6659 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 78884-78925 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH829594 Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence 126600-126641 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH917279 Klebsiella pneumoniae strain A1706 plasmid pA1706-NDM, complete sequence 26617-26658 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH917279 Klebsiella pneumoniae strain A1706 plasmid pA1706-NDM, complete sequence 69717-69758 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH909349 Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence 5870-5911 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH909349 Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence 85571-85612 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH909349 Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence 188071-188112 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK079573 Klebsiella pneumoniae strain LDH4-2 plasmid pHNLDH4-2, complete sequence 24290-24331 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK248692 Klebsiella pneumoniae strain KP18-29 plasmid p18-29tetA, complete sequence 59787-59828 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH287084 Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence 119872-119913 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH287084 Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence 233602-233643 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH287084 Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence 117156-117197 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH263653 Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence 76567-76608 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH477636 Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence 155705-155746 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH477636 Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence 9619-9660 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 155284-155325 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MK413720 Enterobacter cloacae strain 12949 plasmid p12949-HI2, complete sequence 47592-47633 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MT219826 Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence 1223-1264 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MT219826 Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence 47586-47627 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 MT090959 Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_KPC, complete sequence 23112-23153 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP014778 Pluralibacter gergoviae strain FB2 plasmid pFB2.3, complete sequence 105668-105709 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_MG557997 Citrobacter freundii strain Cfr-36808cz plasmid pCfr-36808cz, complete sequence 12268-12309 1 0.976
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_KY751925 Klebsiella pneumoniae strain M16-13 plasmid pM16-13, complete sequence 60303-60344 2 0.952
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP049605 Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence 151434-151475 2 0.952
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 229211-229252 2 0.952
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029140 Klebsiella michiganensis strain AR375 plasmid unnamed1, complete sequence 94762-94803 2 0.952
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP029140 Klebsiella michiganensis strain AR375 plasmid unnamed1, complete sequence 5669-5710 2 0.952
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 NZ_CP034679 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_83kb, complete sequence 77827-77868 2 0.952
NZ_CP008825_1 1.1|241815|42|NZ_CP008825|CRISPRCasFinder 241815-241856 42 CP052387 Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence 79239-79280 2 0.952

1. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026282 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

2. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018350 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-67, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

3. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018350 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-67, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

4. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

5. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

6. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

7. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

8. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

9. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

10. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

11. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

12. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

13. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

14. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

15. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

16. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

17. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

18. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

19. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

20. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

21. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

22. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KX710093 (Leclercia adecarboxylata strain pP10164 plasmid pP10164-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

23. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KX710093 (Leclercia adecarboxylata strain pP10164 plasmid pP10164-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

24. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KX710093 (Leclercia adecarboxylata strain pP10164 plasmid pP10164-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

25. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KY296104 (Enterobacter cloacae strain 13E169 plasmid pHN84KPC, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

26. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KY270852 (Enterobacter cloacae strain T5282 plasmid pT5282-mphA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

27. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KY270852 (Enterobacter cloacae strain T5282 plasmid pT5282-mphA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

28. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KY751925 (Klebsiella pneumoniae strain M16-13 plasmid pM16-13, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

29. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LC511995 (Enterobacter hormaechei subsp. xiangfangensis strain MY146 plasmid pMY146-rmtE, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

30. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LC511995 (Enterobacter hormaechei subsp. xiangfangensis strain MY146 plasmid pMY146-rmtE, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

31. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

32. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

33. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

34. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032198 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

35. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

36. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

37. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034757 (Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

38. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

39. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

40. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

41. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

42. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

43. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

44. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

45. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

46. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050847 (Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

47. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050847 (Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

48. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050847 (Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

49. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050847 (Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

50. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050847 (Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

51. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP016764 (Citrobacter freundii strain B38 plasmid pOZ181, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

52. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP016764 (Citrobacter freundii strain B38 plasmid pOZ181, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

53. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KU665641 (Klebsiella pneumoniae strain AO-15200 plasmid pG06-VIM-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

54. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KU665641 (Klebsiella pneumoniae strain AO-15200 plasmid pG06-VIM-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

55. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

56. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KX960110 (Escherichia coli strain CREC-TJ2 plasmid pCREC-TJ2-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

57. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KX960110 (Escherichia coli strain CREC-TJ2 plasmid pCREC-TJ2-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

58. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KX810825 (Salmonella enterica subsp. enterica serovar Typhimurium strain MU1 plasmid pIMP4-SEM1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

59. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KX810825 (Salmonella enterica subsp. enterica serovar Typhimurium strain MU1 plasmid pIMP4-SEM1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

60. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KX810825 (Salmonella enterica subsp. enterica serovar Typhimurium strain MU1 plasmid pIMP4-SEM1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

61. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KX810825 (Salmonella enterica subsp. enterica serovar Typhimurium strain MU1 plasmid pIMP4-SEM1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

62. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LN830952 (Enterobacter sp. 247 strain 247 BMC plasmid pEB247, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

63. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

64. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

65. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

66. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

67. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

68. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

69. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

70. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

71. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

72. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

73. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

74. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KJ958927 (Klebsiella pneumoniae strain Kpn-3002cz plasmid pS-3002cz, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

75. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KP975077 (Enterobacter cloacae strain MRSN17626 plasmid pMRVIM0813, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

76. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KP975077 (Enterobacter cloacae strain MRSN17626 plasmid pMRVIM0813, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

77. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KP975077 (Enterobacter cloacae strain MRSN17626 plasmid pMRVIM0813, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

78. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_014368 (Klebsiella pneumoniae plasmid pNL194, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

79. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028197 (Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

80. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028197 (Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

81. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028197 (Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

82. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP010131 (Escherichia coli strain C9 plasmid B, complete genome) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

83. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021755 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

84. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

85. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011839 (Klebsiella pneumoniae strain KP5 plasmid pSg1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

86. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP048368 (Escherichia coli strain 163 plasmid pC-F-164_A-OXA140, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

87. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044528 (Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

88. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044528 (Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

89. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

90. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

91. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

92. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

93. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

94. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

95. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

96. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

97. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

98. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

99. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

100. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

101. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011601 (Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

102. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011601 (Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

103. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011601 (Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

104. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011601 (Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

105. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011601 (Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

106. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052163 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

107. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

108. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

109. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

110. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

111. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP023191 (Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

112. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

113. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

114. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

115. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to KY486279 (Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

116. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to KY000035 (Agrobacterium sp. strain EHA101 plasmid pTi_EHA101, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

117. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to KY000035 (Agrobacterium sp. strain EHA101 plasmid pTi_EHA101, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

118. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028975 (Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

119. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028975 (Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

120. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028975 (Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

121. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028975 (Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

122. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028975 (Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

123. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028975 (Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

124. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

125. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

126. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

127. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

128. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP048350 (Raoultella ornithinolytica strain 23 plasmid p23_A-OXA140, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

129. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP048350 (Raoultella ornithinolytica strain 23 plasmid p23_A-OXA140, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

130. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

131. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

132. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

133. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

134. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

135. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP019900 (Raoultella planticola strain GODA plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

136. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP019900 (Raoultella planticola strain GODA plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

137. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

138. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

139. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

140. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

141. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

142. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

143. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

144. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

145. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

146. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

147. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

148. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KX646543 (Shigella boydii strain 2246 plasmid p2246-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

149. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028588 (Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

150. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

151. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

152. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

153. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

154. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

155. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

156. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP035215 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

157. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052159 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

158. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

159. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

160. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

161. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

162. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

163. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

164. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

165. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

166. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543579 (Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

167. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543579 (Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

168. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543579 (Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

169. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543579 (Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

170. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543579 (Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

171. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543579 (Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

172. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543579 (Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

173. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543581 (Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

174. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543581 (Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

175. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543581 (Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

176. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543581 (Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

177. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543581 (Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

178. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543581 (Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

179. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543581 (Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

180. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

181. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

182. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

183. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

184. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

185. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

186. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP027678 (Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

187. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP027678 (Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

188. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP027678 (Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

189. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP033961 (Klebsiella pneumoniae strain L482 plasmid p2_L382, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

190. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029447 (Serratia marcescens strain CAV1761 plasmid pCAV1761-73, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

191. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

192. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

193. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

194. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

195. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

196. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

197. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

198. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029729 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

199. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP035634 (Enterobacter cloacae strain EN3600 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

200. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP035634 (Enterobacter cloacae strain EN3600 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

201. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN539017 (Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

202. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KJ958926 (Klebsiella pneumoniae strain Kpn-3002cz plasmid pB-3002cz, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

203. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042506 (Leclercia adecarboxylata strain E1 plasmid pE1_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

204. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042506 (Leclercia adecarboxylata strain E1 plasmid pE1_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

205. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042506 (Leclercia adecarboxylata strain E1 plasmid pE1_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

206. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042506 (Leclercia adecarboxylata strain E1 plasmid pE1_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

207. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

208. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

209. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

210. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

211. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

212. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

213. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

214. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

215. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018724 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

216. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018724 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

217. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

218. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

219. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

220. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

221. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

222. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

223. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

224. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

225. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

226. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

227. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

228. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

229. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

230. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

231. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

232. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

233. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

234. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LN824135 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

235. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

236. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026237 (Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

237. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026237 (Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

238. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

239. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

240. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MT077884 (Escherichia coli plasmid p33, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

241. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MT077884 (Escherichia coli plasmid p33, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

242. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MT077884 (Escherichia coli plasmid p33, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

243. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MT077888 (Escherichia coli plasmid p65, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

244. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP051432 (Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

245. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

246. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052144 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

247. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

248. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

249. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

250. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

251. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP048293 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

252. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP048293 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

253. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP048293 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

254. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_021576 (Klebsiella pneumoniae plasmid pKP1780, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

255. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_021576 (Klebsiella pneumoniae plasmid pKP1780, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

256. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_023314 (Klebsiella pneumoniae plasmid pKPS30, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

257. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP046002 (Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

258. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

259. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

260. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008789 (Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

261. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

262. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN423361 (Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

263. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN423361 (Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

264. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN423361 (Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

265. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN423361 (Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

266. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN423361 (Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

267. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN423361 (Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

268. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN915010 (Escherichia coli strain TJ-33 plasmid pNDM-TJ33, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

269. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN915011 (Escherichia coli strain GD-33 plasmid pNDM33-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

270. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN915013 (Escherichia coli strain TD-33 plasmid pNDM-TD33, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

271. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044204 (Salmonella enterica subsp. enterica serovar Senftenberg strain AR-0405 plasmid pAR-0405, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

272. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020529 (Enterobacter cloacae strain 174 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

273. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020529 (Enterobacter cloacae strain 174 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

274. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020529 (Enterobacter cloacae strain 174 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

275. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020529 (Enterobacter cloacae strain 174 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

276. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

277. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

278. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

279. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

280. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

281. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

282. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

283. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347229 (Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

284. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347229 (Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

285. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347229 (Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

286. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

287. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

288. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

289. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

290. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

291. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

292. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

293. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

294. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

295. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

296. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

297. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

298. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

299. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

300. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

301. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

302. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

303. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

304. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

305. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

306. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

307. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

308. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

309. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

310. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

311. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

312. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_021238 (Klebsiella pneumoniae strain Kpn-1433 plasmid pKP1433, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

313. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_021238 (Klebsiella pneumoniae strain Kpn-1433 plasmid pKP1433, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

314. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

315. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

316. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044302 (Escherichia coli strain P59A plasmid pP59A-4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

317. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

318. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

319. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

320. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

321. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

322. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

323. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

324. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052357 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

325. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

326. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

327. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

328. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

329. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

330. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

331. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

332. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

333. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

334. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

335. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

336. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

337. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

338. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

339. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

340. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

341. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

342. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031566 (Enterobacter hormaechei strain 2013_1a plasmid pIncLM-1301491, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

343. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031567 (Enterobacter hormaechei strain 2013_1a plasmid pIncHI2-1301491, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

344. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031567 (Enterobacter hormaechei strain 2013_1a plasmid pIncHI2-1301491, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

345. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031568 (Enterobacter hormaechei strain 2013_1a plasmid pSHV12-1301491, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

346. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031568 (Enterobacter hormaechei strain 2013_1a plasmid pSHV12-1301491, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

347. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

348. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

349. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

350. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

351. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

352. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

353. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

354. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

355. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

356. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

357. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040888 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

358. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040888 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

359. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040888 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

360. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

361. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

362. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

363. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

364. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

365. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

366. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032878 (Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

367. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN158991 (Escherichia coli strain TREC8 plasmid pTREC8, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

368. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

369. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

370. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MH909331 (Leclercia adecarboxylata plasmid p707804-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

371. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MH909331 (Leclercia adecarboxylata plasmid p707804-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

372. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

373. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

374. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

375. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

376. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

377. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

378. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

379. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

380. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

381. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

382. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

383. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

384. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

385. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

386. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023841 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

387. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038139 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

388. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

389. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030080 (Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

390. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030080 (Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

391. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030080 (Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

392. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

393. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042616 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

394. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042616 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

395. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026272 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

396. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026272 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

397. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026272 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

398. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

399. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

400. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

401. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

402. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

403. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

404. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

405. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

406. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

407. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

408. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

409. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

410. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

411. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

412. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

413. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

414. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

415. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008824 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKEC-39c, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

416. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008825 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

417. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008825 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

418. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008825 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

419. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008825 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

420. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008825 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

421. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008825 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

422. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008825 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

423. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008825 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

424. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

425. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

426. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

427. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

428. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041374 (Klebsiella pneumoniae strain KP58 plasmid pKP58-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

429. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

430. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

431. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

432. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

433. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

434. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

435. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

436. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

437. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

438. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

439. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

440. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

441. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

442. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

443. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

444. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

445. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

446. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

447. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

448. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

449. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

450. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP025213 (Klebsiella pneumoniae strain HZW25 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

451. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP025213 (Klebsiella pneumoniae strain HZW25 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

452. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP025213 (Klebsiella pneumoniae strain HZW25 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

453. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP025213 (Klebsiella pneumoniae strain HZW25 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

454. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP022696 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

455. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP022696 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

456. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP022696 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

457. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP022696 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

458. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

459. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

460. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

461. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

462. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

463. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

464. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044153 (Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

465. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044153 (Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

466. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

467. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

468. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

469. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

470. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

471. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

472. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

473. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021962 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000008, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

474. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040546 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

475. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040929 (Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

476. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

477. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029586 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-96, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

478. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP049311 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N53023 plasmid pN53023, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

479. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP049311 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N53023 plasmid pN53023, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

480. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

481. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

482. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

483. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

484. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

485. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

486. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

487. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

488. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

489. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029037 (Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

490. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029037 (Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

491. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043855 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

492. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044215 (Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

493. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044215 (Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

494. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044215 (Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

495. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045217 (Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

496. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026203 (Escherichia coli strain ECONIH5 plasmid pECO-a7e8, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

497. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018887 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

498. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

499. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

500. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

501. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

502. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

503. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

504. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052376 (Klebsiella pneumoniae strain D16KP0025 plasmid pD16KP0025-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

505. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

506. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

507. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

508. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_024960 (Escherichia coli plasmid pIS04_68, strain ISO4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

509. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_024960 (Escherichia coli plasmid pIS04_68, strain ISO4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

510. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP007735 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

511. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP007735 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

512. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP007735 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

513. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP007735 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

514. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP007735 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

515. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP007735 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

516. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026174 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

517. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026180 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

518. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026180 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

519. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026180 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

520. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026182 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

521. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026182 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

522. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026182 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

523. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026184 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

524. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

525. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

526. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

527. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

528. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

529. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP049309 (Salmonella enterica subsp. enterica serovar Johannesburg strain CVM N58011 plasmid p58011, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

530. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP049309 (Salmonella enterica subsp. enterica serovar Johannesburg strain CVM N58011 plasmid p58011, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

531. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_010870 (Klebsiella pneumoniae plasmid pK29, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

532. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_010870 (Klebsiella pneumoniae plasmid pK29, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

533. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021547 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000003, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

534. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024813 (Enterobacter sp. CRENT-193 plasmid pCRENT-193_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

535. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP043751 (Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

536. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

537. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

538. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

539. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

540. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP047338 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-50kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

541. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP049307 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N58631 plasmid p58631, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

542. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP049307 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N58631 plasmid p58631, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

543. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

544. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021687 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001186, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

545. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021720 (Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

546. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024857 (Escherichia coli strain AR_0011 plasmid tig00001069_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

547. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP043545 (Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

548. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

549. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

550. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

551. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

552. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

553. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

554. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

555. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

556. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

557. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

558. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026110 (Paraburkholderia hospita strain DSM 17164 plasmid pEMT1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

559. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026110 (Paraburkholderia hospita strain DSM 17164 plasmid pEMT1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

560. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to JX469827 (Uncultured bacterium plasmid pEMT3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

561. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to JX469827 (Uncultured bacterium plasmid pEMT3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

562. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030186 (Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

563. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030186 (Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

564. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030186 (Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

565. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030186 (Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

566. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030186 (Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

567. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030066 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

568. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

569. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

570. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

571. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

572. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

573. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

574. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

575. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

576. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

577. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

578. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008798 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPC-484, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

579. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

580. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

581. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

582. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

583. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042494 (Leclercia adecarboxylata strain E61 plasmid pE61_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

584. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042494 (Leclercia adecarboxylata strain E61 plasmid pE61_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

585. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042494 (Leclercia adecarboxylata strain E61 plasmid pE61_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

586. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042494 (Leclercia adecarboxylata strain E61 plasmid pE61_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

587. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP043753 (Escherichia coli strain CVM N56639 plasmid pN56639, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

588. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030224 (Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

589. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040730 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed1) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

590. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040730 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed1) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

591. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040731 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed2) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

592. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

593. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

594. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

595. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

596. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

597. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

598. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

599. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

600. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

601. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

602. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

603. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011587 (Enterobacter asburiae strain CAV1043 plasmid pCAV1043-51, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

604. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026404 (Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

605. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008899 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-8a4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

606. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008899 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-8a4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

607. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008899 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-8a4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

608. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008899 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-8a4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

609. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008899 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-8a4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

610. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008906 (Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-08e, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

611. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008906 (Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-08e, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

612. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029140 (Klebsiella michiganensis strain AR375 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

613. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029140 (Klebsiella michiganensis strain AR375 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

614. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030920 (Escherichia coli strain KL53 plasmid pKL53-L, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

615. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

616. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

617. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP039328 (Citrobacter portucalensis strain Effluent_1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

618. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP039328 (Citrobacter portucalensis strain Effluent_1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

619. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041248 (Raoultella electrica strain DSM 102253 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

620. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041250 (Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

621. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052547 (Klebsiella pneumoniae strain B16KP0089 plasmid pB16KP0089-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

622. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

623. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP036447 (Klebsiella pneumoniae strain KPNIH45 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

624. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_019122 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH163_120, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

625. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_011281 (Klebsiella variicola strain 342 plasmid pKP91, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

626. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_011282 (Klebsiella variicola strain 342 plasmid pKP187, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

627. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

628. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP022155 (Escherichia coli strain ABWA45 plasmid pABWA45_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

629. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP019074 (Escherichia coli strain CRE1493 plasmid p1493-3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

630. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

631. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

632. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

633. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

634. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

635. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

636. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

637. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

638. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

639. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN256759 (Escherichia coli strain 4M9F plasmid p4M9F, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

640. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN256759 (Escherichia coli strain 4M9F plasmid p4M9F, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

641. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN256759 (Escherichia coli strain 4M9F plasmid p4M9F, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

642. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP039271 (Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

643. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP039271 (Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

644. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

645. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

646. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

647. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

648. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038275 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-101716, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

649. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038275 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-101716, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

650. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038276 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-107717, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

651. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP016526 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

652. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP016526 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

653. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP016526 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

654. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP016526 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

655. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP016526 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

656. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP010155 (Escherichia coli strain D9 plasmid C, complete genome) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

657. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031575 (Enterobacter hormaechei strain A1 plasmid pIncHI2-1502264, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

658. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031575 (Enterobacter hormaechei strain A1 plasmid pIncHI2-1502264, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

659. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031575 (Enterobacter hormaechei strain A1 plasmid pIncHI2-1502264, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

660. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031575 (Enterobacter hormaechei strain A1 plasmid pIncHI2-1502264, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

661. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

662. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

663. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

664. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

665. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP050163 (Escherichia coli plasmid Carbapenemase(KPC-2)_IncHI2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

666. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP050163 (Escherichia coli plasmid Carbapenemase(KPC-2)_IncHI2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

667. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP050163 (Escherichia coli plasmid Carbapenemase(KPC-2)_IncHI2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

668. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

669. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

670. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

671. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

672. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

673. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

674. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

675. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP039170 (Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

676. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP043758 (Escherichia coli strain CVM N55972 plasmid pN55972-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

677. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP043758 (Escherichia coli strain CVM N55972 plasmid pN55972-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

678. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP046008 (Escherichia coli strain 1919D62 plasmid p1919D62-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

679. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034416 (Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

680. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

681. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

682. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

683. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

684. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

685. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034132 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_81.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

686. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034679 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_83kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

687. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034679 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_83kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

688. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034679 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_83kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

689. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

690. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

691. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

692. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

693. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

694. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024430 (Klebsiella pneumoniae strain DA48896 plasmid p48896_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

695. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024431 (Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

696. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023570 (Enterobacter hormaechei strain BW plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

697. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023570 (Enterobacter hormaechei strain BW plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

698. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP022610 (Escherichia coli strain ATCC 700415 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

699. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041114 (Escherichia coli strain ECCTRSRTH03 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

700. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

701. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

702. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

703. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

704. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

705. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

706. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

707. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK933279 (Enterobacter hormaechei strain SCNJ07 plasmid pMCR-SCNJ07, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

708. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK933279 (Enterobacter hormaechei strain SCNJ07 plasmid pMCR-SCNJ07, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

709. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK933279 (Enterobacter hormaechei strain SCNJ07 plasmid pMCR-SCNJ07, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

710. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC532224 (Enterobacter hormaechei subsp. xiangfangensis A2483 plasmid pA2483mcr-9 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

711. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC532224 (Enterobacter hormaechei subsp. xiangfangensis A2483 plasmid pA2483mcr-9 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

712. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC532224 (Enterobacter hormaechei subsp. xiangfangensis A2483 plasmid pA2483mcr-9 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

713. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC532226 (Enterobacter hormaechei subsp. xiangfangensis A2504 plasmid pA2504mcr-9 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

714. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC532226 (Enterobacter hormaechei subsp. xiangfangensis A2504 plasmid pA2504mcr-9 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

715. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC532226 (Enterobacter hormaechei subsp. xiangfangensis A2504 plasmid pA2504mcr-9 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

716. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

717. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

718. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

719. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

720. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

721. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

722. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

723. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

724. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

725. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026661 (Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

726. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026661 (Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

727. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018669 (Klebsiella pneumoniae strain CAV1042 plasmid pKPC_CAV1042-89, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

728. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045065 (Enterobacter roggenkampii strain WCHER090065 plasmid pMCR10_090065, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

729. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045065 (Enterobacter roggenkampii strain WCHER090065 plasmid pMCR10_090065, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

730. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045065 (Enterobacter roggenkampii strain WCHER090065 plasmid pMCR10_090065, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

731. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

732. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

733. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

734. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

735. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

736. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

737. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

738. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

739. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

740. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

741. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

742. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

743. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

744. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

745. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

746. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

747. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_013507 (Escherichia coli ETEC H10407 plasmid pEntH10407, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

748. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LN794248 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid incHI2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

749. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

750. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029248 (Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_D, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

751. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029248 (Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_D, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

752. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029248 (Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_D, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

753. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP017452 (Klebsiella sp. LTGPAF-6F plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

754. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043927 (Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

755. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043927 (Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

756. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043927 (Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

757. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043927 (Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

758. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011641 (Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

759. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

760. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

761. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

762. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

763. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

764. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

765. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

766. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

767. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

768. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

769. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

770. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

771. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

772. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

773. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

774. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MH061383 (Pseudomonas aeruginosa plasmid pP6qnrS1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

775. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031102 (Leclercia sp. W17 plasmid pW17-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

776. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031102 (Leclercia sp. W17 plasmid pW17-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

777. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031102 (Leclercia sp. W17 plasmid pW17-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

778. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP017187 (Enterobacter hormaechei subsp. hoffmannii strain DSM 14563 plasmid pDSMZ14563, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

779. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP017187 (Enterobacter hormaechei subsp. hoffmannii strain DSM 14563 plasmid pDSMZ14563, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

780. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

781. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

782. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

783. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

784. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

785. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

786. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

787. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

788. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

789. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP022226 (Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

790. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042589 (Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

791. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP013340 (Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

792. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

793. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

794. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

795. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

796. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

797. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

798. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

799. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP046614 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

800. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP046614 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

801. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP012170 (Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

802. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP012170 (Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

803. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP012170 (Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

804. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP012170 (Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

805. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP012170 (Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

806. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

807. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

808. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

809. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

810. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

811. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034140 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_84.1Kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

812. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC542971 (Escherichia coli IOMTU413 plasmid pIOMTU413 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

813. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC542971 (Escherichia coli IOMTU413 plasmid pIOMTU413 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

814. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC542971 (Escherichia coli IOMTU413 plasmid pIOMTU413 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

815. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC542971 (Escherichia coli IOMTU413 plasmid pIOMTU413 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

816. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

817. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

818. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

819. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

820. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

821. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052304 (Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

822. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_024983 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTm-A54650, strain A54560, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

823. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026578 (Escherichia coli strain WCHEC005237 plasmid pQnrS1_005237, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

824. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

825. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

826. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

827. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044968 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

828. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044968 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

829. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

830. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

831. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

832. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

833. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

834. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

835. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

836. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

837. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

838. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018316 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

839. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018316 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

840. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015916 (Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

841. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015916 (Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

842. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

843. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

844. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

845. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

846. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

847. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

848. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

849. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

850. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

851. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

852. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

853. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

854. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

855. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

856. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

857. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

858. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

859. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

860. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

861. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

862. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

863. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

864. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032189 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

865. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP027150 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

866. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP037959 (Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

867. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

868. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

869. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

870. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN816373 (Escherichia coli strain A127 plasmid pA127-X1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

871. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN865122 (Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

872. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_011743 (Escherichia fergusonii ATCC 35469 plasmid pEFER, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

873. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP032292 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

874. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP032292 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

875. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

876. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

877. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

878. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

879. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

880. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043767 (Enterobacter hormaechei strain EB_P9_L5_03.19 plasmid pIMPIncH12_331kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

881. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043767 (Enterobacter hormaechei strain EB_P9_L5_03.19 plasmid pIMPIncH12_331kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

882. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

883. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

884. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP039861 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

885. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP033379 (Escherichia coli strain L73 plasmid pL73-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

886. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP033379 (Escherichia coli strain L73 plasmid pL73-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

887. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP033379 (Escherichia coli strain L73 plasmid pL73-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

888. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP027606 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

889. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034390 (Escherichia coli strain RS571 plasmid pRS571-MCR-1.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

890. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034390 (Escherichia coli strain RS571 plasmid pRS571-MCR-1.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

891. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP013215 (Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

892. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP013215 (Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

893. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP013215 (Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

894. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP013215 (Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

895. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052204 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

896. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052373 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

897. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052373 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

898. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052373 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

899. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052373 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

900. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

901. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP027144 (Enterobacter hormaechei subsp. hoffmannii strain AR_0365 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

902. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP027144 (Enterobacter hormaechei subsp. hoffmannii strain AR_0365 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

903. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP027144 (Enterobacter hormaechei subsp. hoffmannii strain AR_0365 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

904. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP027144 (Enterobacter hormaechei subsp. hoffmannii strain AR_0365 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

905. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP027145 (Enterobacter hormaechei subsp. hoffmannii strain AR_0365 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

906. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011622 (Klebsiella pneumoniae strain CAV1344 plasmid pKPC_CAV1344, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

907. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

908. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

909. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

910. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014758 (Klebsiella pneumoniae strain AATZP plasmid pKPN-041, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

911. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011644 (Klebsiella pneumoniae strain CAV1596 plasmid pCAV1596-41, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

912. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

913. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP027162 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

914. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034789 (Escherichia coli strain ECCNB20-2 plasmid pTB422, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

915. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034789 (Escherichia coli strain ECCNB20-2 plasmid pTB422, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

916. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021463 (Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

917. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021463 (Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

918. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042579 (Enterobacter kobei strain C16 plasmid pC16_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

919. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042579 (Enterobacter kobei strain C16 plasmid pC16_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

920. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042579 (Enterobacter kobei strain C16 plasmid pC16_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

921. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042579 (Enterobacter kobei strain C16 plasmid pC16_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

922. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP035201 (Klebsiella pneumoniae strain LH375 plasmid pLH375-5, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

923. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP035201 (Klebsiella pneumoniae strain LH375 plasmid pLH375-5, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

924. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

925. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP033636 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

926. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

927. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

928. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

929. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

930. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

931. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

932. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

933. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

934. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052178 (Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

935. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

936. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

937. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

938. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

939. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

940. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

941. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

942. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

943. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018691 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

944. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018691 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

945. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT883141 (Escherichia coli isolate 6666666.257727.embl plasmid III) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

946. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP047574 (Escherichia coli strain 2EC1 plasmid p2EC1-3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

947. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

948. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_019117 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH696_117, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

949. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

950. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

951. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

952. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

953. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

954. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032170 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

955. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

956. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

957. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

958. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

959. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

960. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

961. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP023198 (Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

962. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

963. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP035212 (Klebsiella pneumoniae strain TH164 plasmid pTH164-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

964. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

965. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

966. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049193 (Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

967. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049193 (Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

968. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049193 (Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

969. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049193 (Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

970. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049193 (Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

971. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049193 (Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

972. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

973. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

974. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052366 (Klebsiella pneumoniae strain D16KP0109 plasmid pD16KP0109-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

975. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044337 (Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

976. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

977. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

978. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054751 (Klebsiella pneumoniae strain KP20194c3 plasmid pKP20194c3-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

979. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054781 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

980. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

981. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

982. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

983. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

984. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

985. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

986. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

987. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

988. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

989. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021698 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000183, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

990. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021698 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000183, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

991. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021698 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000183, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

992. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

993. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

994. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

995. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

996. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026720 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

997. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026720 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

998. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

999. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1000. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1001. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1002. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1003. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1004. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1005. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054763 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1006. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038456 (Escherichia coli strain EC-129 plasmid pEC129_3) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1007. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038456 (Escherichia coli strain EC-129 plasmid pEC129_3) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1008. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1009. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018105 (Escherichia coli strain MRSN352231 plasmid pMR0716_PSE, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1010. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1011. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1012. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1013. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1014. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1015. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1016. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1017. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1018. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1019. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1020. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1021. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1022. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1023. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1024. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1025. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041444 (Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1026. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041444 (Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1027. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1028. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1029. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045998 (Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1030. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1031. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042525 (Citrobacter freundii strain E11 plasmid pE11_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1032. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042525 (Citrobacter freundii strain E11 plasmid pE11_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1033. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042525 (Citrobacter freundii strain E11 plasmid pE11_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1034. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042525 (Citrobacter freundii strain E11 plasmid pE11_001, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1035. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1036. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1037. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1038. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1039. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1040. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1041. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1042. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1043. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1044. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP018352 (Enterobacter hormaechei strain TUM11043 plasmid pMTY11043_IncHI2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1045. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP018352 (Enterobacter hormaechei strain TUM11043 plasmid pMTY11043_IncHI2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1046. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1047. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1048. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1049. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1050. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054745 (Klebsiella pneumoniae strain KP20194c4 plasmid pKP20194c4-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1051. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054727 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1052. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054739 (Klebsiella pneumoniae strain KP20194c5 plasmid pKP20194c5-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1053. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP020502 (Serratia marcescens strain BWH-23 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1054. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1055. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044371 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1056. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038654 (Citrobacter freundii strain 154 plasmid p154_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1057. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038654 (Citrobacter freundii strain 154 plasmid p154_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1058. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038654 (Citrobacter freundii strain 154 plasmid p154_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1059. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038657 (Citrobacter freundii strain 565 plasmid p565_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1060. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038657 (Citrobacter freundii strain 565 plasmid p565_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1061. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038657 (Citrobacter freundii strain 565 plasmid p565_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1062. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1063. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1064. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1065. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054775 (Klebsiella pneumoniae strain KP20194a2 plasmid pKP20194a2-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1066. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054733 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1067. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054721 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1068. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054757 (Klebsiella pneumoniae strain KP20194c plasmid pKP20194c-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1069. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054769 (Klebsiella pneumoniae strain KP20194b plasmid pKP20194b-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1070. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_019256 (Shigella sp. LN126 plasmid pLN126_33, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1071. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_019256 (Shigella sp. LN126 plasmid pLN126_33, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1072. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MH884649 (Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1073. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MH884651 (Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1074. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021761 (Klebsiella pneumoniae strain AR_0138 plasmid tig00000004, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1075. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1076. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MH229869 (Escherichia coli plasmid pKANJ7, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1077. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1078. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP018145 (Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1079. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP018145 (Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1080. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052259 (Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1081. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029717 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1082. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029717 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1083. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029717 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1084. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029717 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1085. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029720 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1086. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024910 (Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L plasmid pOSUKPC4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1087. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024910 (Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L plasmid pOSUKPC4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1088. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024910 (Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L plasmid pOSUKPC4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1089. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1090. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1091. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1092. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1093. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1094. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1095. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT994837 (Klebsiella pneumoniae isolate CNR132 plasmid CNR132, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1096. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT994839 (Klebsiella pneumoniae isolate CNR95 plasmid CNR95, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1097. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT994834 (Klebsiella pneumoniae isolate CNR3 plasmid CNR3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1098. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT994836 (Klebsiella pneumoniae isolate CNR339 plasmid CNR339, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1099. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT994840 (Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1100. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1101. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN937241 (Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1102. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN937241 (Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1103. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN937241 (Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1104. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN937241 (Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1105. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1106. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1107. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1108. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1109. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1110. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1111. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1112. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1113. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1114. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1115. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1116. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1117. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_004429 (Escherichia coli plasmid pIS2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1118. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_004429 (Escherichia coli plasmid pIS2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1119. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044051 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1120. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044051 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1121. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1122. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT985322 (Escherichia coli strain 727 plasmid RCS55TR727_p, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1123. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT985322 (Escherichia coli strain 727 plasmid RCS55TR727_p, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1124. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT985306 (Escherichia coli strain ECOR 37 plasmid RCS88_p, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1125. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT985306 (Escherichia coli strain ECOR 37 plasmid RCS88_p, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1126. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT985249 (Escherichia coli strain 195 plasmid RCS46_p, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1127. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT985249 (Escherichia coli strain 195 plasmid RCS46_p, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1128. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT985249 (Escherichia coli strain 195 plasmid RCS46_p, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1129. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT985249 (Escherichia coli strain 195 plasmid RCS46_p, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1130. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN604267 (Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1131. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP047634 (Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1132. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1133. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1134. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1135. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1136. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052495 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1137. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK461931 (Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1138. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK461931 (Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1139. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK731977 (Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1140. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1141. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1142. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1143. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1144. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1145. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1146. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1147. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1148. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1149. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MN540571 (Escherichia coli strain E.coli4feg plasmid pIV_IncHI2_CTX_M_15, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1150. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1151. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP025683 (Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1152. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP025683 (Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1153. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH829594 (Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1154. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH829594 (Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1155. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH829594 (Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1156. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH829594 (Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1157. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH829594 (Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1158. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH917279 (Klebsiella pneumoniae strain A1706 plasmid pA1706-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1159. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH287085 (Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1160. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH909349 (Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1161. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH909349 (Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1162. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK079573 (Klebsiella pneumoniae strain LDH4-2 plasmid pHNLDH4-2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1163. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK248692 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29tetA, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1164. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH287084 (Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1165. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1166. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH341574 (Klebsiella pneumoniae strain MYKLB95 plasmid MYKLB95-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1167. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH341574 (Klebsiella pneumoniae strain MYKLB95 plasmid MYKLB95-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1168. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH477636 (Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1169. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1170. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK413720 (Enterobacter cloacae strain 12949 plasmid p12949-HI2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1171. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK413720 (Enterobacter cloacae strain 12949 plasmid p12949-HI2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1172. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK736669 (Enterobacter cloacae strain EclC2185 plasmid pEclC2185CTXM15, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1173. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038858 (Escherichia coli strain PigCaeca_2 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1174. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1175. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MT219826 (Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1176. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MT090959 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1177. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014778 (Pluralibacter gergoviae strain FB2 plasmid pFB2.3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1178. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014778 (Pluralibacter gergoviae strain FB2 plasmid pFB2.3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1179. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014778 (Pluralibacter gergoviae strain FB2 plasmid pFB2.3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1180. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014778 (Pluralibacter gergoviae strain FB2 plasmid pFB2.3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1181. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014778 (Pluralibacter gergoviae strain FB2 plasmid pFB2.3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1182. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014778 (Pluralibacter gergoviae strain FB2 plasmid pFB2.3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1183. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1184. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1185. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1186. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MG557997 (Citrobacter freundii strain Cfr-36808cz plasmid pCfr-36808cz, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1187. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MG904992 (Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1188. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MG904992 (Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence) position: , mismatch: 0, identity: 1.0

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******************************************

1189. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026282 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1190. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018350 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-67, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1191. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018350 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-67, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1192. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1193. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaaaatg	Protospacer
**************************************.***

1194. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KY296104 (Enterobacter cloacae strain 13E169 plasmid pHN84KPC, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1195. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1196. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KX960110 (Escherichia coli strain CREC-TJ2 plasmid pCREC-TJ2-NDM, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1197. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028197 (Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1198. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028197 (Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgctgtcgggaagatg	Protospacer
****************************.*************

1199. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021755 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_4, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1200. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1201. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1202. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011601 (Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1203. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011601 (Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1204. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to KY486279 (Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1205. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028975 (Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1206. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1207. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1208. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1209. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1210. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KX646543 (Shigella boydii strain 2246 plasmid p2246-CTXM, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1211. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1212. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1213. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP035215 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1214. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP035215 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1215. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP035215 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1216. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP035215 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1217. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP035634 (Enterobacter cloacae strain EN3600 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1218. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KJ958926 (Klebsiella pneumoniae strain Kpn-3002cz plasmid pB-3002cz, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1219. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1220. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LN824135 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1221. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1222. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026237 (Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1223. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MT077884 (Escherichia coli plasmid p33, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1224. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MT077888 (Escherichia coli plasmid p65, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1225. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_023314 (Klebsiella pneumoniae plasmid pKPS30, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1226. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1227. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN423361 (Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1228. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044204 (Salmonella enterica subsp. enterica serovar Senftenberg strain AR-0405 plasmid pAR-0405, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1229. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1230. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1231. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1232. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1233. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1234. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1235. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031568 (Enterobacter hormaechei strain 2013_1a plasmid pSHV12-1301491, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1236. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1237. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1238. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040888 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1239. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1240. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038139 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1241. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1242. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1243. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1244. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026272 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1245. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026272 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1246. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1247. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1248. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
tttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
.*****************************************

1249. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1250. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1251. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1252. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008825 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1253. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008825 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1254. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008825 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1255. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008825 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1256. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008825 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1257. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041374 (Klebsiella pneumoniae strain KP58 plasmid pKP58-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1258. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1259. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1260. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP025213 (Klebsiella pneumoniae strain HZW25 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1261. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029037 (Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1262. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045217 (Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1263. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045217 (Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1264. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045217 (Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1265. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045217 (Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1266. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045217 (Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1267. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045217 (Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1268. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045217 (Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1269. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1270. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1271. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052376 (Klebsiella pneumoniae strain D16KP0025 plasmid pD16KP0025-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1272. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_024960 (Escherichia coli plasmid pIS04_68, strain ISO4, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1273. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_024960 (Escherichia coli plasmid pIS04_68, strain ISO4, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1274. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026180 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttactttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
*****.************************************

1275. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttactttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
*****.************************************

1276. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1277. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_010870 (Klebsiella pneumoniae plasmid pK29, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1278. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021547 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000003, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1279. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP043751 (Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1280. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1281. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1282. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP047338 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-50kb, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1283. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021687 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001186, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1284. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021720 (Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1285. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024857 (Escherichia coli strain AR_0011 plasmid tig00001069_pilon, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1286. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024857 (Escherichia coli strain AR_0011 plasmid tig00001069_pilon, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1287. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP043545 (Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1288. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP043545 (Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1289. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1290. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030186 (Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
tttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
.*****************************************

1291. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030066 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1292. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1293. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1294. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgttttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
******.***********************************

1295. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008798 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPC-484, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1296. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1297. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
tttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
.*****************************************

1298. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030224 (Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1299. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP030224 (Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1300. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040730 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed1) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1301. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040731 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed2) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1302. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040731 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed2) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1303. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008899 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-8a4, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1304. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP008906 (Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-08e, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1305. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052547 (Klebsiella pneumoniae strain B16KP0089 plasmid pB16KP0089-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1306. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1307. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttactttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
*****.************************************

1308. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP036447 (Klebsiella pneumoniae strain KPNIH45 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1309. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1310. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1311. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP022155 (Escherichia coli strain ABWA45 plasmid pABWA45_1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1312. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1313. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1314. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1315. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN256759 (Escherichia coli strain 4M9F plasmid p4M9F, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1316. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038275 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-101716, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1317. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP016526 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1318. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031575 (Enterobacter hormaechei strain A1 plasmid pIncHI2-1502264, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1319. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1320. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1321. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1322. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP050163 (Escherichia coli plasmid Carbapenemase(KPC-2)_IncHI2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1323. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1324. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1325. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP046008 (Escherichia coli strain 1919D62 plasmid p1919D62-2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtttgcgttgtcgggaagatg	Protospacer
***********************.******************

1326. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034132 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_81.9Kb, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1327. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP024431 (Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1328. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1329. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1330. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1331. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1332. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1333. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1334. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
tttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
.*****************************************

1335. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1336. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP017452 (Klebsiella sp. LTGPAF-6F plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1337. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1338. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1339. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1340. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1341. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1342. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1343. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP012170 (Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1344. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacagtctgcgttgtcgggaagatg	Protospacer
********************.*********************

1345. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034140 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_84.1Kb, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1346. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1347. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1348. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1349. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1350. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP027150 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed3) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1351. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1352. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1353. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP013215 (Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1354. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052373 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1355. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1356. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1357. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1358. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1359. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1360. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014758 (Klebsiella pneumoniae strain AATZP plasmid pKPN-041, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1361. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP011644 (Klebsiella pneumoniae strain CAV1596 plasmid pCAV1596-41, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1362. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1363. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP027162 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed3) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1364. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1365. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
tttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
.*****************************************

1366. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
tttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
.*****************************************

1367. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1368. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1369. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1370. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1371. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1372. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT883141 (Escherichia coli isolate 6666666.257727.embl plasmid III) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtttgcgttgtcgggaagatg	Protospacer
***********************.******************

1373. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1374. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1375. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1376. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1377. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP035212 (Klebsiella pneumoniae strain TH164 plasmid pTH164-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1378. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1379. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1380. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049193 (Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1381. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049193 (Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
tttttgctttgccacggaacggtctgcgttgtcgggaagatg	Protospacer
.*****************************************

1382. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049193 (Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1383. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052366 (Klebsiella pneumoniae strain D16KP0109 plasmid pD16KP0109-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1384. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044337 (Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1385. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054751 (Klebsiella pneumoniae strain KP20194c3 plasmid pKP20194c3-p1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1386. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054781 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1387. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1388. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1389. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1390. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054763 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1391. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP038456 (Escherichia coli strain EC-129 plasmid pEC129_3) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1392. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP041444 (Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1393. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054745 (Klebsiella pneumoniae strain KP20194c4 plasmid pKP20194c4-p1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1394. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054727 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1395. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054739 (Klebsiella pneumoniae strain KP20194c5 plasmid pKP20194c5-p1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1396. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP044371 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-3, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1397. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054775 (Klebsiella pneumoniae strain KP20194a2 plasmid pKP20194a2-p1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1398. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054733 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1399. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054721 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1400. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054757 (Klebsiella pneumoniae strain KP20194c plasmid pKP20194c-p1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1401. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP054769 (Klebsiella pneumoniae strain KP20194b plasmid pKP20194b-p1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1402. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MH884649 (Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1403. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MH884651 (Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1404. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1405. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1406. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_AP018145 (Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1407. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029717 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1408. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT994837 (Klebsiella pneumoniae isolate CNR132 plasmid CNR132, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1409. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT994839 (Klebsiella pneumoniae isolate CNR95 plasmid CNR95, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1410. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT994836 (Klebsiella pneumoniae isolate CNR339 plasmid CNR339, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1411. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_LT994840 (Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1412. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN937241 (Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1413. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1414. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1415. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MN604267 (Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1416. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK461931 (Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1417. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1418. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1419. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1420. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH829594 (Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1421. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH917279 (Klebsiella pneumoniae strain A1706 plasmid pA1706-NDM, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1422. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH917279 (Klebsiella pneumoniae strain A1706 plasmid pA1706-NDM, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1423. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH909349 (Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1424. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH909349 (Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1425. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH909349 (Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1426. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK079573 (Klebsiella pneumoniae strain LDH4-2 plasmid pHNLDH4-2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1427. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK248692 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29tetA, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1428. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH287084 (Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1429. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH287084 (Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1430. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH287084 (Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1431. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1432. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH477636 (Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1433. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH477636 (Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1434. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1435. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MK413720 (Enterobacter cloacae strain 12949 plasmid p12949-HI2, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1436. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MT219826 (Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1437. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MT219826 (Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1438. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to MT090959 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_KPC, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaagata	Protospacer
*****************************************.

1439. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP014778 (Pluralibacter gergoviae strain FB2 plasmid pFB2.3, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgcgttgtcgggaaaatg	Protospacer
**************************************.***

1440. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_MG557997 (Citrobacter freundii strain Cfr-36808cz plasmid pCfr-36808cz, complete sequence) position: , mismatch: 1, identity: 0.976

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaatggtctgcgttgtcgggaagatg	Protospacer
*******************.**********************

1441. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_KY751925 (Klebsiella pneumoniae strain M16-13 plasmid pM16-13, complete sequence) position: , mismatch: 2, identity: 0.952

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccatggaatggtctgcgttgtcgggaagatg	Protospacer
**************.****.**********************

1442. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.952

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgtgttgtcgggaggatg	Protospacer
**************************.**********.****

1443. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.952

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgtgttgtcgggaggatg	Protospacer
**************************.**********.****

1444. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029140 (Klebsiella michiganensis strain AR375 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.952

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgtgttgtcgggaggatg	Protospacer
**************************.**********.****

1445. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP029140 (Klebsiella michiganensis strain AR375 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.952

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgtgttgtcgggaggatg	Protospacer
**************************.**********.****

1446. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to NZ_CP034679 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_83kb, complete sequence) position: , mismatch: 2, identity: 0.952

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgtgttgtcgggaggatg	Protospacer
**************************.**********.****

1447. spacer 1.1|241815|42|NZ_CP008825|CRISPRCasFinder matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 2, identity: 0.952

cttttgctttgccacggaacggtctgcgttgtcgggaagatg	CRISPR spacer
cttttgctttgccacggaacggtctgtgttgtcgggaggatg	Protospacer
**************************.**********.****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7094 : 64576 47 Escherichia_phage(62.5%) integrase,transposase NA
DBSCAN-SWA_2 75916 : 179992 116 Escherichia_phage(21.62%) integrase,protease,transposase attL 102439:102458|attR 142428:143247
DBSCAN-SWA_3 223147 : 271562 55 Escherichia_phage(35.71%) transposase NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP008825.1|WP_123906519.1|94859_95042_+|hypothetical-protein 94859_95042_+ 60 aa aa NA NA NA 75916-179992 yes
NZ_CP008825.1|WP_000340139.1|95022_95520_+|membrane-protein 95022_95520_+ 165 aa aa NA NA NA 75916-179992 yes
3. NZ_CP008824
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 22947 : 95346 89 Escherichia_phage(14.29%) protease,integrase,transposase attL 53224:53241|attR 60408:60425
DBSCAN-SWA_2 139503 : 176011 26 Escherichia_phage(20.0%) integrase,transposase attL 133262:133275|attR 145679:145692
DBSCAN-SWA_3 191599 : 225874 32 Escherichia_phage(35.29%) integrase,transposase attL 204196:204210|attR 237968:237982
DBSCAN-SWA_4 251027 : 302552 55 Escherichia_phage(44.0%) integrase,transposase attL 291813:291828|attR 304684:304699
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage