Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_022739 Pseudomonas sp. VLB120 plasmid pSTY, complete sequence 1 crisprs NA 0 1 0 0
NC_022738 Pseudomonas sp. VLB120, complete sequence 1 crisprs DEDDh,WYL,csa3,cas3,DinG,TnsE_C 0 0 6 0

Results visualization

1. NC_022738
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022738_1 4737166-4737263 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1866512 : 1928795 57 Bacillus_virus(10.0%) protease,coat NA
DBSCAN-SWA_2 2018015 : 2123637 162 Pseudomonas_phage(45.22%) terminase,capsid,head,holin,tRNA,portal,protease,integrase,tail,transposase attL 2025449:2025491|attR 2127133:2127175
DBSCAN-SWA_3 3265495 : 3274982 12 uncultured_Caudovirales_phage(71.43%) tRNA NA
DBSCAN-SWA_4 4109877 : 4161752 65 Pseudomonas_phage(53.66%) head,capsid,terminase,protease,portal,integrase,tail attL 4121315:4121374|attR 4161858:4161924
DBSCAN-SWA_5 4547944 : 4579871 39 uncultured_Mediterranean_phage(15.79%) head,capsid,terminase,tRNA,protease,portal,integrase,tail attL 4544467:4544486|attR 4588282:4588301
DBSCAN-SWA_6 5238076 : 5309994 78 Pseudomonas_phage(67.74%) head,terminase,capsid,plate,lysis,holin,portal,integrase,tail,transposase attL 5293260:5293275|attR 5308634:5308649
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_022739
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022739_1 292120-292232 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_022739_1 1.1|292152|49|NC_022739|CRISPRCasFinder 292152-292200 49 NC_022739 Pseudomonas sp. VLB120 plasmid pSTY, complete sequence 292152-292200 0 1.0

1. spacer 1.1|292152|49|NC_022739|CRISPRCasFinder matches to NC_022739 (Pseudomonas sp. VLB120 plasmid pSTY, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggccgcagcgctgaccagcgccgaggcacaggcaccaatccgtcag	CRISPR spacer
ggcggccgcagcgctgaccagcgccgaggcacaggcaccaatccgtcag	Protospacer
*************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage