1. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
2. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
3. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
4. spacer 4.15|1573064|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
5. spacer 4.15|1573064|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
6. spacer 4.15|1573064|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
7. spacer 4.15|1573064|22|NZ_CP002885|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
8. spacer 13.15|3951454|21|NZ_CP002885|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 1, identity: 0.952
agcggccggagccggcggggc CRISPR spacer
agcggccgtagccggcggggc Protospacer
******** ************
9. spacer 13.15|3951454|21|NZ_CP002885|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 1, identity: 0.952
agcggccggagccggcggggc CRISPR spacer
agcggccggagccggctgggc Protospacer
**************** ****
10. spacer 13.15|3951454|21|NZ_CP002885|CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 1, identity: 0.952
agcggccggagccggcggggc CRISPR spacer
agcggccggagcaggcggggc Protospacer
************ ********
11. spacer 13.15|3951454|21|NZ_CP002885|CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 1, identity: 0.952
agcggccggagccggcggggc CRISPR spacer
agcggccggagcaggcggggc Protospacer
************ ********
12. spacer 13.15|3951454|21|NZ_CP002885|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
agcggccggagccggcggggc CRISPR spacer
agcggccggagccgccggggc Protospacer
************** ******
13. spacer 13.15|3951454|21|NZ_CP002885|CRT matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 1, identity: 0.952
agcggccggagccggcggggc CRISPR spacer
agcggccggagacggcggggc Protospacer
*********** *********
14. spacer 13.15|3951454|21|NZ_CP002885|CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 1, identity: 0.952
agcggccggagccggcggggc CRISPR spacer
agcggccggagcctgcggggc Protospacer
************* *******
15. spacer 4.2|1572137|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
16. spacer 4.2|1572137|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
17. spacer 4.2|1572137|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
18. spacer 4.2|1572137|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
19. spacer 4.2|1572137|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
20. spacer 4.3|1572191|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
21. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
22. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
23. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
24. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
25. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
26. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
27. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
28. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
29. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
30. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
31. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
32. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
33. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
34. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
35. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
36. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
37. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
38. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
39. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
40. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
41. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
42. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
43. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
44. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
45. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
46. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
47. spacer 1.11|332485|27|NZ_CP002885|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
48. spacer 1.11|332485|27|NZ_CP002885|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
49. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
50. spacer 4.4|1572245|22|NZ_CP002885|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
51. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
52. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
53. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
54. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
55. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
56. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
57. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
58. spacer 4.15|1573064|22|NZ_CP002885|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864
caatccggcggcgccgccggca CRISPR spacer
gaatccggcggcgccgccgggc Protospacer
*******************
59. spacer 5.2|1618699|24|NZ_CP002885|PILER-CR matches to MK737944 (Microbacterium phage Warren, complete genome) position: , mismatch: 3, identity: 0.875
ttgccgaacagccggccaccagcc CRISPR spacer
gtgccgaacagccgggcacctgcc Protospacer
************** **** ***
60. spacer 5.2|1618699|24|NZ_CP002885|PILER-CR matches to MH153799 (Microbacterium phage Appa, complete genome) position: , mismatch: 3, identity: 0.875
ttgccgaacagccggccaccagcc CRISPR spacer
gtgccgaacagccgggcacctgcc Protospacer
************** **** ***
61. spacer 5.2|1618699|24|NZ_CP002885|PILER-CR matches to MK937602 (Microbacterium phage Sinatra, complete genome) position: , mismatch: 3, identity: 0.875
ttgccgaacagccggccaccagcc CRISPR spacer
ttgccgaacagccagccagcagcg Protospacer
*************.**** ****
62. spacer 6.5|2072234|24|NZ_CP002885|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
63. spacer 6.5|2072234|24|NZ_CP002885|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
64. spacer 2.1|364906|27|NZ_CP002885|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
65. spacer 2.1|364906|27|NZ_CP002885|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
66. spacer 2.7|365302|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
67. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
68. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
69. spacer 4.1|1572077|28|NZ_CP002885|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
70. spacer 4.1|1572077|28|NZ_CP002885|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
71. spacer 4.1|1572077|28|NZ_CP002885|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
72. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
73. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
74. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
75. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
76. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
77. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
78. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
79. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
80. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
81. spacer 4.14|1573007|25|NZ_CP002885|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgccaccgacccccccttgc CRISPR spacer
ttttccgacaccgacccccccttga Protospacer
.** *** ****************
82. spacer 5.2|1618699|24|NZ_CP002885|PILER-CR matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
ttgccgaacagccggccaccagcc CRISPR spacer
tgatcgaacagccggccaccagca Protospacer
* ..*******************
83. spacer 6.5|2072234|24|NZ_CP002885|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
84. spacer 6.5|2072234|24|NZ_CP002885|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
85. spacer 6.5|2072234|24|NZ_CP002885|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
86. spacer 1.2|332005|27|NZ_CP002885|CRT matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 5, identity: 0.815
ccggcgcctagagcgttggcaccgctg CRISPR spacer
ctcgggcctagagcgttggcaccgtgg Protospacer
*. * *******************. *
87. spacer 1.11|332485|27|NZ_CP002885|CRT matches to MK415400 (Phage apr34_1784, complete genome) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
ccgccgttggcgaccagtccgcaatca Protospacer
************* ******** .*..
88. spacer 1.11|332485|27|NZ_CP002885|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gggtcgtcggagaacagtccgccgttg Protospacer
*.***.** ****************
89. spacer 1.11|332485|27|NZ_CP002885|CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gtggcgttgtcgaacagaccgccgttg Protospacer
.* ***** ******* *********
90. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggtcaccgccagcggggccagga Protospacer
********* ************ ***. *.
91. spacer 1.12|332530|30|NZ_CP002885|CRT matches to KM389325 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccgatccagacaccgccagcggcgccgagg Protospacer
***..* .******************* **
92. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcg-ccgtgg CRISPR spacer
ccggccgggacaccgcccccggcgagcgcg- Protospacer
***************** ***** **.*
93. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
94. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
95. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
96. spacer 2.1|364906|27|NZ_CP002885|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
97. spacer 2.1|364906|27|NZ_CP002885|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
98. spacer 2.7|365302|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
99. spacer 2.7|365302|27|NZ_CP002885|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
100. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
101. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
102. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
103. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
104. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
105. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
106. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
107. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
108. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
109. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
110. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
111. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
112. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
113. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
114. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
115. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
116. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
117. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
118. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
119. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
120. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
121. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
122. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
123. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
124. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
125. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
126. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
127. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
128. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
129. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
130. spacer 4.1|1572077|28|NZ_CP002885|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
131. spacer 4.1|1572077|28|NZ_CP002885|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
132. spacer 4.1|1572077|28|NZ_CP002885|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
133. spacer 4.1|1572077|28|NZ_CP002885|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
134. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
135. spacer 4.5|1572299|25|NZ_CP002885|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
136. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
137. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
138. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
139. spacer 4.13|1572941|34|NZ_CP002885|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853
gtcgccgtgcagccagccaccaccgcca-ccggcg CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc- Protospacer
*************.********* *** ** **
140. spacer 5.2|1618699|24|NZ_CP002885|PILER-CR matches to NZ_CP022671 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR6, complete sequence) position: , mismatch: 5, identity: 0.792
ttgccgaacagccggccaccagcc CRISPR spacer
ggatcgaacagccggccaccagca Protospacer
..*******************
141. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP054842 (Acidovorax sp. 16-35-5 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.833
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ccgcatcggtgccggcggcaccatcggcac Protospacer
. *** ***************** **** *
142. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to JX403939 (Pseudomonas phage YMC/01/01/P52_PAE_BP, complete genome) position: , mismatch: 5, identity: 0.833
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
cggcagcggtgccggcggcaccaatttctc Protospacer
..**********************. ***
143. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to KU310943 (Pseudomonas phage YMC11/07/P54_PAE_BP, complete genome) position: , mismatch: 5, identity: 0.833
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
cggcagcggtgccggcggcaccaatttctc Protospacer
..**********************. ***
144. spacer 13.12|3951244|36|NZ_CP002885|CRT matches to MH727545 (Mycobacterium phage DismalStressor, complete genome) position: , mismatch: 5, identity: 0.861
cgaccagcccggcgccaccggcggcaccgggttcgc-- CRISPR spacer
cgaccagcccggcgccgccgacggca--gggttggcct Protospacer
****************.***.***** ***** **
145. spacer 13.12|3951244|36|NZ_CP002885|CRT matches to KX688047 (Mycobacterium phage Marcoliusprime, complete genome) position: , mismatch: 5, identity: 0.861
cgaccagcccggcgccaccggcggcaccgggttcgc-- CRISPR spacer
cgaccagcccggcgccgccgacggca--gggttggcct Protospacer
****************.***.***** ***** **
146. spacer 13.12|3951244|36|NZ_CP002885|CRT matches to NC_028759 (Mycobacterium phage Mufasa, complete genome) position: , mismatch: 5, identity: 0.861
cgaccagcccggcgccaccggcggcaccgggttcgc-- CRISPR spacer
cgaccagcccggcgccgccgacggca--gggttggcct Protospacer
****************.***.***** ***** **
147. spacer 13.12|3951244|36|NZ_CP002885|CRT matches to MF140408 (Mycobacterium phage DismalFunk, complete genome) position: , mismatch: 5, identity: 0.861
cgaccagcccggcgccaccggcggcaccgggttcgc-- CRISPR spacer
cgaccagcccggcgccgccgacggca--gggttggcct Protospacer
****************.***.***** ***** **
148. spacer 1.3|332050|30|NZ_CP002885|CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
tcagcggagccgaagatcacgccgccgagc Protospacer
.*.************* ** ******* *
149. spacer 1.12|332530|30|NZ_CP002885|CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggacaccggcatcggcgaaggcg Protospacer
*************** ** ***** * *
150. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg---- CRISPR spacer
ccagccgggagaccgccagcggc----tggctct Protospacer
**.******* ************ ***
151. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 6, identity: 0.8
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
agatggcc--gacaccaccagcggcgccgtgc Protospacer
.**** ******.**************
152. spacer 2.1|364906|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
153. spacer 2.6|365236|33|NZ_CP002885|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
154. spacer 2.7|365302|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
155. spacer 2.9|365452|27|NZ_CP002885|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
156. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
157. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
158. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
159. spacer 2.10|365512|27|NZ_CP002885|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
160. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
161. spacer 4.1|1572077|28|NZ_CP002885|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
162. spacer 4.1|1572077|28|NZ_CP002885|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
163. spacer 4.1|1572077|28|NZ_CP002885|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
164. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
165. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
166. spacer 4.13|1572941|34|NZ_CP002885|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824
--gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca Protospacer
****.* ***** ******************.
167. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NC_006552 (Pseudomonas phage F116, complete genome) position: , mismatch: 6, identity: 0.8
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
gggcagcggtgccggcggcaccagtttctc Protospacer
.*********************.. ***
168. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to KC900378 (Pseudomonas phage LKA5, complete genome) position: , mismatch: 6, identity: 0.8
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
gggcagcggtgccggcggcaccagtttctc Protospacer
.*********************.. ***
169. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to AY625898 (Pseudomonas aeruginosa phage F116, complete genome) position: , mismatch: 6, identity: 0.8
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
gggcagcggtgccggcggcaccagtttctc Protospacer
.*********************.. ***
170. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NC_042342 (Pseudomonas virus H66, complete genome) position: , mismatch: 6, identity: 0.8
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
cggcagcggtgccggcggcaccagcttatc Protospacer
..*********************.* **
171. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NC_010683 (Ralstonia pickettii 12J plasmid pRPIC01, complete sequence) position: , mismatch: 6, identity: 0.8
tagcagcggtgccggcggcaccaacggctc- CRISPR spacer
gtacagcggcgccggcggcaccaa-ggcgca Protospacer
.******.************** *** *
172. spacer 1.3|332050|30|NZ_CP002885|CRT matches to MK460246 (Mycobacterium phage Nibb, complete genome) position: , mismatch: 7, identity: 0.767
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
ccggcgaagccgaagcgcaagccgaaacgc Protospacer
******.******** ******** .. *
173. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcgcgaaca Protospacer
******.******** ********* . .
174. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ttggcccggtcaccgccagcggcgccgcca Protospacer
..**** ** *****************. .
175. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
cgggccggaacaccgccagcggcgtgaggc Protospacer
* ******.***************. . *
176. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcctatgactccgccagcggcgccgtgc Protospacer
.** *.. *** *****************
177. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacaccga Protospacer
******.*************.**.* .*.
178. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
179. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
180. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
181. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
acggccgggtcatcgccagcggcgaaccgg Protospacer
******** **.*********** .**
182. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
accgcatcgaccccgccagcggcgccgtga Protospacer
* ** *** *****************.
183. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
184. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
185. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NC_021279 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
186. spacer 2.4|365101|27|NZ_CP002885|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
187. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
188. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
189. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
190. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
191. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
192. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
193. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
194. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
195. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
196. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
197. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
198. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
199. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
200. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
201. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
202. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
203. spacer 4.1|1572077|28|NZ_CP002885|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
204. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
205. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
206. spacer 6.3|2072144|30|NZ_CP002885|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
207. spacer 6.3|2072144|30|NZ_CP002885|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
208. spacer 6.3|2072144|30|NZ_CP002885|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
209. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ttgagatccgcgacgatgggtgtggcgccggc Protospacer
** .********.**** ***********
210. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.781
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ttcccgcaggcgacggtgcgggcggcgccggc Protospacer
**..* * ********* ***.*********
211. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
212. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
213. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
214. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
215. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
216. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
217. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
218. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
219. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
220. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
221. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
222. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
223. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
224. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
225. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
226. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
227. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
228. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
229. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
230. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
231. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
232. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
233. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
234. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
235. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
236. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
237. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
238. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
239. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
240. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
241. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
242. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
243. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
244. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
245. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
246. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
247. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
248. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
249. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
250. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
251. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
252. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
253. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
254. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
255. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
256. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
257. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
258. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
259. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
260. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
261. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
262. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
263. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
264. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
265. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
266. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
267. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
268. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
269. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
270. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
271. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ggtcagcgatgccggcggcatcaacggcca Protospacer
. *****.***********.*******.
272. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to MN369748 (Mycobacterium phage Miko, complete genome) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
cggcggcggtgccggcggcaacaacgccaa Protospacer
..**.*************** ***** *
273. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to MF185727 (Mycobacterium phage BobSwaget, complete genome) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
cggcggcggtgccggcggcaacaacgccaa Protospacer
..**.*************** ***** *
274. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to MK801735 (Mycobacterium Phage Rachaly, complete genome) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
cggcggcggtgccggcggcaacaacgccaa Protospacer
..**.*************** ***** *
275. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to MF324899 (Mycobacterium phage Lokk, complete genome) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
cggcggcggtgccggcggcaacaacgccaa Protospacer
..**.*************** ***** *
276. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NC_015146 (Pseudarthrobacter phenanthrenivorans Sphe3 plasmid pASPHE301, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
caccggcggtgccgacggcacctacggcca Protospacer
.* *.*********.******* *****.
277. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
gcgaaccggtgccggcggcaccacccgctg Protospacer
* * ***************** * ***
278. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to LT603684 (Pseudomonas phage phiC725A genome assembly) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
cggcagaggtgccggcggcaccagtttctc Protospacer
..**** ****************.. ***
279. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
gatcatcggtgccggcggcaccatcgccat Protospacer
* ** ***************** ** * .
280. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to MF975720 (Pseudomonas phage VW-6S, complete genome) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
ccgccgcggcgccggcggcaccaactacac Protospacer
. ** ****.*************** .* *
281. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to KM389247 (UNVERIFIED: Pseudomonas phage JBD90 clone contig00001 genomic sequence) position: , mismatch: 7, identity: 0.767
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
cggcagaggtgccggcggcaccagtttctc Protospacer
..**** ****************.. ***
282. spacer 1.3|332050|30|NZ_CP002885|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 8, identity: 0.733
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
agcacgaagccgaagagaaagccgccgatg Protospacer
.**.********** ********* *
283. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcaccctggacaccgcctgcggcgccggac Protospacer
.*. ** ********** ********* .
284. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcacgaaca Protospacer
******.******** *******.* . .
285. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcggtcgacaccgccagcggcgacgtga Protospacer
.** **************** ****.
286. spacer 1.12|332530|30|NZ_CP002885|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcg----gcgccgtgg CRISPR spacer
agggccgggacaccgcccgcggccagcgct---- Protospacer
*************** *** ****.
287. spacer 2.6|365236|33|NZ_CP002885|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
288. spacer 2.6|365236|33|NZ_CP002885|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
289. spacer 2.6|365236|33|NZ_CP002885|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
290. spacer 2.6|365236|33|NZ_CP002885|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
291. spacer 2.6|365236|33|NZ_CP002885|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
292. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
293. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
294. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
295. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
296. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
297. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
298. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
299. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
300. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
301. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
302. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
303. spacer 6.3|2072144|30|NZ_CP002885|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
304. spacer 6.3|2072144|30|NZ_CP002885|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
305. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.75
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agcgcggccgcgtcggtgggggtggcgcccgc Protospacer
. * ***** **************** **
306. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 8, identity: 0.75
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcaccaccgcggcggtgcgggtggcgccggc Protospacer
. . *. *****.***** *************
307. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 8, identity: 0.733
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
cctcagcggtgccggcagcaccaacatcga Protospacer
. *************.********. *
308. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NC_008203 (Mycobacterium phage Che12, complete genome) position: , mismatch: 8, identity: 0.733
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
tgcgggcggtgccggcggaaacaacggcgg Protospacer
*. .************* * *******
309. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to MH142220 (UNVERIFIED: Acidithiobacillus phage AcaML1 strain BC13 genomic sequence) position: , mismatch: 8, identity: 0.733
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
attcctgggtgccggcggcagctacggctc Protospacer
* ************* * *******
310. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to MH142219 (UNVERIFIED: Acidithiobacillus phage AcaML1 strain F genomic sequence) position: , mismatch: 8, identity: 0.733
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
attcctgggtgccggcggcagctacggctc Protospacer
* ************* * *******
311. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to DQ398043 (Mycobacterium virus Che12, complete genome) position: , mismatch: 8, identity: 0.733
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
tgcgggcggtgccggcggaaacaacggcgg Protospacer
*. .************* * *******
312. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to JX507079 (Acidithiobacillus phage AcaML1, complete genome) position: , mismatch: 8, identity: 0.733
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
attcctgggtgccggcggcagctacggctc Protospacer
* ************* * *******
313. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP041158 (Leisingera aquaemixtae strain R2C4 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
aggcagcggtcccggcggcaccatcacccg Protospacer
.******** ************ *. *.
314. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
cgaccgcggtgccggcggcatccacggcgg Protospacer
...* ***************.* *****
315. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 8, identity: 0.733
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
cagcagcggcgccggcggcaccggggcgac Protospacer
.********.************.. * *
316. spacer 13.8|3950926|39|NZ_CP002885|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.795
tgacggcggcaccggcggagcggccggagccggcggggc CRISPR spacer
tcccggtaaccccggcggagcgggcggagccggcggcgc Protospacer
* ***...* ************ ************ **
317. spacer 13.12|3951244|36|NZ_CP002885|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 8, identity: 0.778
cgaccagcccggcgccaccggcggcaccgggttcgc CRISPR spacer
cgacctgcccggccccaccggcggcatcctgctcaa Protospacer
***** ******* ************.* *.**.
318. spacer 1.13|332578|39|NZ_CP002885|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.769
--ccgaagagcaaaccggcgtcgccgccgcgcccgccggcc CRISPR spacer
ggccggcgg--aaaccggcgtcgccgcggcggccgccggag Protospacer
***. *. **************** *** *******
319. spacer 2.6|365236|33|NZ_CP002885|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
320. spacer 2.6|365236|33|NZ_CP002885|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
321. spacer 2.6|365236|33|NZ_CP002885|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
322. spacer 2.6|365236|33|NZ_CP002885|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
323. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
324. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
325. spacer 3.1|690318|31|NZ_CP002885|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
326. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
327. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
328. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
329. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
330. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
331. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
332. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
333. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
334. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
335. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
336. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gcccccggcgtgacggtggaggtggcgccggc Protospacer
...*. **.********.************
337. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
338. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc Protospacer
... *. * ******* ** ************
339. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc Protospacer
... *. * ******* ** ************
340. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gtggcggtggcggcggtgggggtggcggcggc Protospacer
* * . ***.************** ****
341. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
tgcgaccgggcgacggtggaggtggcgccagc Protospacer
* . .* **********.*********.**
342. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to NZ_CP005086 (Sphingobium sp. TKS plasmid pTK2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
caacattcagcgacggtgggtgtggcggcggc Protospacer
. . *.* *********** ****** ****
343. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to MH271296 (Gordonia phage Emperor, complete genome) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcacgacggcggcggtgcgggtggcgccggc Protospacer
. . * * ***.***** *************
344. spacer 13.2|3950485|30|NZ_CP002885|CRT matches to NZ_CP013632 (Rhizobium sp. N324 plasmid pRspN324b, complete sequence) position: , mismatch: 9, identity: 0.7
tagcagcggtgccggcggcaccaacggctc CRISPR spacer
cgttttcgatgccggcggcgccaacggctt Protospacer
.. . **.**********.*********.
345. spacer 2.6|365236|33|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
346. spacer 2.6|365236|33|NZ_CP002885|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
347. spacer 2.6|365236|33|NZ_CP002885|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
348. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
349. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
350. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
351. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
352. spacer 4.10|1572692|31|NZ_CP002885|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
353. spacer 4.13|1572941|34|NZ_CP002885|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca Protospacer
. .. .*******.***************.**.
354. spacer 8.9|3111484|35|NZ_CP002885|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
355. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
aggacggccgcggcggtggcggtggcgccgta Protospacer
* *****.****** **********
356. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ctgctggccgcgacggtgctggtggcgccgat Protospacer
.* .. *********** **********..
357. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
tcgcggatcgggatggtgggggtggcgccgga Protospacer
*. . .** **.*****************
358. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gcgagggcggcgacggtgggcgtgtcgccggc Protospacer
. * *********** *** *******
359. spacer 10.6|3739457|32|NZ_CP002885|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcagcagcgcgacggtgtcggtggcgccggt Protospacer
. . . ********** ***********.
360. spacer 13.21|3951874|48|NZ_CP002885|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.771
caccggcggcagcggcggggccggcggtagcggcggggccaacttcaa CRISPR spacer
ctcgggcggcaacggcggggccggcggtagcggcggcgcaggcgcctt Protospacer
* * *******.************************ ** ..* .*
361. spacer 13.8|3950926|39|NZ_CP002885|CRT matches to NZ_CP045296 (Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence) position: , mismatch: 12, identity: 0.692
tgacggcggcaccggcggagcggccggagccggcggggc CRISPR spacer
gcagatcggcaccggagcagcggccggagccggcttctt Protospacer
* . ********* * **************** .