Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_022873 Bacillus thuringiensis YBT-1518, complete sequence 10 crisprs RT,cas3,csa3,WYL,DinG,DEDDh,c2c9_V-U4,cas14j 5 30 16 1
NC_022876 Bacillus thuringiensis YBT-1518 plasmid pBMB0231, complete sequence 0 crisprs Cas14u_CAS-V,cas14j 0 0 7 0
NC_022875 Bacillus thuringiensis YBT-1518 plasmid pBMB0230, complete sequence 0 crisprs RT,csa3 0 0 5 0
NC_022874 Bacillus thuringiensis YBT-1518 plasmid pBMB0229, complete sequence 0 crisprs csa3 0 0 1 0
NC_022877 Bacillus thuringiensis YBT-1518 plasmid pBMB0232, complete sequence 0 crisprs csa3,RT 0 0 1 0
NC_020124 Bacillus thuringiensis YBT-1518 plasmid pBMB0228, complete sequence 0 crisprs NA 0 0 0 0
NC_022882 Bacillus thuringiensis YBT-1518 plasmid pBMB0233, complete sequence 1 crisprs cas14j,RT,Cas14u_CAS-V 4 4 3 0

Results visualization

1. NC_022873
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022873_1 1339998-1340113 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022873_2 3528808-3528880 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022873_3 3583799-3583870 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022873_6 3584591-3584670 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022873_4 3584069-3584203 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022873_5 3584285-3584422 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022873_7 4026874-4027872 Orphan NA
23 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022873_8 5518603-5519286 Orphan NA
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022873_9 5781904-5782037 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022873_10 5798440-5798548 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_022873_3 3.1|3583825|19|NC_022873|CRISPRCasFinder 3583825-3583843 19 NC_022873.1 2894094-2894112 1 0.947
NC_022873_4 4.1|3584095|19|NC_022873|CRISPRCasFinder 3584095-3584113 19 NC_022873.1 5108636-5108654 2 0.895
NC_022873_7 7.17|4027558|18|NC_022873|CRT 4027558-4027575 18 NC_022873.1 2893730-2893747 1 0.944
NC_022873_8 8.14|5519206|18|NC_022873|CRT 5519206-5519223 18 NC_022873.1 3581138-3581155 0 1.0
NC_022873_8 8.14|5519206|18|NC_022873|CRT 5519206-5519223 18 NC_022873.1 4623682-4623699 0 1.0
NC_022873_8 8.14|5519206|18|NC_022873|CRT 5519206-5519223 18 NC_022873.1 4623772-4623789 0 1.0
NC_022873_8 8.14|5519206|18|NC_022873|CRT 5519206-5519223 18 NC_022873.1 4623862-4623879 0 1.0
NC_022873_8 8.14|5519206|18|NC_022873|CRT 5519206-5519223 18 NC_022873.1 4623997-4624014 0 1.0
NC_022873_8 8.14|5519206|18|NC_022873|CRT 5519206-5519223 18 NC_022873.1 4624087-4624104 0 1.0
NC_022873_8 8.14|5519206|18|NC_022873|CRT 5519206-5519223 18 NC_022873.1 4900016-4900033 0 1.0
NC_022873_8 8.14|5519206|18|NC_022873|CRT 5519206-5519223 18 NC_022873.1 5316743-5316760 0 1.0
NC_022873_8 8.14|5519206|18|NC_022873|CRT 5519206-5519223 18 NC_022873.1 5518585-5518602 0 1.0
NC_022873_8 8.14|5519206|18|NC_022873|CRT 5519206-5519223 18 NC_022873.1 3581876-3581893 1 0.944
NC_022873_8 8.14|5519206|18|NC_022873|CRT 5519206-5519223 18 NC_022873.1 4623592-4623609 1 0.944
NC_022873_8 8.14|5519206|18|NC_022873|CRT 5519206-5519223 18 NC_022873.1 4623637-4623654 1 0.944
NC_022873_8 8.14|5519206|18|NC_022873|CRT 5519206-5519223 18 NC_022873.1 4623952-4623969 1 0.944
NC_022873_8 8.14|5519206|18|NC_022873|CRT 5519206-5519223 18 NC_022873.1 5316878-5316895 1 0.944
NC_022873_8 8.14|5519206|18|NC_022873|CRT 5519206-5519223 18 NC_022873.1 5519296-5519313 1 0.944
NC_022873_10 10.1|5798465|59|NC_022873|CRISPRCasFinder 5798465-5798523 59 NC_022873.1 5798567-5798625 1 0.983

1. spacer 3.1|3583825|19|NC_022873|CRISPRCasFinder matches to position: 2894094-2894112, mismatch: 1, identity: 0.947

ttccttgcactccttgaga	CRISPR spacer
ttccttgcacaccttgaga	Protospacer
********** ********

2. spacer 4.1|3584095|19|NC_022873|CRISPRCasFinder matches to position: 5108636-5108654, mismatch: 2, identity: 0.895

caccttgaataccttgaat	CRISPR spacer
caccttgaattccctgaat	Protospacer
********** **.*****

3. spacer 7.17|4027558|18|NC_022873|CRT matches to position: 2893730-2893747, mismatch: 1, identity: 0.944

tggacctcaaggcgttca	CRISPR spacer
tggacctcaaggagttca	Protospacer
************ *****

4. spacer 8.14|5519206|18|NC_022873|CRT matches to position: 3581138-3581155, mismatch: 0, identity: 1.0

gttgctcccgttggaccc	CRISPR spacer
gttgctcccgttggaccc	Protospacer
******************

5. spacer 8.14|5519206|18|NC_022873|CRT matches to position: 4623682-4623699, mismatch: 0, identity: 1.0

gttgctcccgttggaccc	CRISPR spacer
gttgctcccgttggaccc	Protospacer
******************

6. spacer 8.14|5519206|18|NC_022873|CRT matches to position: 4623772-4623789, mismatch: 0, identity: 1.0

gttgctcccgttggaccc	CRISPR spacer
gttgctcccgttggaccc	Protospacer
******************

7. spacer 8.14|5519206|18|NC_022873|CRT matches to position: 4623862-4623879, mismatch: 0, identity: 1.0

gttgctcccgttggaccc	CRISPR spacer
gttgctcccgttggaccc	Protospacer
******************

8. spacer 8.14|5519206|18|NC_022873|CRT matches to position: 4623997-4624014, mismatch: 0, identity: 1.0

gttgctcccgttggaccc	CRISPR spacer
gttgctcccgttggaccc	Protospacer
******************

9. spacer 8.14|5519206|18|NC_022873|CRT matches to position: 4624087-4624104, mismatch: 0, identity: 1.0

gttgctcccgttggaccc	CRISPR spacer
gttgctcccgttggaccc	Protospacer
******************

10. spacer 8.14|5519206|18|NC_022873|CRT matches to position: 4900016-4900033, mismatch: 0, identity: 1.0

gttgctcccgttggaccc	CRISPR spacer
gttgctcccgttggaccc	Protospacer
******************

11. spacer 8.14|5519206|18|NC_022873|CRT matches to position: 5316743-5316760, mismatch: 0, identity: 1.0

gttgctcccgttggaccc	CRISPR spacer
gttgctcccgttggaccc	Protospacer
******************

12. spacer 8.14|5519206|18|NC_022873|CRT matches to position: 5518585-5518602, mismatch: 0, identity: 1.0

gttgctcccgttggaccc	CRISPR spacer
gttgctcccgttggaccc	Protospacer
******************

13. spacer 8.14|5519206|18|NC_022873|CRT matches to position: 3581876-3581893, mismatch: 1, identity: 0.944

gttgctcccgttggaccc	CRISPR spacer
gttgctcctgttggaccc	Protospacer
********.*********

14. spacer 8.14|5519206|18|NC_022873|CRT matches to position: 4623592-4623609, mismatch: 1, identity: 0.944

gttgctcccgttggaccc	CRISPR spacer
gttgcccccgttggaccc	Protospacer
*****.************

15. spacer 8.14|5519206|18|NC_022873|CRT matches to position: 4623637-4623654, mismatch: 1, identity: 0.944

gttgctcccgttggaccc	CRISPR spacer
gttgctcctgttggaccc	Protospacer
********.*********

16. spacer 8.14|5519206|18|NC_022873|CRT matches to position: 4623952-4623969, mismatch: 1, identity: 0.944

gttgctcccgttggaccc	CRISPR spacer
gttgctcctgttggaccc	Protospacer
********.*********

17. spacer 8.14|5519206|18|NC_022873|CRT matches to position: 5316878-5316895, mismatch: 1, identity: 0.944

gttgctcccgttggaccc	CRISPR spacer
gttgctcctgttggaccc	Protospacer
********.*********

18. spacer 8.14|5519206|18|NC_022873|CRT matches to position: 5519296-5519313, mismatch: 1, identity: 0.944

gttgctcccgttggaccc	CRISPR spacer
gttgctcctgttggaccc	Protospacer
********.*********

19. spacer 10.1|5798465|59|NC_022873|CRISPRCasFinder matches to position: 5798567-5798625, mismatch: 1, identity: 0.983

gctgccttcgccttggctttcgctttttcttcttccgttacttcttctgttccttctct	CRISPR spacer
gccgccttcgccttggctttcgctttttcttcttccgttacttcttctgttccttctct	Protospacer
**.********************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_022873_4 4.1|3584095|19|NC_022873|CRISPRCasFinder 3584095-3584113 19 MN689516 Lactococcus phage CHPC148, complete genome 18112-18130 0 1.0
NC_022873_4 4.1|3584095|19|NC_022873|CRISPRCasFinder 3584095-3584113 19 NC_004746 Lactococcus phage 4268, complete genome 31982-32000 0 1.0
NC_022873_4 4.1|3584095|19|NC_022873|CRISPRCasFinder 3584095-3584113 19 MN689530 Lactococcus phage CHPC974, partial genome 16223-16241 0 1.0
NC_022873_4 4.1|3584095|19|NC_022873|CRISPRCasFinder 3584095-3584113 19 AJ245616 Lactococcus lactis phage BK5-T complete genome 11689-11707 0 1.0
NC_022873_4 4.1|3584095|19|NC_022873|CRISPRCasFinder 3584095-3584113 19 AF176025 Lactococcus phage BK5-T, complete genome 11689-11707 0 1.0
NC_022873_4 4.1|3584095|19|NC_022873|CRISPRCasFinder 3584095-3584113 19 GU075905 Prochlorococcus phage P-HM2, complete genome 71396-71414 0 1.0
NC_022873_4 4.1|3584095|19|NC_022873|CRISPRCasFinder 3584095-3584113 19 AF489521 Lactococcus bacteriophage 4268, complete genome 31982-32000 0 1.0
NC_022873_5 5.2|3584374|22|NC_022873|CRISPRCasFinder 3584374-3584395 22 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 125328-125349 0 1.0
NC_022873_5 5.2|3584374|22|NC_022873|CRISPRCasFinder 3584374-3584395 22 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 125385-125406 0 1.0
NC_022873_5 5.2|3584374|22|NC_022873|CRISPRCasFinder 3584374-3584395 22 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 125460-125481 0 1.0
NC_022873_5 5.2|3584374|22|NC_022873|CRISPRCasFinder 3584374-3584395 22 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 125517-125538 0 1.0
NC_022873_5 5.2|3584374|22|NC_022873|CRISPRCasFinder 3584374-3584395 22 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 125574-125595 0 1.0
NC_022873_5 5.2|3584374|22|NC_022873|CRISPRCasFinder 3584374-3584395 22 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 125631-125652 0 1.0
NC_022873_5 5.2|3584374|22|NC_022873|CRISPRCasFinder 3584374-3584395 22 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 125688-125709 0 1.0
NC_022873_5 5.2|3584374|22|NC_022873|CRISPRCasFinder 3584374-3584395 22 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 125745-125766 0 1.0
NC_022873_7 7.5|4027054|27|NC_022873|CRT 4027054-4027080 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1998-2024 3 0.889
NC_022873_7 7.18|4027594|27|NC_022873|CRT 4027594-4027620 27 MN693092 Marine virus AFVG_25M37, complete genome 19117-19143 3 0.889
NC_022873_7 7.1|4026892|27|NC_022873|CRT 4026892-4026918 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1998-2024 4 0.852
NC_022873_7 7.1|4026892|27|NC_022873|CRT 4026892-4026918 27 MT380195 Klebsiella phage KP_LZD_B01, complete genome 83709-83735 4 0.852
NC_022873_7 7.1|4026892|27|NC_022873|CRT 4026892-4026918 27 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 88214-88240 4 0.852
NC_022873_7 7.3|4026973|27|NC_022873|CRT 4026973-4026999 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1998-2024 4 0.852
NC_022873_7 7.3|4026973|27|NC_022873|CRT 4026973-4026999 27 MT380195 Klebsiella phage KP_LZD_B01, complete genome 83709-83735 4 0.852
NC_022873_7 7.3|4026973|27|NC_022873|CRT 4026973-4026999 27 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 88214-88240 4 0.852
NC_022873_7 7.5|4027054|27|NC_022873|CRT 4027054-4027080 27 MN204498 Streptomyces phage Saftant, complete genome 18450-18476 4 0.852
NC_022873_7 7.7|4027135|27|NC_022873|CRT 4027135-4027161 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1998-2024 4 0.852
NC_022873_7 7.7|4027135|27|NC_022873|CRT 4027135-4027161 27 MT380195 Klebsiella phage KP_LZD_B01, complete genome 83709-83735 4 0.852
NC_022873_7 7.7|4027135|27|NC_022873|CRT 4027135-4027161 27 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 88214-88240 4 0.852
NC_022873_7 7.9|4027216|27|NC_022873|CRT 4027216-4027242 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1998-2024 4 0.852
NC_022873_7 7.9|4027216|27|NC_022873|CRT 4027216-4027242 27 MT380195 Klebsiella phage KP_LZD_B01, complete genome 83709-83735 4 0.852
NC_022873_7 7.9|4027216|27|NC_022873|CRT 4027216-4027242 27 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 88214-88240 4 0.852
NC_022873_7 7.12|4027333|27|NC_022873|CRT 4027333-4027359 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1998-2024 4 0.852
NC_022873_7 7.12|4027333|27|NC_022873|CRT 4027333-4027359 27 MT380195 Klebsiella phage KP_LZD_B01, complete genome 83709-83735 4 0.852
NC_022873_7 7.12|4027333|27|NC_022873|CRT 4027333-4027359 27 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 88214-88240 4 0.852
NC_022873_7 7.14|4027414|27|NC_022873|CRT 4027414-4027440 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1998-2024 4 0.852
NC_022873_7 7.14|4027414|27|NC_022873|CRT 4027414-4027440 27 MT380195 Klebsiella phage KP_LZD_B01, complete genome 83709-83735 4 0.852
NC_022873_7 7.14|4027414|27|NC_022873|CRT 4027414-4027440 27 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 88214-88240 4 0.852
NC_022873_2 2.1|3528831|27|NC_022873|CRISPRCasFinder 3528831-3528857 27 MN855978 Bacteriophage sp. isolate 105, complete genome 12320-12346 5 0.815
NC_022873_7 7.1|4026892|27|NC_022873|CRT 4026892-4026918 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2043-2069 5 0.815
NC_022873_7 7.1|4026892|27|NC_022873|CRT 4026892-4026918 27 MH825709 Mycobacterium phage NicoleTera, complete genome 5047-5073 5 0.815
NC_022873_7 7.1|4026892|27|NC_022873|CRT 4026892-4026918 27 MN204498 Streptomyces phage Saftant, complete genome 18450-18476 5 0.815
NC_022873_7 7.3|4026973|27|NC_022873|CRT 4026973-4026999 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2043-2069 5 0.815
NC_022873_7 7.3|4026973|27|NC_022873|CRT 4026973-4026999 27 MH825709 Mycobacterium phage NicoleTera, complete genome 5047-5073 5 0.815
NC_022873_7 7.3|4026973|27|NC_022873|CRT 4026973-4026999 27 MN204498 Streptomyces phage Saftant, complete genome 18450-18476 5 0.815
NC_022873_7 7.5|4027054|27|NC_022873|CRT 4027054-4027080 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2043-2069 5 0.815
NC_022873_7 7.5|4027054|27|NC_022873|CRT 4027054-4027080 27 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 2376902-2376928 5 0.815
NC_022873_7 7.5|4027054|27|NC_022873|CRT 4027054-4027080 27 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1250407-1250433 5 0.815
NC_022873_7 7.5|4027054|27|NC_022873|CRT 4027054-4027080 27 MH825709 Mycobacterium phage NicoleTera, complete genome 5047-5073 5 0.815
NC_022873_7 7.5|4027054|27|NC_022873|CRT 4027054-4027080 27 MT380195 Klebsiella phage KP_LZD_B01, complete genome 83709-83735 5 0.815
NC_022873_7 7.5|4027054|27|NC_022873|CRT 4027054-4027080 27 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 88214-88240 5 0.815
NC_022873_7 7.7|4027135|27|NC_022873|CRT 4027135-4027161 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2043-2069 5 0.815
NC_022873_7 7.7|4027135|27|NC_022873|CRT 4027135-4027161 27 MH825709 Mycobacterium phage NicoleTera, complete genome 5047-5073 5 0.815
NC_022873_7 7.7|4027135|27|NC_022873|CRT 4027135-4027161 27 MN204498 Streptomyces phage Saftant, complete genome 18450-18476 5 0.815
NC_022873_7 7.9|4027216|27|NC_022873|CRT 4027216-4027242 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2043-2069 5 0.815
NC_022873_7 7.9|4027216|27|NC_022873|CRT 4027216-4027242 27 MH825709 Mycobacterium phage NicoleTera, complete genome 5047-5073 5 0.815
NC_022873_7 7.9|4027216|27|NC_022873|CRT 4027216-4027242 27 MN204498 Streptomyces phage Saftant, complete genome 18450-18476 5 0.815
NC_022873_7 7.12|4027333|27|NC_022873|CRT 4027333-4027359 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2043-2069 5 0.815
NC_022873_7 7.12|4027333|27|NC_022873|CRT 4027333-4027359 27 MH825709 Mycobacterium phage NicoleTera, complete genome 5047-5073 5 0.815
NC_022873_7 7.12|4027333|27|NC_022873|CRT 4027333-4027359 27 MN204498 Streptomyces phage Saftant, complete genome 18450-18476 5 0.815
NC_022873_7 7.14|4027414|27|NC_022873|CRT 4027414-4027440 27 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 2043-2069 5 0.815
NC_022873_7 7.14|4027414|27|NC_022873|CRT 4027414-4027440 27 MH825709 Mycobacterium phage NicoleTera, complete genome 5047-5073 5 0.815
NC_022873_7 7.14|4027414|27|NC_022873|CRT 4027414-4027440 27 MN204498 Streptomyces phage Saftant, complete genome 18450-18476 5 0.815
NC_022873_7 7.15|4027459|27|NC_022873|CRT 4027459-4027485 27 MN693092 Marine virus AFVG_25M37, complete genome 19117-19143 5 0.815
NC_022873_7 7.18|4027594|27|NC_022873|CRT 4027594-4027620 27 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 181146-181172 5 0.815
NC_022873_7 7.18|4027594|27|NC_022873|CRT 4027594-4027620 27 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 179828-179854 5 0.815
NC_022873_7 7.18|4027594|27|NC_022873|CRT 4027594-4027620 27 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 182247-182273 5 0.815
NC_022873_7 7.18|4027594|27|NC_022873|CRT 4027594-4027620 27 MN693099 Marine virus AFVG_25M184, complete genome 13864-13890 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 NZ_KY270853 Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence 191326-191352 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 20270-20296 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 28980-29006 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 43134-43160 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 KU318421 Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence 241296-241322 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 NC_023911 Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence 169354-169380 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 NZ_CP025964 Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence 108955-108981 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 NZ_CP046614 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence 200945-200971 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 NZ_CP026019 Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence 199734-199760 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 NZ_MF344566 Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence 241189-241215 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 265017-265043 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 NZ_MF344563 Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence 253189-253215 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 367803-367829 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 NZ_CP019048 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence 87011-87037 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 40505-40531 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 300731-300757 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 189248-189274 5 0.815
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 221473-221499 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 NZ_CP019048 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence 87011-87037 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 40505-40531 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 300731-300757 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 189248-189274 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 221473-221499 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 NZ_KY270853 Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence 191326-191352 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 20270-20296 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 28980-29006 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 43134-43160 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 KU318421 Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence 241296-241322 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 NC_023911 Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence 169354-169380 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 NZ_CP025964 Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence 108955-108981 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 NZ_CP046614 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence 200945-200971 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 NZ_CP026019 Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence 199734-199760 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 NZ_MF344566 Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence 241189-241215 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 265017-265043 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 NZ_MF344563 Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence 253189-253215 5 0.815
NC_022873_8 8.2|5518666|27|NC_022873|CRT 5518666-5518692 27 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 367803-367829 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 NZ_KY270853 Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence 191326-191352 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 20270-20296 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 28980-29006 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 NZ_CP019048 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence 87011-87037 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 40505-40531 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 43134-43160 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 KU318421 Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence 241296-241322 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 NC_023911 Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence 169354-169380 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 NZ_CP025964 Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence 108955-108981 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 NZ_CP046614 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence 200945-200971 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 300731-300757 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 NZ_CP026019 Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence 199734-199760 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 NZ_MF344566 Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence 241189-241215 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 189248-189274 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 265017-265043 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 NZ_MF344563 Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence 253189-253215 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 221473-221499 5 0.815
NC_022873_8 8.3|5518711|27|NC_022873|CRT 5518711-5518737 27 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 367803-367829 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 NZ_KY270853 Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence 191326-191352 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 20270-20296 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 28980-29006 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 NZ_CP019048 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence 87011-87037 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 40505-40531 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 43134-43160 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 KU318421 Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence 241296-241322 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 NC_023911 Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence 169354-169380 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 NZ_CP025964 Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence 108955-108981 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 NZ_CP046614 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence 200945-200971 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 300731-300757 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 NZ_CP026019 Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence 199734-199760 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 NZ_MF344566 Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence 241189-241215 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 189248-189274 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 265017-265043 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 NZ_MF344563 Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence 253189-253215 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 221473-221499 5 0.815
NC_022873_8 8.4|5518756|27|NC_022873|CRT 5518756-5518782 27 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 367803-367829 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 NZ_CP019048 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence 87011-87037 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 40505-40531 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 300731-300757 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 189248-189274 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 221473-221499 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 NZ_KY270853 Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence 191326-191352 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 20270-20296 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 28980-29006 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 43134-43160 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 KU318421 Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence 241296-241322 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 NC_023911 Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence 169354-169380 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 NZ_CP025964 Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence 108955-108981 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 NZ_CP046614 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence 200945-200971 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 NZ_CP026019 Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence 199734-199760 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 NZ_MF344566 Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence 241189-241215 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 265017-265043 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 NZ_MF344563 Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence 253189-253215 5 0.815
NC_022873_8 8.5|5518801|27|NC_022873|CRT 5518801-5518827 27 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 367803-367829 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 NZ_CP019048 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence 87011-87037 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 40505-40531 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 300731-300757 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 189248-189274 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 221473-221499 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 NZ_KY270853 Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence 191326-191352 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 20270-20296 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 28980-29006 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 43134-43160 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 KU318421 Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence 241296-241322 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 NC_023911 Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence 169354-169380 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 NZ_CP025964 Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence 108955-108981 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 NZ_CP046614 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence 200945-200971 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 NZ_CP026019 Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence 199734-199760 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 NZ_MF344566 Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence 241189-241215 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 265017-265043 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 NZ_MF344563 Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence 253189-253215 5 0.815
NC_022873_8 8.6|5518846|27|NC_022873|CRT 5518846-5518872 27 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 367803-367829 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 NZ_KY270853 Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence 191326-191352 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 20270-20296 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 28980-29006 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 NZ_CP019048 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence 87011-87037 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 40505-40531 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 43134-43160 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 KU318421 Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence 241296-241322 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 NC_023911 Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence 169354-169380 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 NZ_CP025964 Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence 108955-108981 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 NZ_CP046614 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence 200945-200971 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 300731-300757 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 NZ_CP026019 Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence 199734-199760 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 NZ_MF344566 Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence 241189-241215 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 189248-189274 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 265017-265043 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 NZ_MF344563 Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence 253189-253215 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 221473-221499 5 0.815
NC_022873_8 8.7|5518891|27|NC_022873|CRT 5518891-5518917 27 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 367803-367829 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 NZ_CP019048 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence 87011-87037 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 40505-40531 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 300731-300757 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 189248-189274 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 221473-221499 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 NZ_KY270853 Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence 191326-191352 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 20270-20296 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 28980-29006 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 43134-43160 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 KU318421 Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence 241296-241322 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 NC_023911 Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence 169354-169380 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 NZ_CP025964 Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence 108955-108981 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 NZ_CP046614 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence 200945-200971 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 NZ_CP026019 Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence 199734-199760 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 NZ_MF344566 Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence 241189-241215 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 265017-265043 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 NZ_MF344563 Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence 253189-253215 5 0.815
NC_022873_8 8.8|5518936|27|NC_022873|CRT 5518936-5518962 27 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 367803-367829 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 NZ_KY270853 Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence 191326-191352 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 20270-20296 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 28980-29006 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 43134-43160 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 KU318421 Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence 241296-241322 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 NC_023911 Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence 169354-169380 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 NZ_CP025964 Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence 108955-108981 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 NZ_CP046614 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence 200945-200971 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 NZ_CP026019 Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence 199734-199760 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 NZ_MF344566 Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence 241189-241215 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 265017-265043 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 NZ_MF344563 Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence 253189-253215 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 367803-367829 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 NZ_CP019048 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence 87011-87037 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 40505-40531 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 300731-300757 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 189248-189274 5 0.815
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 221473-221499 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 NZ_CP019048 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence 87011-87037 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 40505-40531 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 300731-300757 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 189248-189274 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 221473-221499 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 NZ_KY270853 Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence 191326-191352 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 20270-20296 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 28980-29006 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 43134-43160 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 KU318421 Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence 241296-241322 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 NC_023911 Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence 169354-169380 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 NZ_CP025964 Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence 108955-108981 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 NZ_CP046614 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence 200945-200971 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 NZ_CP026019 Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence 199734-199760 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 NZ_MF344566 Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence 241189-241215 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 265017-265043 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 NZ_MF344563 Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence 253189-253215 5 0.815
NC_022873_8 8.10|5519026|27|NC_022873|CRT 5519026-5519052 27 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 367803-367829 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 NZ_CP019048 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence 87011-87037 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 40505-40531 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 300731-300757 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 189248-189274 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 221473-221499 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 NZ_KY270853 Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence 191326-191352 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 20270-20296 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 28980-29006 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 43134-43160 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 KU318421 Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence 241296-241322 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 NC_023911 Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence 169354-169380 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 NZ_CP025964 Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence 108955-108981 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 NZ_CP046614 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence 200945-200971 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 NZ_CP026019 Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence 199734-199760 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 NZ_MF344566 Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence 241189-241215 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 265017-265043 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 NZ_MF344563 Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence 253189-253215 5 0.815
NC_022873_8 8.11|5519071|27|NC_022873|CRT 5519071-5519097 27 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 367803-367829 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 NZ_CP019048 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence 87011-87037 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 40505-40531 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 300731-300757 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 189248-189274 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 221473-221499 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 NZ_KY270853 Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence 191326-191352 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 20270-20296 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 28980-29006 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 43134-43160 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 KU318421 Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence 241296-241322 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 NC_023911 Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence 169354-169380 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 NZ_CP025964 Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence 108955-108981 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 NZ_CP046614 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence 200945-200971 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 NZ_CP026019 Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence 199734-199760 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 NZ_MF344566 Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence 241189-241215 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 265017-265043 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 NZ_MF344563 Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence 253189-253215 5 0.815
NC_022873_8 8.12|5519116|27|NC_022873|CRT 5519116-5519142 27 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 367803-367829 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 NZ_KY270853 Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence 191326-191352 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 20270-20296 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 28980-29006 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 NZ_CP019048 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence 87011-87037 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 40505-40531 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 43134-43160 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 KU318421 Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence 241296-241322 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 NC_023911 Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence 169354-169380 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 NZ_CP025964 Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence 108955-108981 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 NZ_CP046614 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence 200945-200971 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 300731-300757 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 NZ_CP026019 Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence 199734-199760 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 NZ_MF344566 Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence 241189-241215 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 189248-189274 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 265017-265043 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 NZ_MF344563 Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence 253189-253215 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 221473-221499 5 0.815
NC_022873_8 8.13|5519161|27|NC_022873|CRT 5519161-5519187 27 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 367803-367829 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 NZ_KY270853 Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence 191326-191352 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 20270-20296 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 28980-29006 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 43134-43160 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 KU318421 Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence 241296-241322 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 NC_023911 Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence 169354-169380 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 NZ_CP025964 Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence 108955-108981 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 NZ_CP046614 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence 200945-200971 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 NZ_CP026019 Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence 199734-199760 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 NZ_MF344566 Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence 241189-241215 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 265017-265043 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 NZ_MF344563 Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence 253189-253215 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 367803-367829 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 NZ_CP019048 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence 87011-87037 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 40505-40531 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 300731-300757 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 189248-189274 5 0.815
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 221473-221499 5 0.815
NC_022873_7 7.1|4026892|27|NC_022873|CRT 4026892-4026918 27 MT701598 Streptomyces phage Sitrop, complete genome 15910-15936 6 0.778
NC_022873_7 7.1|4026892|27|NC_022873|CRT 4026892-4026918 27 MT066160 Vibrio phage Saratov-12, complete genome 4498-4524 6 0.778
NC_022873_7 7.1|4026892|27|NC_022873|CRT 4026892-4026918 27 MT767883 Vibrio phage Saratov-15, complete genome 10808-10834 6 0.778
NC_022873_7 7.3|4026973|27|NC_022873|CRT 4026973-4026999 27 MT701598 Streptomyces phage Sitrop, complete genome 15910-15936 6 0.778
NC_022873_7 7.3|4026973|27|NC_022873|CRT 4026973-4026999 27 MT066160 Vibrio phage Saratov-12, complete genome 4498-4524 6 0.778
NC_022873_7 7.3|4026973|27|NC_022873|CRT 4026973-4026999 27 MT767883 Vibrio phage Saratov-15, complete genome 10808-10834 6 0.778
NC_022873_7 7.5|4027054|27|NC_022873|CRT 4027054-4027080 27 MT701598 Streptomyces phage Sitrop, complete genome 15910-15936 6 0.778
NC_022873_7 7.5|4027054|27|NC_022873|CRT 4027054-4027080 27 MT066160 Vibrio phage Saratov-12, complete genome 4498-4524 6 0.778
NC_022873_7 7.5|4027054|27|NC_022873|CRT 4027054-4027080 27 MT767883 Vibrio phage Saratov-15, complete genome 10808-10834 6 0.778
NC_022873_7 7.7|4027135|27|NC_022873|CRT 4027135-4027161 27 MT701598 Streptomyces phage Sitrop, complete genome 15910-15936 6 0.778
NC_022873_7 7.7|4027135|27|NC_022873|CRT 4027135-4027161 27 MT066160 Vibrio phage Saratov-12, complete genome 4498-4524 6 0.778
NC_022873_7 7.7|4027135|27|NC_022873|CRT 4027135-4027161 27 MT767883 Vibrio phage Saratov-15, complete genome 10808-10834 6 0.778
NC_022873_7 7.9|4027216|27|NC_022873|CRT 4027216-4027242 27 MT701598 Streptomyces phage Sitrop, complete genome 15910-15936 6 0.778
NC_022873_7 7.9|4027216|27|NC_022873|CRT 4027216-4027242 27 MT066160 Vibrio phage Saratov-12, complete genome 4498-4524 6 0.778
NC_022873_7 7.9|4027216|27|NC_022873|CRT 4027216-4027242 27 MT767883 Vibrio phage Saratov-15, complete genome 10808-10834 6 0.778
NC_022873_7 7.12|4027333|27|NC_022873|CRT 4027333-4027359 27 MT701598 Streptomyces phage Sitrop, complete genome 15910-15936 6 0.778
NC_022873_7 7.12|4027333|27|NC_022873|CRT 4027333-4027359 27 MT066160 Vibrio phage Saratov-12, complete genome 4498-4524 6 0.778
NC_022873_7 7.12|4027333|27|NC_022873|CRT 4027333-4027359 27 MT767883 Vibrio phage Saratov-15, complete genome 10808-10834 6 0.778
NC_022873_7 7.14|4027414|27|NC_022873|CRT 4027414-4027440 27 MT701598 Streptomyces phage Sitrop, complete genome 15910-15936 6 0.778
NC_022873_7 7.14|4027414|27|NC_022873|CRT 4027414-4027440 27 MT066160 Vibrio phage Saratov-12, complete genome 4498-4524 6 0.778
NC_022873_7 7.14|4027414|27|NC_022873|CRT 4027414-4027440 27 MT767883 Vibrio phage Saratov-15, complete genome 10808-10834 6 0.778
NC_022873_7 7.18|4027594|27|NC_022873|CRT 4027594-4027620 27 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 13201-13227 6 0.778
NC_022873_7 7.18|4027594|27|NC_022873|CRT 4027594-4027620 27 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 13204-13230 6 0.778
NC_022873_7 7.18|4027594|27|NC_022873|CRT 4027594-4027620 27 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 13201-13227 6 0.778
NC_022873_7 7.18|4027594|27|NC_022873|CRT 4027594-4027620 27 MN693189 Marine virus AFVG_25M326, complete genome 18918-18944 6 0.778
NC_022873_7 7.18|4027594|27|NC_022873|CRT 4027594-4027620 27 AP013669 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C108A-MedDCM-OCT-S25-C43, *** SEQUENCING IN PROGRESS *** 3984-4010 6 0.778
NC_022873_7 7.18|4027594|27|NC_022873|CRT 4027594-4027620 27 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 134824-134850 6 0.778
NC_022873_7 7.18|4027594|27|NC_022873|CRT 4027594-4027620 27 AP013411 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C108A-MedDCM-OCT-S29-C43 29495-29521 6 0.778
NC_022873_8 8.1|5518621|27|NC_022873|CRT 5518621-5518647 27 MN150686 Bacillus phage BC-T25, complete genome 23896-23922 6 0.778
NC_022873_8 8.9|5518981|27|NC_022873|CRT 5518981-5519007 27 MN150686 Bacillus phage BC-T25, complete genome 23896-23922 6 0.778
NC_022873_8 8.15|5519242|27|NC_022873|CRT 5519242-5519268 27 MN150686 Bacillus phage BC-T25, complete genome 23896-23922 6 0.778
NC_022873_7 7.15|4027459|27|NC_022873|CRT 4027459-4027485 27 MN586053 Arthrobacter phage BeatusComedenti, complete genome 29812-29838 7 0.741
NC_022873_7 7.15|4027459|27|NC_022873|CRT 4027459-4027485 27 NC_031231 Arthrobacter phage KellEzio, complete genome 29814-29840 7 0.741
NC_022873_7 7.19|4027639|36|NC_022873|CRT 4027639-4027674 36 MN693405 Marine virus AFVG_25M416, complete genome 18970-19005 7 0.806
NC_022873_7 7.19|4027639|36|NC_022873|CRT 4027639-4027674 36 AP013669 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C108A-MedDCM-OCT-S25-C43, *** SEQUENCING IN PROGRESS *** 3666-3701 7 0.806
NC_022873_7 7.19|4027639|36|NC_022873|CRT 4027639-4027674 36 MN693333 Marine virus AFVG_25M417, complete genome 18970-19005 7 0.806
NC_022873_7 7.19|4027639|36|NC_022873|CRT 4027639-4027674 36 AP013411 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C108A-MedDCM-OCT-S29-C43 29804-29839 7 0.806
NC_022873_7 7.21|4027729|27|NC_022873|CRT 4027729-4027755 27 AP013564 Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C5-MedDCM-OCT-S33-C6, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces 9195-9221 7 0.741
NC_022873_7 7.21|4027729|27|NC_022873|CRT 4027729-4027755 27 AP013944 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S41-C114, *** SEQUENCING IN PROGRESS *** 9025-9051 7 0.741
NC_022873_7 7.21|4027729|27|NC_022873|CRT 4027729-4027755 27 AP013943 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S40-C165, *** SEQUENCING IN PROGRESS *** 9797-9823 7 0.741
NC_022873_7 7.21|4027729|27|NC_022873|CRT 4027729-4027755 27 AP013945 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S43-C137, *** SEQUENCING IN PROGRESS *** 4494-4520 7 0.741
NC_022873_7 7.21|4027729|27|NC_022873|CRT 4027729-4027755 27 AP014476 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S42-C91, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces 17307-17333 7 0.741
NC_022873_7 7.21|4027729|27|NC_022873|CRT 4027729-4027755 27 AP013942 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S39-C99, *** SEQUENCING IN PROGRESS *** 14907-14933 7 0.741
NC_022873_9 9.1|5781927|31|NC_022873|CRISPRCasFinder 5781927-5781957 31 JX238501 Bacillus phage phiAGATE, complete genome 124559-124589 8 0.742
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 NZ_CP014851 Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence 100650-100683 8 0.765
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 MN812210 Flavobacterium phage vB_FspS_hemulen9-1, complete genome 22854-22887 8 0.765
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 MN812215 Flavobacterium phage vB_FspS_lillamy9-4, complete genome 22191-22224 8 0.765
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 MN812216 Flavobacterium phage vB_FspS_lillamy9-5, complete genome 22191-22224 8 0.765
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 NC_048835 Flavobacterium phage vB_FspS_lillamy9-1, complete genome 22191-22224 8 0.765
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 MN812213 Flavobacterium phage vB_FspS_lillamy9-2, complete genome 22191-22224 8 0.765
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 MN812230 Flavobacterium phage vB_FspS_sniff9-2, complete genome 21831-21864 8 0.765
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 MN812209 Flavobacterium phage vB_FspS_hemulen6-2, complete genome 22983-23016 8 0.765
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 MN812218 Flavobacterium phage vB_FspS_lillamy9-7, complete genome 21454-21487 8 0.765
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 MN812233 Flavobacterium phage vB_FspS_snork9-1, complete genome 22007-22040 8 0.765
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 MN812219 Flavobacterium phage vB_FspS_morran9-1, complete genome 22308-22341 8 0.765
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 MN812217 Flavobacterium phage vB_FspS_lillamy9-6, complete genome 21930-21963 8 0.765
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 NC_048840 Flavobacterium phage vB_FspS_snork6-1, complete genome 22137-22170 8 0.765
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 NC_048839 Flavobacterium phage vB_FspS_sniff9-1, complete genome 22057-22090 8 0.765
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 NC_048842 Flavobacterium phage vB_FspS_stinky9-1, complete genome 21673-21706 8 0.765
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 MN812232 Flavobacterium phage vB_FspS_snork6-2, complete genome 21655-21688 8 0.765
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 MN812208 Flavobacterium phage vB_FspS_hemulen6-1, complete genome 22983-23016 8 0.765
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 47181-47214 11 0.676
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 47565-47598 11 0.676
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 47949-47982 11 0.676
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 48333-48366 11 0.676
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 48717-48750 11 0.676
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 49101-49134 11 0.676
NC_022873_9 9.2|5781981|34|NC_022873|CRISPRCasFinder 5781981-5782014 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 49485-49518 11 0.676

1. spacer 4.1|3584095|19|NC_022873|CRISPRCasFinder matches to MN689516 (Lactococcus phage CHPC148, complete genome) position: , mismatch: 0, identity: 1.0

caccttgaataccttgaat	CRISPR spacer
caccttgaataccttgaat	Protospacer
*******************

2. spacer 4.1|3584095|19|NC_022873|CRISPRCasFinder matches to NC_004746 (Lactococcus phage 4268, complete genome) position: , mismatch: 0, identity: 1.0

caccttgaataccttgaat	CRISPR spacer
caccttgaataccttgaat	Protospacer
*******************

3. spacer 4.1|3584095|19|NC_022873|CRISPRCasFinder matches to MN689530 (Lactococcus phage CHPC974, partial genome) position: , mismatch: 0, identity: 1.0

caccttgaataccttgaat	CRISPR spacer
caccttgaataccttgaat	Protospacer
*******************

4. spacer 4.1|3584095|19|NC_022873|CRISPRCasFinder matches to AJ245616 (Lactococcus lactis phage BK5-T complete genome) position: , mismatch: 0, identity: 1.0

caccttgaataccttgaat	CRISPR spacer
caccttgaataccttgaat	Protospacer
*******************

5. spacer 4.1|3584095|19|NC_022873|CRISPRCasFinder matches to AF176025 (Lactococcus phage BK5-T, complete genome) position: , mismatch: 0, identity: 1.0

caccttgaataccttgaat	CRISPR spacer
caccttgaataccttgaat	Protospacer
*******************

6. spacer 4.1|3584095|19|NC_022873|CRISPRCasFinder matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 0, identity: 1.0

caccttgaataccttgaat	CRISPR spacer
caccttgaataccttgaat	Protospacer
*******************

7. spacer 4.1|3584095|19|NC_022873|CRISPRCasFinder matches to AF489521 (Lactococcus bacteriophage 4268, complete genome) position: , mismatch: 0, identity: 1.0

caccttgaataccttgaat	CRISPR spacer
caccttgaataccttgaat	Protospacer
*******************

8. spacer 5.2|3584374|22|NC_022873|CRISPRCasFinder matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcccgttggacctggtggacc	CRISPR spacer
ctcccgttggacctggtggacc	Protospacer
**********************

9. spacer 5.2|3584374|22|NC_022873|CRISPRCasFinder matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcccgttggacctggtggacc	CRISPR spacer
ctcccgttggacctggtggacc	Protospacer
**********************

10. spacer 5.2|3584374|22|NC_022873|CRISPRCasFinder matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcccgttggacctggtggacc	CRISPR spacer
ctcccgttggacctggtggacc	Protospacer
**********************

11. spacer 5.2|3584374|22|NC_022873|CRISPRCasFinder matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcccgttggacctggtggacc	CRISPR spacer
ctcccgttggacctggtggacc	Protospacer
**********************

12. spacer 5.2|3584374|22|NC_022873|CRISPRCasFinder matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcccgttggacctggtggacc	CRISPR spacer
ctcccgttggacctggtggacc	Protospacer
**********************

13. spacer 5.2|3584374|22|NC_022873|CRISPRCasFinder matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcccgttggacctggtggacc	CRISPR spacer
ctcccgttggacctggtggacc	Protospacer
**********************

14. spacer 5.2|3584374|22|NC_022873|CRISPRCasFinder matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcccgttggacctggtggacc	CRISPR spacer
ctcccgttggacctggtggacc	Protospacer
**********************

15. spacer 5.2|3584374|22|NC_022873|CRISPRCasFinder matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcccgttggacctggtggacc	CRISPR spacer
ctcccgttggacctggtggacc	Protospacer
**********************

16. spacer 7.5|4027054|27|NC_022873|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.889

cggcgctaccggtgccactggacctcg	CRISPR spacer
cggcgctaccggtgctactggacctac	Protospacer
***************.*********  

17. spacer 7.18|4027594|27|NC_022873|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 3, identity: 0.889

tggtgctaccggacctcaaggtgctca	CRISPR spacer
tggtgctactggacctcaaggtgctac	Protospacer
*********.***************  

18. spacer 7.1|4026892|27|NC_022873|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggcgctaccggtgctactggacctac	Protospacer
.**************.*********  

19. spacer 7.1|4026892|27|NC_022873|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

20. spacer 7.1|4026892|27|NC_022873|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

21. spacer 7.3|4026973|27|NC_022873|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggcgctaccggtgctactggacctac	Protospacer
.**************.*********  

22. spacer 7.3|4026973|27|NC_022873|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

23. spacer 7.3|4026973|27|NC_022873|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

24. spacer 7.5|4027054|27|NC_022873|CRT matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 4, identity: 0.852

cggcgctaccggtgccactggacctcg	CRISPR spacer
cggtgctaccggtgccactggtccgca	Protospacer
***.***************** ** *.

25. spacer 7.7|4027135|27|NC_022873|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggcgctaccggtgctactggacctac	Protospacer
.**************.*********  

26. spacer 7.7|4027135|27|NC_022873|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

27. spacer 7.7|4027135|27|NC_022873|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

28. spacer 7.9|4027216|27|NC_022873|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggcgctaccggtgctactggacctac	Protospacer
.**************.*********  

29. spacer 7.9|4027216|27|NC_022873|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

30. spacer 7.9|4027216|27|NC_022873|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

31. spacer 7.12|4027333|27|NC_022873|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggcgctaccggtgctactggacctac	Protospacer
.**************.*********  

32. spacer 7.12|4027333|27|NC_022873|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

33. spacer 7.12|4027333|27|NC_022873|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

34. spacer 7.14|4027414|27|NC_022873|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggcgctaccggtgctactggacctac	Protospacer
.**************.*********  

35. spacer 7.14|4027414|27|NC_022873|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

36. spacer 7.14|4027414|27|NC_022873|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 4, identity: 0.852

tggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
*********.*****.******** *.

37. spacer 2.1|3528831|27|NC_022873|CRISPRCasFinder matches to MN855978 (Bacteriophage sp. isolate 105, complete genome) position: , mismatch: 5, identity: 0.815

taaaacataaacgaatgaattgcaaac	CRISPR spacer
cgaaacaaaaacgactgaattgcaaaa	Protospacer
..***** ****** *********** 

38. spacer 7.1|4026892|27|NC_022873|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggtgctaccggtgctactggacctac	Protospacer
 **.***********.*********  

39. spacer 7.1|4026892|27|NC_022873|CRT matches to MH825709 (Mycobacterium phage NicoleTera, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggagctaccggtgccacgggaccgca	Protospacer
 ** ************** ***** *.

40. spacer 7.1|4026892|27|NC_022873|CRT matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggtgctaccggtgccactggtccgca	Protospacer
.**.***************** ** *.

41. spacer 7.3|4026973|27|NC_022873|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggtgctaccggtgctactggacctac	Protospacer
 **.***********.*********  

42. spacer 7.3|4026973|27|NC_022873|CRT matches to MH825709 (Mycobacterium phage NicoleTera, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggagctaccggtgccacgggaccgca	Protospacer
 ** ************** ***** *.

43. spacer 7.3|4026973|27|NC_022873|CRT matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggtgctaccggtgccactggtccgca	Protospacer
.**.***************** ** *.

44. spacer 7.5|4027054|27|NC_022873|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

cggcgctaccggtgccactggacctcg	CRISPR spacer
aggtgctaccggtgctactggacctac	Protospacer
 **.***********.*********  

45. spacer 7.5|4027054|27|NC_022873|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815

cggcgctaccggtgccactggacctcg	CRISPR spacer
cggcgctaccggtgccacgggtctgca	Protospacer
****************** ** *. *.

46. spacer 7.5|4027054|27|NC_022873|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 5, identity: 0.815

cggcgctaccggtgccactggacctcg	CRISPR spacer
cggcgctaccggtgccacgggtctgca	Protospacer
****************** ** *. *.

47. spacer 7.5|4027054|27|NC_022873|CRT matches to MH825709 (Mycobacterium phage NicoleTera, complete genome) position: , mismatch: 5, identity: 0.815

cggcgctaccggtgccactggacctcg	CRISPR spacer
aggagctaccggtgccacgggaccgca	Protospacer
 ** ************** ***** *.

48. spacer 7.5|4027054|27|NC_022873|CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 5, identity: 0.815

cggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
.********.*****.******** *.

49. spacer 7.5|4027054|27|NC_022873|CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 5, identity: 0.815

cggcgctaccggtgccactggacctcg	CRISPR spacer
tggcgctactggtgctactggaccgca	Protospacer
.********.*****.******** *.

50. spacer 7.7|4027135|27|NC_022873|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggtgctaccggtgctactggacctac	Protospacer
 **.***********.*********  

51. spacer 7.7|4027135|27|NC_022873|CRT matches to MH825709 (Mycobacterium phage NicoleTera, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggagctaccggtgccacgggaccgca	Protospacer
 ** ************** ***** *.

52. spacer 7.7|4027135|27|NC_022873|CRT matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggtgctaccggtgccactggtccgca	Protospacer
.**.***************** ** *.

53. spacer 7.9|4027216|27|NC_022873|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggtgctaccggtgctactggacctac	Protospacer
 **.***********.*********  

54. spacer 7.9|4027216|27|NC_022873|CRT matches to MH825709 (Mycobacterium phage NicoleTera, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggagctaccggtgccacgggaccgca	Protospacer
 ** ************** ***** *.

55. spacer 7.9|4027216|27|NC_022873|CRT matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggtgctaccggtgccactggtccgca	Protospacer
.**.***************** ** *.

56. spacer 7.12|4027333|27|NC_022873|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggtgctaccggtgctactggacctac	Protospacer
 **.***********.*********  

57. spacer 7.12|4027333|27|NC_022873|CRT matches to MH825709 (Mycobacterium phage NicoleTera, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggagctaccggtgccacgggaccgca	Protospacer
 ** ************** ***** *.

58. spacer 7.12|4027333|27|NC_022873|CRT matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggtgctaccggtgccactggtccgca	Protospacer
.**.***************** ** *.

59. spacer 7.14|4027414|27|NC_022873|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggtgctaccggtgctactggacctac	Protospacer
 **.***********.*********  

60. spacer 7.14|4027414|27|NC_022873|CRT matches to MH825709 (Mycobacterium phage NicoleTera, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggagctaccggtgccacgggaccgca	Protospacer
 ** ************** ***** *.

61. spacer 7.14|4027414|27|NC_022873|CRT matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctaccggtgccactggacctcg	CRISPR spacer
cggtgctaccggtgccactggtccgca	Protospacer
.**.***************** ** *.

62. spacer 7.15|4027459|27|NC_022873|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 5, identity: 0.815

tggcgctactggacctcagggtgttca	CRISPR spacer
tggtgctactggacctcaaggtgctac	Protospacer
***.**************.****.*  

63. spacer 7.18|4027594|27|NC_022873|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 5, identity: 0.815

tggtgctaccggacctcaaggtgctca	CRISPR spacer
cggtgctaccggtcctcaaggtgatat	Protospacer
.*********** ********** *  

64. spacer 7.18|4027594|27|NC_022873|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 5, identity: 0.815

tggtgctaccggacctcaaggtgctca	CRISPR spacer
cggtgctaccggtcctcaaggtgatat	Protospacer
.*********** ********** *  

65. spacer 7.18|4027594|27|NC_022873|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 5, identity: 0.815

tggtgctaccggacctcaaggtgctca	CRISPR spacer
cggtgctaccggtcctcaaggtgatat	Protospacer
.*********** ********** *  

66. spacer 7.18|4027594|27|NC_022873|CRT matches to MN693099 (Marine virus AFVG_25M184, complete genome) position: , mismatch: 5, identity: 0.815

tggtgctaccggacctcaaggtgctca	CRISPR spacer
tggtgctactggacctcaaggacctac	Protospacer
*********.***********  **  

67. spacer 8.1|5518621|27|NC_022873|CRT matches to NZ_KY270853 (Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

68. spacer 8.1|5518621|27|NC_022873|CRT matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

69. spacer 8.1|5518621|27|NC_022873|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

70. spacer 8.1|5518621|27|NC_022873|CRT matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

71. spacer 8.1|5518621|27|NC_022873|CRT matches to KU318421 (Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

72. spacer 8.1|5518621|27|NC_022873|CRT matches to NC_023911 (Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

73. spacer 8.1|5518621|27|NC_022873|CRT matches to NZ_CP025964 (Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

74. spacer 8.1|5518621|27|NC_022873|CRT matches to NZ_CP046614 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

75. spacer 8.1|5518621|27|NC_022873|CRT matches to NZ_CP026019 (Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

76. spacer 8.1|5518621|27|NC_022873|CRT matches to NZ_MF344566 (Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

77. spacer 8.1|5518621|27|NC_022873|CRT matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

78. spacer 8.1|5518621|27|NC_022873|CRT matches to NZ_MF344563 (Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

79. spacer 8.1|5518621|27|NC_022873|CRT matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

80. spacer 8.1|5518621|27|NC_022873|CRT matches to NZ_CP019048 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

81. spacer 8.1|5518621|27|NC_022873|CRT matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

82. spacer 8.1|5518621|27|NC_022873|CRT matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

83. spacer 8.1|5518621|27|NC_022873|CRT matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

84. spacer 8.1|5518621|27|NC_022873|CRT matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

85. spacer 8.2|5518666|27|NC_022873|CRT matches to NZ_CP019048 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

86. spacer 8.2|5518666|27|NC_022873|CRT matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

87. spacer 8.2|5518666|27|NC_022873|CRT matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

88. spacer 8.2|5518666|27|NC_022873|CRT matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

89. spacer 8.2|5518666|27|NC_022873|CRT matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

90. spacer 8.2|5518666|27|NC_022873|CRT matches to NZ_KY270853 (Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

91. spacer 8.2|5518666|27|NC_022873|CRT matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

92. spacer 8.2|5518666|27|NC_022873|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

93. spacer 8.2|5518666|27|NC_022873|CRT matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

94. spacer 8.2|5518666|27|NC_022873|CRT matches to KU318421 (Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

95. spacer 8.2|5518666|27|NC_022873|CRT matches to NC_023911 (Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

96. spacer 8.2|5518666|27|NC_022873|CRT matches to NZ_CP025964 (Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

97. spacer 8.2|5518666|27|NC_022873|CRT matches to NZ_CP046614 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

98. spacer 8.2|5518666|27|NC_022873|CRT matches to NZ_CP026019 (Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

99. spacer 8.2|5518666|27|NC_022873|CRT matches to NZ_MF344566 (Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

100. spacer 8.2|5518666|27|NC_022873|CRT matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

101. spacer 8.2|5518666|27|NC_022873|CRT matches to NZ_MF344563 (Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

102. spacer 8.2|5518666|27|NC_022873|CRT matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

103. spacer 8.3|5518711|27|NC_022873|CRT matches to NZ_KY270853 (Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

104. spacer 8.3|5518711|27|NC_022873|CRT matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

105. spacer 8.3|5518711|27|NC_022873|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

106. spacer 8.3|5518711|27|NC_022873|CRT matches to NZ_CP019048 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

107. spacer 8.3|5518711|27|NC_022873|CRT matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

108. spacer 8.3|5518711|27|NC_022873|CRT matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

109. spacer 8.3|5518711|27|NC_022873|CRT matches to KU318421 (Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

110. spacer 8.3|5518711|27|NC_022873|CRT matches to NC_023911 (Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

111. spacer 8.3|5518711|27|NC_022873|CRT matches to NZ_CP025964 (Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

112. spacer 8.3|5518711|27|NC_022873|CRT matches to NZ_CP046614 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

113. spacer 8.3|5518711|27|NC_022873|CRT matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

114. spacer 8.3|5518711|27|NC_022873|CRT matches to NZ_CP026019 (Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

115. spacer 8.3|5518711|27|NC_022873|CRT matches to NZ_MF344566 (Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

116. spacer 8.3|5518711|27|NC_022873|CRT matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

117. spacer 8.3|5518711|27|NC_022873|CRT matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

118. spacer 8.3|5518711|27|NC_022873|CRT matches to NZ_MF344563 (Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

119. spacer 8.3|5518711|27|NC_022873|CRT matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

120. spacer 8.3|5518711|27|NC_022873|CRT matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

121. spacer 8.4|5518756|27|NC_022873|CRT matches to NZ_KY270853 (Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

122. spacer 8.4|5518756|27|NC_022873|CRT matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

123. spacer 8.4|5518756|27|NC_022873|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

124. spacer 8.4|5518756|27|NC_022873|CRT matches to NZ_CP019048 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

125. spacer 8.4|5518756|27|NC_022873|CRT matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

126. spacer 8.4|5518756|27|NC_022873|CRT matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

127. spacer 8.4|5518756|27|NC_022873|CRT matches to KU318421 (Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

128. spacer 8.4|5518756|27|NC_022873|CRT matches to NC_023911 (Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

129. spacer 8.4|5518756|27|NC_022873|CRT matches to NZ_CP025964 (Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

130. spacer 8.4|5518756|27|NC_022873|CRT matches to NZ_CP046614 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

131. spacer 8.4|5518756|27|NC_022873|CRT matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

132. spacer 8.4|5518756|27|NC_022873|CRT matches to NZ_CP026019 (Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

133. spacer 8.4|5518756|27|NC_022873|CRT matches to NZ_MF344566 (Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

134. spacer 8.4|5518756|27|NC_022873|CRT matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

135. spacer 8.4|5518756|27|NC_022873|CRT matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

136. spacer 8.4|5518756|27|NC_022873|CRT matches to NZ_MF344563 (Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

137. spacer 8.4|5518756|27|NC_022873|CRT matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

138. spacer 8.4|5518756|27|NC_022873|CRT matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

139. spacer 8.5|5518801|27|NC_022873|CRT matches to NZ_CP019048 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

140. spacer 8.5|5518801|27|NC_022873|CRT matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

141. spacer 8.5|5518801|27|NC_022873|CRT matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

142. spacer 8.5|5518801|27|NC_022873|CRT matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

143. spacer 8.5|5518801|27|NC_022873|CRT matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

144. spacer 8.5|5518801|27|NC_022873|CRT matches to NZ_KY270853 (Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

145. spacer 8.5|5518801|27|NC_022873|CRT matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

146. spacer 8.5|5518801|27|NC_022873|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

147. spacer 8.5|5518801|27|NC_022873|CRT matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

148. spacer 8.5|5518801|27|NC_022873|CRT matches to KU318421 (Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

149. spacer 8.5|5518801|27|NC_022873|CRT matches to NC_023911 (Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

150. spacer 8.5|5518801|27|NC_022873|CRT matches to NZ_CP025964 (Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

151. spacer 8.5|5518801|27|NC_022873|CRT matches to NZ_CP046614 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

152. spacer 8.5|5518801|27|NC_022873|CRT matches to NZ_CP026019 (Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

153. spacer 8.5|5518801|27|NC_022873|CRT matches to NZ_MF344566 (Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

154. spacer 8.5|5518801|27|NC_022873|CRT matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

155. spacer 8.5|5518801|27|NC_022873|CRT matches to NZ_MF344563 (Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

156. spacer 8.5|5518801|27|NC_022873|CRT matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

157. spacer 8.6|5518846|27|NC_022873|CRT matches to NZ_CP019048 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

158. spacer 8.6|5518846|27|NC_022873|CRT matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

159. spacer 8.6|5518846|27|NC_022873|CRT matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

160. spacer 8.6|5518846|27|NC_022873|CRT matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

161. spacer 8.6|5518846|27|NC_022873|CRT matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

162. spacer 8.6|5518846|27|NC_022873|CRT matches to NZ_KY270853 (Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

163. spacer 8.6|5518846|27|NC_022873|CRT matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

164. spacer 8.6|5518846|27|NC_022873|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

165. spacer 8.6|5518846|27|NC_022873|CRT matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

166. spacer 8.6|5518846|27|NC_022873|CRT matches to KU318421 (Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

167. spacer 8.6|5518846|27|NC_022873|CRT matches to NC_023911 (Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

168. spacer 8.6|5518846|27|NC_022873|CRT matches to NZ_CP025964 (Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

169. spacer 8.6|5518846|27|NC_022873|CRT matches to NZ_CP046614 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

170. spacer 8.6|5518846|27|NC_022873|CRT matches to NZ_CP026019 (Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

171. spacer 8.6|5518846|27|NC_022873|CRT matches to NZ_MF344566 (Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

172. spacer 8.6|5518846|27|NC_022873|CRT matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

173. spacer 8.6|5518846|27|NC_022873|CRT matches to NZ_MF344563 (Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

174. spacer 8.6|5518846|27|NC_022873|CRT matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

175. spacer 8.7|5518891|27|NC_022873|CRT matches to NZ_KY270853 (Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

176. spacer 8.7|5518891|27|NC_022873|CRT matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

177. spacer 8.7|5518891|27|NC_022873|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

178. spacer 8.7|5518891|27|NC_022873|CRT matches to NZ_CP019048 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

179. spacer 8.7|5518891|27|NC_022873|CRT matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

180. spacer 8.7|5518891|27|NC_022873|CRT matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

181. spacer 8.7|5518891|27|NC_022873|CRT matches to KU318421 (Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

182. spacer 8.7|5518891|27|NC_022873|CRT matches to NC_023911 (Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

183. spacer 8.7|5518891|27|NC_022873|CRT matches to NZ_CP025964 (Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

184. spacer 8.7|5518891|27|NC_022873|CRT matches to NZ_CP046614 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

185. spacer 8.7|5518891|27|NC_022873|CRT matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

186. spacer 8.7|5518891|27|NC_022873|CRT matches to NZ_CP026019 (Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

187. spacer 8.7|5518891|27|NC_022873|CRT matches to NZ_MF344566 (Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

188. spacer 8.7|5518891|27|NC_022873|CRT matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

189. spacer 8.7|5518891|27|NC_022873|CRT matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

190. spacer 8.7|5518891|27|NC_022873|CRT matches to NZ_MF344563 (Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

191. spacer 8.7|5518891|27|NC_022873|CRT matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

192. spacer 8.7|5518891|27|NC_022873|CRT matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

193. spacer 8.8|5518936|27|NC_022873|CRT matches to NZ_CP019048 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

194. spacer 8.8|5518936|27|NC_022873|CRT matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

195. spacer 8.8|5518936|27|NC_022873|CRT matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

196. spacer 8.8|5518936|27|NC_022873|CRT matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

197. spacer 8.8|5518936|27|NC_022873|CRT matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

198. spacer 8.8|5518936|27|NC_022873|CRT matches to NZ_KY270853 (Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

199. spacer 8.8|5518936|27|NC_022873|CRT matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

200. spacer 8.8|5518936|27|NC_022873|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

201. spacer 8.8|5518936|27|NC_022873|CRT matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

202. spacer 8.8|5518936|27|NC_022873|CRT matches to KU318421 (Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

203. spacer 8.8|5518936|27|NC_022873|CRT matches to NC_023911 (Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

204. spacer 8.8|5518936|27|NC_022873|CRT matches to NZ_CP025964 (Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

205. spacer 8.8|5518936|27|NC_022873|CRT matches to NZ_CP046614 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

206. spacer 8.8|5518936|27|NC_022873|CRT matches to NZ_CP026019 (Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

207. spacer 8.8|5518936|27|NC_022873|CRT matches to NZ_MF344566 (Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

208. spacer 8.8|5518936|27|NC_022873|CRT matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

209. spacer 8.8|5518936|27|NC_022873|CRT matches to NZ_MF344563 (Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

210. spacer 8.8|5518936|27|NC_022873|CRT matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

211. spacer 8.9|5518981|27|NC_022873|CRT matches to NZ_KY270853 (Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

212. spacer 8.9|5518981|27|NC_022873|CRT matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

213. spacer 8.9|5518981|27|NC_022873|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

214. spacer 8.9|5518981|27|NC_022873|CRT matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

215. spacer 8.9|5518981|27|NC_022873|CRT matches to KU318421 (Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

216. spacer 8.9|5518981|27|NC_022873|CRT matches to NC_023911 (Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

217. spacer 8.9|5518981|27|NC_022873|CRT matches to NZ_CP025964 (Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

218. spacer 8.9|5518981|27|NC_022873|CRT matches to NZ_CP046614 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

219. spacer 8.9|5518981|27|NC_022873|CRT matches to NZ_CP026019 (Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

220. spacer 8.9|5518981|27|NC_022873|CRT matches to NZ_MF344566 (Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

221. spacer 8.9|5518981|27|NC_022873|CRT matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

222. spacer 8.9|5518981|27|NC_022873|CRT matches to NZ_MF344563 (Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

223. spacer 8.9|5518981|27|NC_022873|CRT matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

224. spacer 8.9|5518981|27|NC_022873|CRT matches to NZ_CP019048 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

225. spacer 8.9|5518981|27|NC_022873|CRT matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

226. spacer 8.9|5518981|27|NC_022873|CRT matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

227. spacer 8.9|5518981|27|NC_022873|CRT matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

228. spacer 8.9|5518981|27|NC_022873|CRT matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

229. spacer 8.10|5519026|27|NC_022873|CRT matches to NZ_CP019048 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

230. spacer 8.10|5519026|27|NC_022873|CRT matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

231. spacer 8.10|5519026|27|NC_022873|CRT matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

232. spacer 8.10|5519026|27|NC_022873|CRT matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

233. spacer 8.10|5519026|27|NC_022873|CRT matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

234. spacer 8.10|5519026|27|NC_022873|CRT matches to NZ_KY270853 (Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

235. spacer 8.10|5519026|27|NC_022873|CRT matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

236. spacer 8.10|5519026|27|NC_022873|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

237. spacer 8.10|5519026|27|NC_022873|CRT matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

238. spacer 8.10|5519026|27|NC_022873|CRT matches to KU318421 (Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

239. spacer 8.10|5519026|27|NC_022873|CRT matches to NC_023911 (Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

240. spacer 8.10|5519026|27|NC_022873|CRT matches to NZ_CP025964 (Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

241. spacer 8.10|5519026|27|NC_022873|CRT matches to NZ_CP046614 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

242. spacer 8.10|5519026|27|NC_022873|CRT matches to NZ_CP026019 (Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

243. spacer 8.10|5519026|27|NC_022873|CRT matches to NZ_MF344566 (Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

244. spacer 8.10|5519026|27|NC_022873|CRT matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

245. spacer 8.10|5519026|27|NC_022873|CRT matches to NZ_MF344563 (Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

246. spacer 8.10|5519026|27|NC_022873|CRT matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

247. spacer 8.11|5519071|27|NC_022873|CRT matches to NZ_CP019048 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

248. spacer 8.11|5519071|27|NC_022873|CRT matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

249. spacer 8.11|5519071|27|NC_022873|CRT matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

250. spacer 8.11|5519071|27|NC_022873|CRT matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

251. spacer 8.11|5519071|27|NC_022873|CRT matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

252. spacer 8.11|5519071|27|NC_022873|CRT matches to NZ_KY270853 (Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

253. spacer 8.11|5519071|27|NC_022873|CRT matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

254. spacer 8.11|5519071|27|NC_022873|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

255. spacer 8.11|5519071|27|NC_022873|CRT matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

256. spacer 8.11|5519071|27|NC_022873|CRT matches to KU318421 (Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

257. spacer 8.11|5519071|27|NC_022873|CRT matches to NC_023911 (Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

258. spacer 8.11|5519071|27|NC_022873|CRT matches to NZ_CP025964 (Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

259. spacer 8.11|5519071|27|NC_022873|CRT matches to NZ_CP046614 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

260. spacer 8.11|5519071|27|NC_022873|CRT matches to NZ_CP026019 (Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

261. spacer 8.11|5519071|27|NC_022873|CRT matches to NZ_MF344566 (Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

262. spacer 8.11|5519071|27|NC_022873|CRT matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

263. spacer 8.11|5519071|27|NC_022873|CRT matches to NZ_MF344563 (Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

264. spacer 8.11|5519071|27|NC_022873|CRT matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

265. spacer 8.12|5519116|27|NC_022873|CRT matches to NZ_CP019048 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

266. spacer 8.12|5519116|27|NC_022873|CRT matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

267. spacer 8.12|5519116|27|NC_022873|CRT matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

268. spacer 8.12|5519116|27|NC_022873|CRT matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

269. spacer 8.12|5519116|27|NC_022873|CRT matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

270. spacer 8.12|5519116|27|NC_022873|CRT matches to NZ_KY270853 (Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

271. spacer 8.12|5519116|27|NC_022873|CRT matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

272. spacer 8.12|5519116|27|NC_022873|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

273. spacer 8.12|5519116|27|NC_022873|CRT matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

274. spacer 8.12|5519116|27|NC_022873|CRT matches to KU318421 (Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

275. spacer 8.12|5519116|27|NC_022873|CRT matches to NC_023911 (Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

276. spacer 8.12|5519116|27|NC_022873|CRT matches to NZ_CP025964 (Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

277. spacer 8.12|5519116|27|NC_022873|CRT matches to NZ_CP046614 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

278. spacer 8.12|5519116|27|NC_022873|CRT matches to NZ_CP026019 (Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

279. spacer 8.12|5519116|27|NC_022873|CRT matches to NZ_MF344566 (Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

280. spacer 8.12|5519116|27|NC_022873|CRT matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

281. spacer 8.12|5519116|27|NC_022873|CRT matches to NZ_MF344563 (Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

282. spacer 8.12|5519116|27|NC_022873|CRT matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gaccc	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

283. spacer 8.13|5519161|27|NC_022873|CRT matches to NZ_KY270853 (Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

284. spacer 8.13|5519161|27|NC_022873|CRT matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

285. spacer 8.13|5519161|27|NC_022873|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

286. spacer 8.13|5519161|27|NC_022873|CRT matches to NZ_CP019048 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

287. spacer 8.13|5519161|27|NC_022873|CRT matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

288. spacer 8.13|5519161|27|NC_022873|CRT matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

289. spacer 8.13|5519161|27|NC_022873|CRT matches to KU318421 (Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

290. spacer 8.13|5519161|27|NC_022873|CRT matches to NC_023911 (Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

291. spacer 8.13|5519161|27|NC_022873|CRT matches to NZ_CP025964 (Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

292. spacer 8.13|5519161|27|NC_022873|CRT matches to NZ_CP046614 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

293. spacer 8.13|5519161|27|NC_022873|CRT matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

294. spacer 8.13|5519161|27|NC_022873|CRT matches to NZ_CP026019 (Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

295. spacer 8.13|5519161|27|NC_022873|CRT matches to NZ_MF344566 (Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

296. spacer 8.13|5519161|27|NC_022873|CRT matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

297. spacer 8.13|5519161|27|NC_022873|CRT matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

298. spacer 8.13|5519161|27|NC_022873|CRT matches to NZ_MF344563 (Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

299. spacer 8.13|5519161|27|NC_022873|CRT matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

300. spacer 8.13|5519161|27|NC_022873|CRT matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgcccctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

301. spacer 8.15|5519242|27|NC_022873|CRT matches to NZ_KY270853 (Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-dfrA, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

302. spacer 8.15|5519242|27|NC_022873|CRT matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

303. spacer 8.15|5519242|27|NC_022873|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

304. spacer 8.15|5519242|27|NC_022873|CRT matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

305. spacer 8.15|5519242|27|NC_022873|CRT matches to KU318421 (Klebsiella pneumoniae strain KP04 plasmid pKP04VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

306. spacer 8.15|5519242|27|NC_022873|CRT matches to NC_023911 (Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

307. spacer 8.15|5519242|27|NC_022873|CRT matches to NZ_CP025964 (Klebsiella pneumoniae strain WCHKP34 plasmid pIMP4_LL34, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

308. spacer 8.15|5519242|27|NC_022873|CRT matches to NZ_CP046614 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

309. spacer 8.15|5519242|27|NC_022873|CRT matches to NZ_CP026019 (Klebsiella pneumoniae strain 13190 plasmid p13190-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

310. spacer 8.15|5519242|27|NC_022873|CRT matches to NZ_MF344566 (Klebsiella pneumoniae strain A324 plasmid pA324-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

311. spacer 8.15|5519242|27|NC_022873|CRT matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

312. spacer 8.15|5519242|27|NC_022873|CRT matches to NZ_MF344563 (Klebsiella pneumoniae strain 13190 plasmid p13190-VIM, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

313. spacer 8.15|5519242|27|NC_022873|CRT matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

314. spacer 8.15|5519242|27|NC_022873|CRT matches to NZ_CP019048 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

315. spacer 8.15|5519242|27|NC_022873|CRT matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

316. spacer 8.15|5519242|27|NC_022873|CRT matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

317. spacer 8.15|5519242|27|NC_022873|CRT matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

318. spacer 8.15|5519242|27|NC_022873|CRT matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 5, identity: 0.815

gcagttccggtcgctcctgttg---gacct	CRISPR spacer
tcagttccggtcgcgcctgttgtcaga---	Protospacer
 ************* *******   **   

319. spacer 7.1|4026892|27|NC_022873|CRT matches to MT701598 (Streptomyces phage Sitrop, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
gggcgctaccggtgcgactggtcccac	Protospacer
 ************** ***** **.  

320. spacer 7.1|4026892|27|NC_022873|CRT matches to MT066160 (Vibrio phage Saratov-12, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

321. spacer 7.1|4026892|27|NC_022873|CRT matches to MT767883 (Vibrio phage Saratov-15, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

322. spacer 7.3|4026973|27|NC_022873|CRT matches to MT701598 (Streptomyces phage Sitrop, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
gggcgctaccggtgcgactggtcccac	Protospacer
 ************** ***** **.  

323. spacer 7.3|4026973|27|NC_022873|CRT matches to MT066160 (Vibrio phage Saratov-12, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

324. spacer 7.3|4026973|27|NC_022873|CRT matches to MT767883 (Vibrio phage Saratov-15, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

325. spacer 7.5|4027054|27|NC_022873|CRT matches to MT701598 (Streptomyces phage Sitrop, complete genome) position: , mismatch: 6, identity: 0.778

cggcgctaccggtgccactggacctcg	CRISPR spacer
gggcgctaccggtgcgactggtcccac	Protospacer
 ************** ***** **.  

326. spacer 7.5|4027054|27|NC_022873|CRT matches to MT066160 (Vibrio phage Saratov-12, complete genome) position: , mismatch: 6, identity: 0.778

cggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

327. spacer 7.5|4027054|27|NC_022873|CRT matches to MT767883 (Vibrio phage Saratov-15, complete genome) position: , mismatch: 6, identity: 0.778

cggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

328. spacer 7.7|4027135|27|NC_022873|CRT matches to MT701598 (Streptomyces phage Sitrop, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
gggcgctaccggtgcgactggtcccac	Protospacer
 ************** ***** **.  

329. spacer 7.7|4027135|27|NC_022873|CRT matches to MT066160 (Vibrio phage Saratov-12, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

330. spacer 7.7|4027135|27|NC_022873|CRT matches to MT767883 (Vibrio phage Saratov-15, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

331. spacer 7.9|4027216|27|NC_022873|CRT matches to MT701598 (Streptomyces phage Sitrop, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
gggcgctaccggtgcgactggtcccac	Protospacer
 ************** ***** **.  

332. spacer 7.9|4027216|27|NC_022873|CRT matches to MT066160 (Vibrio phage Saratov-12, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

333. spacer 7.9|4027216|27|NC_022873|CRT matches to MT767883 (Vibrio phage Saratov-15, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

334. spacer 7.12|4027333|27|NC_022873|CRT matches to MT701598 (Streptomyces phage Sitrop, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
gggcgctaccggtgcgactggtcccac	Protospacer
 ************** ***** **.  

335. spacer 7.12|4027333|27|NC_022873|CRT matches to MT066160 (Vibrio phage Saratov-12, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

336. spacer 7.12|4027333|27|NC_022873|CRT matches to MT767883 (Vibrio phage Saratov-15, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

337. spacer 7.14|4027414|27|NC_022873|CRT matches to MT701598 (Streptomyces phage Sitrop, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
gggcgctaccggtgcgactggtcccac	Protospacer
 ************** ***** **.  

338. spacer 7.14|4027414|27|NC_022873|CRT matches to MT066160 (Vibrio phage Saratov-12, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

339. spacer 7.14|4027414|27|NC_022873|CRT matches to MT767883 (Vibrio phage Saratov-15, complete genome) position: , mismatch: 6, identity: 0.778

tggcgctaccggtgccactggacctcg	CRISPR spacer
aggccctaccggtgctactggaccagt	Protospacer
 *** **********.********   

340. spacer 7.18|4027594|27|NC_022873|CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 6, identity: 0.778

tggtgctaccggacctcaaggtgctca	CRISPR spacer
tggtgctactggtcctcaaggtgagtt	Protospacer
*********.** **********  . 

341. spacer 7.18|4027594|27|NC_022873|CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 6, identity: 0.778

tggtgctaccggacctcaaggtgctca	CRISPR spacer
tggtgctactggtcctcaaggtgagtt	Protospacer
*********.** **********  . 

342. spacer 7.18|4027594|27|NC_022873|CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 6, identity: 0.778

tggtgctaccggacctcaaggtgctca	CRISPR spacer
tggtgctactggtcctcaaggtgagtt	Protospacer
*********.** **********  . 

343. spacer 7.18|4027594|27|NC_022873|CRT matches to MN693189 (Marine virus AFVG_25M326, complete genome) position: , mismatch: 6, identity: 0.778

tggtgctaccggacctcaaggtgctca	CRISPR spacer
aggtgctactggacctcaaggtccagc	Protospacer
 ********.************ *   

344. spacer 7.18|4027594|27|NC_022873|CRT matches to AP013669 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C108A-MedDCM-OCT-S25-C43, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.778

tggtgctaccggacctcaaggtgctca	CRISPR spacer
tggtgctactggacctcaaggaccagc	Protospacer
*********.***********  *   

345. spacer 7.18|4027594|27|NC_022873|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

tggtgctaccggacctcaaggtgctca	CRISPR spacer
ccacgctacccgacctcagggtgctca	Protospacer
. ..****** *******.********

346. spacer 7.18|4027594|27|NC_022873|CRT matches to AP013411 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C108A-MedDCM-OCT-S29-C43) position: , mismatch: 6, identity: 0.778

tggtgctaccggacctcaaggtgctca	CRISPR spacer
tggtgctactggacctcaaggaccagc	Protospacer
*********.***********  *   

347. spacer 8.1|5518621|27|NC_022873|CRT matches to MN150686 (Bacillus phage BC-T25, complete genome) position: , mismatch: 6, identity: 0.778

gcagttccggtcgctcctgttggacct	CRISPR spacer
ttagttcctgtcgctcctgttgggcac	Protospacer
 .****** **************.* .

348. spacer 8.9|5518981|27|NC_022873|CRT matches to MN150686 (Bacillus phage BC-T25, complete genome) position: , mismatch: 6, identity: 0.778

gcagttccggtcgctcctgttggacct	CRISPR spacer
ttagttcctgtcgctcctgttgggcac	Protospacer
 .****** **************.* .

349. spacer 8.15|5519242|27|NC_022873|CRT matches to MN150686 (Bacillus phage BC-T25, complete genome) position: , mismatch: 6, identity: 0.778

gcagttccggtcgctcctgttggacct	CRISPR spacer
ttagttcctgtcgctcctgttgggcac	Protospacer
 .****** **************.* .

350. spacer 7.15|4027459|27|NC_022873|CRT matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 7, identity: 0.741

tggcgctactggacctcagggtgttca	CRISPR spacer
cggcgccactggacctcagggtccggg	Protospacer
.*****.*************** .  .

351. spacer 7.15|4027459|27|NC_022873|CRT matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 7, identity: 0.741

tggcgctactggacctcagggtgttca	CRISPR spacer
cggcgccactggacctcagggtccggg	Protospacer
.*****.*************** .  .

352. spacer 7.19|4027639|36|NC_022873|CRT matches to MN693405 (Marine virus AFVG_25M416, complete genome) position: , mismatch: 7, identity: 0.806

tggtgctactggcgctactggacctcaaggcgttca	CRISPR spacer
tggtgctactggagctactggccctcaaggtgcaac	Protospacer
************ ******** ********.*.   

353. spacer 7.19|4027639|36|NC_022873|CRT matches to AP013669 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C108A-MedDCM-OCT-S25-C43, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.806

tggtgctactggcgctactggacctcaaggcgttca	CRISPR spacer
tggtgctactggtgcaactggacctcaaggttctac	Protospacer
************.** **************. .*  

354. spacer 7.19|4027639|36|NC_022873|CRT matches to MN693333 (Marine virus AFVG_25M417, complete genome) position: , mismatch: 7, identity: 0.806

tggtgctactggcgctactggacctcaaggcgttca	CRISPR spacer
tggtgctactggagctactggccctcaaggtgcaac	Protospacer
************ ******** ********.*.   

355. spacer 7.19|4027639|36|NC_022873|CRT matches to AP013411 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C108A-MedDCM-OCT-S29-C43) position: , mismatch: 7, identity: 0.806

tggtgctactggcgctactggacctcaaggcgttca	CRISPR spacer
tggtgctactggtgcaactggacctcaaggttctac	Protospacer
************.** **************. .*  

356. spacer 7.21|4027729|27|NC_022873|CRT matches to AP013564 (Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C5-MedDCM-OCT-S33-C6, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces) position: , mismatch: 7, identity: 0.741

cggcgctactggacctcaaggcgttca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  .   

357. spacer 7.21|4027729|27|NC_022873|CRT matches to AP013944 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S41-C114, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.741

cggcgctactggacctcaaggcgttca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  .   

358. spacer 7.21|4027729|27|NC_022873|CRT matches to AP013943 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S40-C165, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.741

cggcgctactggacctcaaggcgttca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  .   

359. spacer 7.21|4027729|27|NC_022873|CRT matches to AP013945 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S43-C137, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.741

cggcgctactggacctcaaggcgttca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  .   

360. spacer 7.21|4027729|27|NC_022873|CRT matches to AP014476 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S42-C91, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 7, identity: 0.741

cggcgctactggacctcaaggcgttca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  .   

361. spacer 7.21|4027729|27|NC_022873|CRT matches to AP013942 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5C-MedDCM-OCT-S39-C99, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.741

cggcgctactggacctcaaggcgttca	CRISPR spacer
cggcgctactgggcctcaaggaccagc	Protospacer
************.********  .   

362. spacer 9.1|5781927|31|NC_022873|CRISPRCasFinder matches to JX238501 (Bacillus phage phiAGATE, complete genome) position: , mismatch: 8, identity: 0.742

ttcttcttttttgtcactagttgaaccgctt	CRISPR spacer
ctaaccttttttgccactagttaaaccgccc	Protospacer
.*  .********.********.******..

363. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to NZ_CP014851 (Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tttatcttcttttttattttctggtttattttcc	Protospacer
.**.****** ****************  * ..*

364. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to MN812210 (Flavobacterium phage vB_FspS_hemulen9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

365. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to MN812215 (Flavobacterium phage vB_FspS_lillamy9-4, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

366. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to MN812216 (Flavobacterium phage vB_FspS_lillamy9-5, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

367. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to NC_048835 (Flavobacterium phage vB_FspS_lillamy9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

368. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to MN812213 (Flavobacterium phage vB_FspS_lillamy9-2, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

369. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to MN812230 (Flavobacterium phage vB_FspS_sniff9-2, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

370. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to MN812209 (Flavobacterium phage vB_FspS_hemulen6-2, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

371. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to MN812218 (Flavobacterium phage vB_FspS_lillamy9-7, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

372. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to MN812233 (Flavobacterium phage vB_FspS_snork9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

373. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to MN812219 (Flavobacterium phage vB_FspS_morran9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

374. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to MN812217 (Flavobacterium phage vB_FspS_lillamy9-6, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

375. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to NC_048840 (Flavobacterium phage vB_FspS_snork6-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

376. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to NC_048839 (Flavobacterium phage vB_FspS_sniff9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

377. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to NC_048842 (Flavobacterium phage vB_FspS_stinky9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

378. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to MN812232 (Flavobacterium phage vB_FspS_snork6-2, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

379. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to MN812208 (Flavobacterium phage vB_FspS_hemulen6-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

380. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

381. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

382. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

383. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

384. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

385. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

386. spacer 9.2|5781981|34|NC_022873|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 240697 : 353788 80 Bacillus_phage(61.36%) tRNA,head,integrase,terminase,transposase,portal,tail,capsid,protease attL 263779:263798|attR 300618:300637
DBSCAN-SWA_2 362208 : 370584 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_3 397435 : 436801 51 Bacillus_phage(94.59%) tRNA,head,integrase,terminase,portal,tail,capsid,protease attL 415154:415182|attR 450120:450148
DBSCAN-SWA_4 440342 : 449446 7 Bacillus_phage(100.0%) plate,tail NA
DBSCAN-SWA_5 752242 : 760400 8 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_6 772057 : 790921 28 Bacillus_phage(66.67%) integrase attL 773523:773538|attR 789672:789687
DBSCAN-SWA_7 820399 : 922673 98 Bacillus_phage(84.06%) head,integrase,terminase,plate,transposase,portal,tail,capsid,bacteriocin,protease attL 838641:838657|attR 915832:915848
DBSCAN-SWA_8 1808675 : 1838567 49 Bacillus_phage(70.0%) integrase,terminase,plate,transposase,tail attL 1800634:1800650|attR 1838292:1838308
DBSCAN-SWA_9 2147131 : 2156430 9 Bacillus_phage(71.43%) NA NA
DBSCAN-SWA_10 4229760 : 4306739 85 Bacillus_phage(63.04%) tRNA,head,integrase,holin,terminase,transposase,portal,tail,capsid,protease attL 4229388:4229404|attR 4307130:4307146
DBSCAN-SWA_11 4595449 : 4647036 47 Bacillus_phage(62.96%) terminase,plate,transposase,portal,tail,capsid,protease NA
DBSCAN-SWA_12 4908630 : 4916313 10 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_13 5283417 : 5376004 92 Bacillus_phage(42.86%) tRNA,head,integrase,terminase,transposase,coat,portal,tail,capsid,protease attL 5277976:5277999|attR 5378058:5378081
DBSCAN-SWA_14 5483780 : 5557767 74 Bacillus_phage(69.05%) tRNA,head,integrase,holin,terminase,transposase,portal,tail,capsid,protease attL 5514661:5514681|attR 5555471:5555491
DBSCAN-SWA_15 5584617 : 5684179 111 Bacillus_phage(44.07%) head,holin,terminase,plate,transposase,portal,tail,capsid,bacteriocin,protease NA
DBSCAN-SWA_16 5759751 : 5766640 8 Enterobacteria_phage(50.0%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_022873.1|WP_023523307.1|5341481_5341721_-|hypothetical-protein 5341481_5341721_- 79 aa aa NA NA NA 5283417-5376004 yes
2. NC_022876
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 21163 18 Bacillus_phage(28.57%) transposase NA
DBSCAN-SWA_2 25580 : 27401 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_3 46313 : 107579 54 Bacillus_phage(33.33%) transposase NA
DBSCAN-SWA_4 118789 : 119767 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_5 123956 : 132180 6 Acinetobacter_phage(25.0%) transposase NA
DBSCAN-SWA_6 135983 : 136595 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_7 142784 : 145607 5 Bacillus_phage(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_022874
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8322 : 32021 27 Bacillus_phage(71.43%) plate,terminase,portal,capsid,protease,tail,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_022875
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 6411 7 Bacillus_phage(80.0%) NA NA
DBSCAN-SWA_2 11148 : 11778 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_3 16390 : 19148 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_4 31224 : 31506 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_5 35428 : 38222 4 Bacillus_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NC_022877
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 292 : 82927 54 Bacillus_phage(42.86%) integrase,transposase attL 41200:41216|attR 89491:89507
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NC_022882
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022882_1 123767-124061 Orphan NA
4 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_022882_1 1.1|123801|26|NC_022882|CRISPRCasFinder 123801-123826 26 NC_022877.1 108315-108340 0 1.0
NC_022882_1 1.2|123861|38|NC_022882|CRISPRCasFinder 123861-123898 38 NC_022877.1 108243-108280 0 1.0
NC_022882_1 1.3|123933|38|NC_022882|CRISPRCasFinder 123933-123970 38 NC_022877.1 108171-108208 0 1.0
NC_022882_1 1.4|124005|23|NC_022882|CRISPRCasFinder 124005-124027 23 NC_022877.1 108114-108136 0 1.0

1. spacer 1.1|123801|26|NC_022882|CRISPRCasFinder matches to position: 108315-108340, mismatch: 0, identity: 1.0

gttgaaatgtcctgttctgactggat	CRISPR spacer
gttgaaatgtcctgttctgactggat	Protospacer
**************************

2. spacer 1.2|123861|38|NC_022882|CRISPRCasFinder matches to position: 108243-108280, mismatch: 0, identity: 1.0

gatgggatttcttcaaatgtttcatgatttgctgatac	CRISPR spacer
gatgggatttcttcaaatgtttcatgatttgctgatac	Protospacer
**************************************

3. spacer 1.3|123933|38|NC_022882|CRISPRCasFinder matches to position: 108171-108208, mismatch: 0, identity: 1.0

gtctggatttcttcatatacttccatatcgtttggaac	CRISPR spacer
gtctggatttcttcatatacttccatatcgtttggaac	Protospacer
**************************************

4. spacer 1.4|124005|23|NC_022882|CRISPRCasFinder matches to position: 108114-108136, mismatch: 0, identity: 1.0

tgttgtacatcttcatgtacttc	CRISPR spacer
tgttgtacatcttcatgtacttc	Protospacer
***********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_022882_1 1.1|123801|26|NC_022882|CRISPRCasFinder 123801-123826 26 NC_022877 Bacillus thuringiensis YBT-1518 plasmid pBMB0232, complete sequence 108315-108340 0 1.0
NC_022882_1 1.1|123801|26|NC_022882|CRISPRCasFinder 123801-123826 26 NZ_CP033793 Bacillus sp. FDAARGOS_527 plasmid unnamed6, complete sequence 15158-15183 0 1.0
NC_022882_1 1.1|123801|26|NC_022882|CRISPRCasFinder 123801-123826 26 NC_022882 Bacillus thuringiensis YBT-1518 plasmid pBMB0233, complete sequence 123801-123826 0 1.0
NC_022882_1 1.2|123861|38|NC_022882|CRISPRCasFinder 123861-123898 38 NC_022877 Bacillus thuringiensis YBT-1518 plasmid pBMB0232, complete sequence 108243-108280 0 1.0
NC_022882_1 1.2|123861|38|NC_022882|CRISPRCasFinder 123861-123898 38 NC_022882 Bacillus thuringiensis YBT-1518 plasmid pBMB0233, complete sequence 123861-123898 0 1.0
NC_022882_1 1.3|123933|38|NC_022882|CRISPRCasFinder 123933-123970 38 NC_022882 Bacillus thuringiensis YBT-1518 plasmid pBMB0233, complete sequence 123933-123970 0 1.0
NC_022882_1 1.3|123933|38|NC_022882|CRISPRCasFinder 123933-123970 38 NC_022877 Bacillus thuringiensis YBT-1518 plasmid pBMB0232, complete sequence 108171-108208 0 1.0
NC_022882_1 1.4|124005|23|NC_022882|CRISPRCasFinder 124005-124027 23 NC_022882 Bacillus thuringiensis YBT-1518 plasmid pBMB0233, complete sequence 124005-124027 0 1.0
NC_022882_1 1.4|124005|23|NC_022882|CRISPRCasFinder 124005-124027 23 NC_022877 Bacillus thuringiensis YBT-1518 plasmid pBMB0232, complete sequence 108114-108136 0 1.0
NC_022882_1 1.4|124005|23|NC_022882|CRISPRCasFinder 124005-124027 23 NC_022782 Bacillus toyonensis BCT-7112 plasmid pBCT77, complete sequence 35113-35135 0 1.0
NC_022882_1 1.2|123861|38|NC_022882|CRISPRCasFinder 123861-123898 38 NC_022782 Bacillus toyonensis BCT-7112 plasmid pBCT77, complete sequence 34897-34934 1 0.974
NC_022882_1 1.3|123933|38|NC_022882|CRISPRCasFinder 123933-123970 38 NC_022782 Bacillus toyonensis BCT-7112 plasmid pBCT77, complete sequence 34969-35006 1 0.974
NC_022882_1 1.4|124005|23|NC_022882|CRISPRCasFinder 124005-124027 23 NC_018685 Bacillus thuringiensis MC28 plasmid pMC95, complete sequence 36860-36882 1 0.957
NC_022882_1 1.4|124005|23|NC_022882|CRISPRCasFinder 124005-124027 23 NZ_CP033793 Bacillus sp. FDAARGOS_527 plasmid unnamed6, complete sequence 14945-14967 1 0.957
NC_022882_1 1.4|124005|23|NC_022882|CRISPRCasFinder 124005-124027 23 MN549361 Rhizobium phage RL2RES, complete genome 47354-47376 2 0.913
NC_022882_1 1.4|124005|23|NC_022882|CRISPRCasFinder 124005-124027 23 NC_025429 Rhizobium phage vB_RleM_P10VF, complete genome 99313-99335 2 0.913
NC_022882_1 1.4|124005|23|NC_022882|CRISPRCasFinder 124005-124027 23 MT778839 Rhizobium phage P9VFCI, complete genome 73066-73088 2 0.913
NC_022882_1 1.4|124005|23|NC_022882|CRISPRCasFinder 124005-124027 23 MN549360 Rhizobium phage RL38J1, complete genome 148128-148150 2 0.913
NC_022882_1 1.1|123801|26|NC_022882|CRISPRCasFinder 123801-123826 26 NC_022782 Bacillus toyonensis BCT-7112 plasmid pBCT77, complete sequence 34810-34835 3 0.885
NC_022882_1 1.2|123861|38|NC_022882|CRISPRCasFinder 123861-123898 38 NZ_CP033793 Bacillus sp. FDAARGOS_527 plasmid unnamed6, complete sequence 15059-15096 4 0.895

1. spacer 1.1|123801|26|NC_022882|CRISPRCasFinder matches to NC_022877 (Bacillus thuringiensis YBT-1518 plasmid pBMB0232, complete sequence) position: , mismatch: 0, identity: 1.0

gttgaaatgtcctgttctgactggat	CRISPR spacer
gttgaaatgtcctgttctgactggat	Protospacer
**************************

2. spacer 1.1|123801|26|NC_022882|CRISPRCasFinder matches to NZ_CP033793 (Bacillus sp. FDAARGOS_527 plasmid unnamed6, complete sequence) position: , mismatch: 0, identity: 1.0

gttgaaatgtcctgttctgactggat	CRISPR spacer
gttgaaatgtcctgttctgactggat	Protospacer
**************************

3. spacer 1.1|123801|26|NC_022882|CRISPRCasFinder matches to NC_022882 (Bacillus thuringiensis YBT-1518 plasmid pBMB0233, complete sequence) position: , mismatch: 0, identity: 1.0

gttgaaatgtcctgttctgactggat	CRISPR spacer
gttgaaatgtcctgttctgactggat	Protospacer
**************************

4. spacer 1.2|123861|38|NC_022882|CRISPRCasFinder matches to NC_022877 (Bacillus thuringiensis YBT-1518 plasmid pBMB0232, complete sequence) position: , mismatch: 0, identity: 1.0

gatgggatttcttcaaatgtttcatgatttgctgatac	CRISPR spacer
gatgggatttcttcaaatgtttcatgatttgctgatac	Protospacer
**************************************

5. spacer 1.2|123861|38|NC_022882|CRISPRCasFinder matches to NC_022882 (Bacillus thuringiensis YBT-1518 plasmid pBMB0233, complete sequence) position: , mismatch: 0, identity: 1.0

gatgggatttcttcaaatgtttcatgatttgctgatac	CRISPR spacer
gatgggatttcttcaaatgtttcatgatttgctgatac	Protospacer
**************************************

6. spacer 1.3|123933|38|NC_022882|CRISPRCasFinder matches to NC_022882 (Bacillus thuringiensis YBT-1518 plasmid pBMB0233, complete sequence) position: , mismatch: 0, identity: 1.0

gtctggatttcttcatatacttccatatcgtttggaac	CRISPR spacer
gtctggatttcttcatatacttccatatcgtttggaac	Protospacer
**************************************

7. spacer 1.3|123933|38|NC_022882|CRISPRCasFinder matches to NC_022877 (Bacillus thuringiensis YBT-1518 plasmid pBMB0232, complete sequence) position: , mismatch: 0, identity: 1.0

gtctggatttcttcatatacttccatatcgtttggaac	CRISPR spacer
gtctggatttcttcatatacttccatatcgtttggaac	Protospacer
**************************************

8. spacer 1.4|124005|23|NC_022882|CRISPRCasFinder matches to NC_022882 (Bacillus thuringiensis YBT-1518 plasmid pBMB0233, complete sequence) position: , mismatch: 0, identity: 1.0

tgttgtacatcttcatgtacttc	CRISPR spacer
tgttgtacatcttcatgtacttc	Protospacer
***********************

9. spacer 1.4|124005|23|NC_022882|CRISPRCasFinder matches to NC_022877 (Bacillus thuringiensis YBT-1518 plasmid pBMB0232, complete sequence) position: , mismatch: 0, identity: 1.0

tgttgtacatcttcatgtacttc	CRISPR spacer
tgttgtacatcttcatgtacttc	Protospacer
***********************

10. spacer 1.4|124005|23|NC_022882|CRISPRCasFinder matches to NC_022782 (Bacillus toyonensis BCT-7112 plasmid pBCT77, complete sequence) position: , mismatch: 0, identity: 1.0

tgttgtacatcttcatgtacttc	CRISPR spacer
tgttgtacatcttcatgtacttc	Protospacer
***********************

11. spacer 1.2|123861|38|NC_022882|CRISPRCasFinder matches to NC_022782 (Bacillus toyonensis BCT-7112 plasmid pBCT77, complete sequence) position: , mismatch: 1, identity: 0.974

gatgggatttcttcaaatgtttcatgatttgctgatac	CRISPR spacer
gatgggatttcttcaaatgtttcatgatctgctgatac	Protospacer
****************************.*********

12. spacer 1.3|123933|38|NC_022882|CRISPRCasFinder matches to NC_022782 (Bacillus toyonensis BCT-7112 plasmid pBCT77, complete sequence) position: , mismatch: 1, identity: 0.974

gtctggatttcttcatatacttccatatcgtttggaac	CRISPR spacer
gtctggatttcttcatatacttccatatcgcttggaac	Protospacer
******************************.*******

13. spacer 1.4|124005|23|NC_022882|CRISPRCasFinder matches to NC_018685 (Bacillus thuringiensis MC28 plasmid pMC95, complete sequence) position: , mismatch: 1, identity: 0.957

tgttgtacatcttcatgtacttc	CRISPR spacer
tgttgtacctcttcatgtacttc	Protospacer
******** **************

14. spacer 1.4|124005|23|NC_022882|CRISPRCasFinder matches to NZ_CP033793 (Bacillus sp. FDAARGOS_527 plasmid unnamed6, complete sequence) position: , mismatch: 1, identity: 0.957

tgttgtacatcttcatgtacttc	CRISPR spacer
tgttgtacctcttcatgtacttc	Protospacer
******** **************

15. spacer 1.4|124005|23|NC_022882|CRISPRCasFinder matches to MN549361 (Rhizobium phage RL2RES, complete genome) position: , mismatch: 2, identity: 0.913

tgttgtacatcttcatgtacttc	CRISPR spacer
tgttgtacttcttcaggtacttc	Protospacer
******** ****** *******

16. spacer 1.4|124005|23|NC_022882|CRISPRCasFinder matches to NC_025429 (Rhizobium phage vB_RleM_P10VF, complete genome) position: , mismatch: 2, identity: 0.913

tgttgtacatcttcatgtacttc	CRISPR spacer
tgttgtacttcttcaggtacttc	Protospacer
******** ****** *******

17. spacer 1.4|124005|23|NC_022882|CRISPRCasFinder matches to MT778839 (Rhizobium phage P9VFCI, complete genome) position: , mismatch: 2, identity: 0.913

tgttgtacatcttcatgtacttc	CRISPR spacer
tgttgtacttcttcaggtacttc	Protospacer
******** ****** *******

18. spacer 1.4|124005|23|NC_022882|CRISPRCasFinder matches to MN549360 (Rhizobium phage RL38J1, complete genome) position: , mismatch: 2, identity: 0.913

tgttgtacatcttcatgtacttc	CRISPR spacer
tgttgtacttcttcaggtacttc	Protospacer
******** ****** *******

19. spacer 1.1|123801|26|NC_022882|CRISPRCasFinder matches to NC_022782 (Bacillus toyonensis BCT-7112 plasmid pBCT77, complete sequence) position: , mismatch: 3, identity: 0.885

gttgaaatgtcctgttctgactggat	CRISPR spacer
gttgaaatgtcctgttctgattttat	Protospacer
********************.*  **

20. spacer 1.2|123861|38|NC_022882|CRISPRCasFinder matches to NZ_CP033793 (Bacillus sp. FDAARGOS_527 plasmid unnamed6, complete sequence) position: , mismatch: 4, identity: 0.895

gatgggatttcttcaaatgtttcatgatttgctgatac	CRISPR spacer
gattggatttcttcaaatgtttcatgatctgctgacat	Protospacer
*** ************************.******.*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 237 : 64637 57 Bacillus_phage(35.71%) transposase,integrase attL 17517:17571|attR 45709:45763
DBSCAN-SWA_2 72648 : 156881 57 Bacillus_phage(28.57%) transposase,holin NA
DBSCAN-SWA_3 167103 : 237614 51 Bacillus_phage(33.33%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage