Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017729 Salmonella enterica subsp. enterica serovar Typhimurium strain SARA13 plasmid pSARA13, complete sequence 0 crisprs cas14j 0 0 0 0
NZ_CP017728 Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 strain SGSC 2193 chromosome, complete genome 5 crisprs PD-DExK,WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,cas14j,DEDDh,DinG,RT 0 27 9 0

Results visualization

1. NZ_CP017728
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017728_1 599189-599289 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017728_2 948509-950063 TypeI-E I-E
25 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017728_3 966195-966714 TypeI-E I-E
8 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017728_4 966788-967365 TypeI-E I-E
9 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017728_5 1158287-1158396 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017728_2 2.21|949759|32|NZ_CP017728|CRISPRCasFinder,CRT 949759-949790 32 NZ_CP034699 Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence 177960-177991 1 0.969
NZ_CP017728_2 2.21|949759|32|NZ_CP017728|CRISPRCasFinder,CRT 949759-949790 32 NZ_CP034710 Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence 67131-67162 1 0.969
NZ_CP017728_2 2.32|949762|32|NZ_CP017728|PILER-CR 949762-949793 32 NZ_CP034699 Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence 177960-177991 1 0.969
NZ_CP017728_2 2.32|949762|32|NZ_CP017728|PILER-CR 949762-949793 32 NZ_CP034710 Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence 67131-67162 1 0.969
NZ_CP017728_2 2.15|949392|32|NZ_CP017728|CRISPRCasFinder,CRT 949392-949423 32 NZ_CP030204 Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence 130783-130814 2 0.938
NZ_CP017728_2 2.26|949392|35|NZ_CP017728|PILER-CR 949392-949426 35 NZ_CP030204 Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence 130780-130814 4 0.886
NZ_CP017728_2 2.6|948843|32|NZ_CP017728|CRISPRCasFinder,CRT 948843-948874 32 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 208454-208485 7 0.781
NZ_CP017728_2 2.6|948843|32|NZ_CP017728|CRISPRCasFinder,CRT 948843-948874 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 449563-449594 7 0.781
NZ_CP017728_2 2.6|948843|32|NZ_CP017728|CRISPRCasFinder,CRT 948843-948874 32 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 167100-167131 7 0.781
NZ_CP017728_3 3.13|966530|32|NZ_CP017728|CRISPRCasFinder,CRT 966530-966561 32 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29079 7 0.781
NZ_CP017728_3 3.13|966530|32|NZ_CP017728|CRISPRCasFinder,CRT 966530-966561 32 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142294-142325 7 0.781
NZ_CP017728_4 4.1|966817|32|NZ_CP017728|PILER-CR,CRISPRCasFinder,CRT 966817-966848 32 NZ_CP013929 Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence 188177-188208 7 0.781
NZ_CP017728_4 4.1|966817|32|NZ_CP017728|PILER-CR,CRISPRCasFinder,CRT 966817-966848 32 CP013931 Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence 192938-192969 7 0.781
NZ_CP017728_4 4.1|966817|32|NZ_CP017728|PILER-CR,CRISPRCasFinder,CRT 966817-966848 32 NC_019394 Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence 188204-188235 7 0.781
NZ_CP017728_2 2.9|949026|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 949026-949057 32 CP001770 Spirosoma linguale DSM 74 plasmid pSLIN01, complete sequence 145771-145802 8 0.75
NZ_CP017728_2 2.10|949087|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 949087-949118 32 LQ277707 Sequence 2 from Patent WO2016071503 12422-12453 8 0.75
NZ_CP017728_2 2.10|949087|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 949087-949118 32 LZ998055 JP 2017534684-A/2: Phage Therapy 12422-12453 8 0.75
NZ_CP017728_2 2.13|949270|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 949270-949301 32 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 1098771-1098802 8 0.75
NZ_CP017728_2 2.13|949270|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 949270-949301 32 NZ_CP014128 Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence 160189-160220 8 0.75
NZ_CP017728_2 2.13|949270|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 949270-949301 32 NC_014561 Pantoea vagans C9-1 plasmid pPag1, complete sequence 156443-156474 8 0.75
NZ_CP017728_2 2.13|949270|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 949270-949301 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 137983-138014 8 0.75
NZ_CP017728_2 2.18|949576|32|NZ_CP017728|CRISPRCasFinder,CRT 949576-949607 32 CP024685 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence 135469-135500 8 0.75
NZ_CP017728_2 2.18|949576|32|NZ_CP017728|CRISPRCasFinder,CRT 949576-949607 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 11654-11685 8 0.75
NZ_CP017728_2 2.29|949579|32|NZ_CP017728|PILER-CR 949579-949610 32 CP024685 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence 135469-135500 8 0.75
NZ_CP017728_2 2.29|949579|32|NZ_CP017728|PILER-CR 949579-949610 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 11654-11685 8 0.75
NZ_CP017728_3 3.6|966529|33|NZ_CP017728|PILER-CR 966529-966561 33 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142293-142325 8 0.758
NZ_CP017728_3 3.6|966529|33|NZ_CP017728|PILER-CR 966529-966561 33 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29080 8 0.758
NZ_CP017728_3 3.14|966591|32|NZ_CP017728|CRISPRCasFinder,CRT 966591-966622 32 NZ_CP016179 Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence 203354-203385 8 0.75
NZ_CP017728_4 4.2|966878|32|NZ_CP017728|PILER-CR,CRISPRCasFinder,CRT 966878-966909 32 NZ_CP016489 Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence 8862-8893 8 0.75
NZ_CP017728_4 4.2|966878|32|NZ_CP017728|PILER-CR,CRISPRCasFinder,CRT 966878-966909 32 NZ_CP016476 Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence 151600-151631 8 0.75
NZ_CP017728_4 4.8|967244|32|NZ_CP017728|PILER-CR,CRISPRCasFinder,CRT 967244-967275 32 MN855803 Bacteriophage sp. isolate 108, partial genome 10057-10088 8 0.75
NZ_CP017728_2 2.2|948599|32|NZ_CP017728|CRISPRCasFinder,CRT 948599-948630 32 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 353298-353329 9 0.719
NZ_CP017728_2 2.2|948599|32|NZ_CP017728|CRISPRCasFinder,CRT 948599-948630 32 AM749121 Streptococcus phage M102 complete genome 7893-7924 9 0.719
NZ_CP017728_2 2.2|948599|32|NZ_CP017728|CRISPRCasFinder,CRT 948599-948630 32 NC_012884 Streptococcus phage M102, complete genome 7893-7924 9 0.719
NZ_CP017728_2 2.5|948782|32|NZ_CP017728|CRISPRCasFinder,CRT 948782-948813 32 MN693046 Marine virus AFVG_25M413, complete genome 4323-4354 9 0.719
NZ_CP017728_2 2.5|948782|32|NZ_CP017728|CRISPRCasFinder,CRT 948782-948813 32 MN693008 Marine virus AFVG_117M9, complete genome 4316-4347 9 0.719
NZ_CP017728_2 2.6|948843|32|NZ_CP017728|CRISPRCasFinder,CRT 948843-948874 32 DQ674738 Aeromonas phage phiO18P, complete genome 15707-15738 9 0.719
NZ_CP017728_2 2.6|948843|32|NZ_CP017728|CRISPRCasFinder,CRT 948843-948874 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 380725-380756 9 0.719
NZ_CP017728_2 2.6|948843|32|NZ_CP017728|CRISPRCasFinder,CRT 948843-948874 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 153785-153816 9 0.719
NZ_CP017728_2 2.7|948904|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 948904-948935 32 MN694645 Marine virus AFVG_250M761, complete genome 31050-31081 9 0.719
NZ_CP017728_2 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 948965-948996 32 MN062720 Microbacterium phage FuzzBuster, complete genome 19374-19405 9 0.719
NZ_CP017728_2 2.13|949270|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 949270-949301 32 NZ_CP045722 Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence 332-363 9 0.719
NZ_CP017728_2 2.13|949270|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 949270-949301 32 NZ_CP022519 Pantoea vagans strain FBS135 plasmid pPant3, complete sequence 62976-63007 9 0.719
NZ_CP017728_2 2.13|949270|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 949270-949301 32 NZ_CP028351 Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence 144976-145007 9 0.719
NZ_CP017728_3 3.11|966408|32|NZ_CP017728|CRISPRCasFinder,CRT 966408-966439 32 MT162468 Synechococcus phage S-H25, complete genome 69929-69960 9 0.719
NZ_CP017728_2 2.3|948660|32|NZ_CP017728|CRISPRCasFinder,CRT 948660-948691 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 1134787-1134818 10 0.688
NZ_CP017728_2 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 948965-948996 32 NZ_CP019257 Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence 20006-20037 10 0.688
NZ_CP017728_2 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 948965-948996 32 NZ_CP019274 Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence 9024-9055 10 0.688
NZ_CP017728_2 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 948965-948996 32 NZ_CP019275 Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence 27130-27161 10 0.688
NZ_CP017728_2 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 948965-948996 32 NZ_CP019279 Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence 19363-19394 10 0.688
NZ_CP017728_2 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 948965-948996 32 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 23427-23458 10 0.688
NZ_CP017728_2 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 948965-948996 32 NC_049342 Escherichia phage 500465-1, complete genome 24342-24373 10 0.688
NZ_CP017728_2 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 948965-948996 32 KY271398 Klebsiella phage 4 LV-2017, complete genome 28240-28271 10 0.688
NZ_CP017728_2 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR 948965-948996 32 CP025900 Escherichia phage sp., complete genome 24342-24373 10 0.688
NZ_CP017728_2 2.22|949820|32|NZ_CP017728|CRISPRCasFinder,CRT 949820-949851 32 NZ_CP044072 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence 99817-99848 10 0.688
NZ_CP017728_2 2.25|950003|32|NZ_CP017728|CRISPRCasFinder,CRT 950003-950034 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 146919-146950 10 0.688
NZ_CP017728_2 2.33|949823|32|NZ_CP017728|PILER-CR 949823-949854 32 NZ_CP044072 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence 99817-99848 10 0.688
NZ_CP017728_3 3.11|966408|32|NZ_CP017728|CRISPRCasFinder,CRT 966408-966439 32 LN681539 Clostridium phage phiCD505, complete genome 8933-8964 10 0.688
NZ_CP017728_3 3.11|966408|32|NZ_CP017728|CRISPRCasFinder,CRT 966408-966439 32 JX145341 Clostridium phage phiMMP02, complete genome 8932-8963 10 0.688
NZ_CP017728_3 3.11|966408|32|NZ_CP017728|CRISPRCasFinder,CRT 966408-966439 32 NC_011398 Clostridium phage phiCD27, complete genome 8924-8955 10 0.688
NZ_CP017728_3 3.11|966408|32|NZ_CP017728|CRISPRCasFinder,CRT 966408-966439 32 NC_048642 Clostridium phage CDKM9, complete genome 8871-8902 10 0.688
NZ_CP017728_3 3.11|966408|32|NZ_CP017728|CRISPRCasFinder,CRT 966408-966439 32 KX228400 Clostridium phage CDKM15, complete genome 9066-9097 10 0.688
NZ_CP017728_4 4.9|967305|32|NZ_CP017728|CRISPRCasFinder,CRT 967305-967336 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
NZ_CP017728_4 4.9|967305|32|NZ_CP017728|CRISPRCasFinder,CRT 967305-967336 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
NZ_CP017728_2 2.1|948538|32|NZ_CP017728|CRISPRCasFinder,CRT 948538-948569 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1885546-1885577 11 0.656
NZ_CP017728_2 2.1|948538|32|NZ_CP017728|CRISPRCasFinder,CRT 948538-948569 32 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 56201-56232 11 0.656
NZ_CP017728_2 2.1|948538|32|NZ_CP017728|CRISPRCasFinder,CRT 948538-948569 32 NZ_CP040822 Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence 83399-83430 11 0.656
NZ_CP017728_2 2.1|948538|32|NZ_CP017728|CRISPRCasFinder,CRT 948538-948569 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1487158-1487189 11 0.656
NZ_CP017728_2 2.1|948538|32|NZ_CP017728|CRISPRCasFinder,CRT 948538-948569 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 597699-597730 11 0.656
NZ_CP017728_2 2.6|948843|32|NZ_CP017728|CRISPRCasFinder,CRT 948843-948874 32 NZ_CP054036 Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence 234768-234799 11 0.656
NZ_CP017728_2 2.6|948843|32|NZ_CP017728|CRISPRCasFinder,CRT 948843-948874 32 NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 299431-299462 11 0.656

1. spacer 2.21|949759|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP034699 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

2. spacer 2.21|949759|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP034710 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

3. spacer 2.32|949762|32|NZ_CP017728|PILER-CR matches to NZ_CP034699 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

4. spacer 2.32|949762|32|NZ_CP017728|PILER-CR matches to NZ_CP034710 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

5. spacer 2.15|949392|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP030204 (Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence) position: , mismatch: 2, identity: 0.938

aaacgaaagaggctatgcggttgtttatcggt	CRISPR spacer
aaacgaaagaggccatgcgattgtttatcggt	Protospacer
*************.*****.************

6. spacer 2.26|949392|35|NZ_CP017728|PILER-CR matches to NZ_CP030204 (Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence) position: , mismatch: 4, identity: 0.886

tcgaaacgaaagaggctatgcggttgtttatcggt	CRISPR spacer
atgaaacgaaagaggccatgcgattgtttatcggt	Protospacer
 .**************.*****.************

7. spacer 2.6|948843|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 7, identity: 0.781

ccggcatcagcgccgatccgttcatagtgccc---	CRISPR spacer
tcggcaccagcgccgatccggtca---tgctcgaa	Protospacer
.*****.************* ***   ***.*   

8. spacer 2.6|948843|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.781

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ccggcatcaccgccgatcctttcaccgccgcc	Protospacer
********* ********* ****. *.  **

9. spacer 2.6|948843|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.781

ccggcatcagcgccgatccgttcatagtgccc---	CRISPR spacer
tcggcaccagcgccgatccggtca---tgctcgaa	Protospacer
.*****.************* ***   ***.*   

10. spacer 3.13|966530|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 7, identity: 0.781

ttacgtgtttattcatctgttgcattagattc	CRISPR spacer
attggtgtttcttcatctattgcattagaagc	Protospacer
 *  ****** *******.**********  *

11. spacer 3.13|966530|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

ttacgtgtttattcatctgttgcattagattc	CRISPR spacer
attggtgtttcttcatctattgcattagaagc	Protospacer
 *  ****** *******.**********  *

12. spacer 4.1|966817|32|NZ_CP017728|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013929 (Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence) position: , mismatch: 7, identity: 0.781

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**  

13. spacer 4.1|966817|32|NZ_CP017728|PILER-CR,CRISPRCasFinder,CRT matches to CP013931 (Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence) position: , mismatch: 7, identity: 0.781

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**  

14. spacer 4.1|966817|32|NZ_CP017728|PILER-CR,CRISPRCasFinder,CRT matches to NC_019394 (Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence) position: , mismatch: 7, identity: 0.781

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**  

15. spacer 2.9|949026|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to CP001770 (Spirosoma linguale DSM 74 plasmid pSLIN01, complete sequence) position: , mismatch: 8, identity: 0.75

cggaggatggaatatttccgaggctggcgatt	CRISPR spacer
tgggagatggaatacttccggggctggcaacc	Protospacer
.**..*********.*****.*******.*..

16. spacer 2.10|949087|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to LQ277707 (Sequence 2 from Patent WO2016071503) position: , mismatch: 8, identity: 0.75

atgccggaacgctgatggcgtttgacatgagc----	CRISPR spacer
ttgccggaacgctattggcgtttg----cagccttt	Protospacer
 ************. *********     ***    

17. spacer 2.10|949087|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to LZ998055 (JP 2017534684-A/2: Phage Therapy) position: , mismatch: 8, identity: 0.75

atgccggaacgctgatggcgtttgacatgagc----	CRISPR spacer
ttgccggaacgctattggcgtttg----cagccttt	Protospacer
 ************. *********     ***    

18. spacer 2.13|949270|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac-	CRISPR spacer
atacgctggtctataccggcaa-ggatccgctg	Protospacer
  ******************** *.*. ** . 

19. spacer 2.13|949270|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014128 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacactggtctacaccggcaacgtaaaattc	Protospacer
****.********.********** * .   *

20. spacer 2.13|949270|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to NC_014561 (Pantoea vagans C9-1 plasmid pPag1, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacactggtctacaccggcaacgtaaaattc	Protospacer
****.********.********** * .   *

21. spacer 2.13|949270|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
ggacgctgttcaataccggcaacgtccggatc	Protospacer
 ******* ** ************  ** . *

22. spacer 2.18|949576|32|NZ_CP017728|CRISPRCasFinder,CRT matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
attcactatcagacattttattcagttctgcc	Protospacer
  ***** ** *****************  . 

23. spacer 2.18|949576|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
cgcgcgtgtctgacattgtattcagttcattt	Protospacer
**.   * ********* **********.** 

24. spacer 2.29|949579|32|NZ_CP017728|PILER-CR matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
attcactatcagacattttattcagttctgcc	Protospacer
  ***** ** *****************  . 

25. spacer 2.29|949579|32|NZ_CP017728|PILER-CR matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
cgcgcgtgtctgacattgtattcagttcattt	Protospacer
**.   * ********* **********.** 

26. spacer 3.6|966529|33|NZ_CP017728|PILER-CR matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758

gttacgtgtttattcatctgttgcattagattc	CRISPR spacer
aattggtgtttcttcatctattgcattagaagc	Protospacer
. *  ****** *******.**********  *

27. spacer 3.6|966529|33|NZ_CP017728|PILER-CR matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 8, identity: 0.758

gttacgtgtttattcatctgttgcattagattc	CRISPR spacer
aattggtgtttcttcatctattgcattagaagc	Protospacer
. *  ****** *******.**********  *

28. spacer 3.14|966591|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gaggcgtac-----aggctgttagatgagaaattacc	CRISPR spacer
-----atactaataaggctgtttgatgcgaaattacc	Protospacer
     .***     ******** **** *********

29. spacer 4.2|966878|32|NZ_CP017728|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016489 (Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75

ttcttgaatatgattgcgggtatatgtggata	CRISPR spacer
ctcttgaatatgattgcgggtttagatttacc	Protospacer
.******************** ** .*  *. 

30. spacer 4.2|966878|32|NZ_CP017728|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016476 (Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcttgaatatgattgcgggtatatgtggata	CRISPR spacer
ctcttgaatatgattgcgggtttagatttacc	Protospacer
.******************** ** .*  *. 

31. spacer 4.8|967244|32|NZ_CP017728|PILER-CR,CRISPRCasFinder,CRT matches to MN855803 (Bacteriophage sp. isolate 108, partial genome) position: , mismatch: 8, identity: 0.75

ggttaaccaggggtttttccccactatttcgc	CRISPR spacer
aggtaacgaggggtttttccccaatattgaaa	Protospacer
.* **** *************** ****  . 

32. spacer 2.2|948599|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 9, identity: 0.719

gcagcggttgagtaactcctcgtccacgtcga	CRISPR spacer
ggtgcgggtgaggaactcctcgtccactgaac	Protospacer
*  **** **** **************   . 

33. spacer 2.2|948599|32|NZ_CP017728|CRISPRCasFinder,CRT matches to AM749121 (Streptococcus phage M102 complete genome) position: , mismatch: 9, identity: 0.719

gcagcggttgagtaactcctcgtccacgtcga	CRISPR spacer
aaggcggtggagtaactcctggtccagcccaa	Protospacer
. .***** *********** *****  .*.*

34. spacer 2.2|948599|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NC_012884 (Streptococcus phage M102, complete genome) position: , mismatch: 9, identity: 0.719

gcagcggttgagtaactcctcgtccacgtcga	CRISPR spacer
aaggcggtggagtaactcctggtccagcccaa	Protospacer
. .***** *********** *****  .*.*

35. spacer 2.5|948782|32|NZ_CP017728|CRISPRCasFinder,CRT matches to MN693046 (Marine virus AFVG_25M413, complete genome) position: , mismatch: 9, identity: 0.719

gcgaggtcaataaaaaatggtgtggctttacc	CRISPR spacer
ttagggtcaacaaaaaatggtgtggtttcaga	Protospacer
 ...******.**************.**.*  

36. spacer 2.5|948782|32|NZ_CP017728|CRISPRCasFinder,CRT matches to MN693008 (Marine virus AFVG_117M9, complete genome) position: , mismatch: 9, identity: 0.719

gcgaggtcaataaaaaatggtgtggctttacc	CRISPR spacer
ttagggtcaacaaaaaatggtgtggtttcaga	Protospacer
 ...******.**************.**.*  

37. spacer 2.6|948843|32|NZ_CP017728|CRISPRCasFinder,CRT matches to DQ674738 (Aeromonas phage phiO18P, complete genome) position: , mismatch: 9, identity: 0.719

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ccggcatcagcgccgagcagttcagcaaactg	Protospacer
**************** * *****  . .*. 

38. spacer 2.6|948843|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 9, identity: 0.719

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
gcggcatcagcgccgaccggttcaccgtcagg	Protospacer
 ***************.* *****. **    

39. spacer 2.6|948843|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ccggcatgagcgccgatcagttcgacgccctg	Protospacer
******* ********** ****.  *. *. 

40. spacer 2.7|948904|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to MN694645 (Marine virus AFVG_250M761, complete genome) position: , mismatch: 9, identity: 0.719

aacaggaacaggaaaaaaaagatttgtccggt	CRISPR spacer
tacagtaacaggaaaaaaaggattaatgatgc	Protospacer
 **** *************.**** .*   *.

41. spacer 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to MN062720 (Microbacterium phage FuzzBuster, complete genome) position: , mismatch: 9, identity: 0.719

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaacggtcagcctgtccaggagga	Protospacer
****** *********** ****..**     

42. spacer 2.13|949270|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045722 (Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacgctgatctataccggcaacgtcaagttt	Protospacer
********.***************   .   .

43. spacer 2.13|949270|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022519 (Pantoea vagans strain FBS135 plasmid pPant3, complete sequence) position: , mismatch: 9, identity: 0.719

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacgctgatctataccggcaacgtcaagttt	Protospacer
********.***************   .   .

44. spacer 2.13|949270|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028351 (Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence) position: , mismatch: 9, identity: 0.719

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacactggtctacaccggcaacgtaaaattt	Protospacer
****.********.********** * .   .

45. spacer 3.11|966408|32|NZ_CP017728|CRISPRCasFinder,CRT matches to MT162468 (Synechococcus phage S-H25, complete genome) position: , mismatch: 9, identity: 0.719

ttgcag----ggcgatattgttgttggtgaatggga	CRISPR spacer
----aacactgacgatattattgttggtgattgggg	Protospacer
    *.    *.*******.********** ****.

46. spacer 2.3|948660|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 10, identity: 0.688

ctccagcgctcgaatttatttgaggccaccac	CRISPR spacer
gaacaccgcgcgaatttatttgaggcaagttt	Protospacer
   ** *** **************** * . .

47. spacer 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019257 (Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

48. spacer 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019274 (Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

49. spacer 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019275 (Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

50. spacer 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019279 (Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

51. spacer 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

52. spacer 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to NC_049342 (Escherichia phage 500465-1, complete genome) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

53. spacer 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to KY271398 (Klebsiella phage 4 LV-2017, complete genome) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

54. spacer 2.8|948965|32|NZ_CP017728|CRISPRCasFinder,CRT,PILER-CR matches to CP025900 (Escherichia phage sp., complete genome) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

55. spacer 2.22|949820|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP044072 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatcgagagtgcgaagaggcagaacgggca	CRISPR spacer
gaaggtggcagtgccaagagacagaacgggca	Protospacer
  .. .*. ***** *****.***********

56. spacer 2.25|950003|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgttcatcggcagcgtcacgcaatatgaagat	CRISPR spacer
acatcatcggcatcgtcacgccatatccggca	Protospacer
   ********* ******** ****  .*  

57. spacer 2.33|949823|32|NZ_CP017728|PILER-CR matches to NZ_CP044072 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatcgagagtgcgaagaggcagaacgggca	CRISPR spacer
gaaggtggcagtgccaagagacagaacgggca	Protospacer
  .. .*. ***** *****.***********

58. spacer 3.11|966408|32|NZ_CP017728|CRISPRCasFinder,CRT matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

59. spacer 3.11|966408|32|NZ_CP017728|CRISPRCasFinder,CRT matches to JX145341 (Clostridium phage phiMMP02, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

60. spacer 3.11|966408|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NC_011398 (Clostridium phage phiCD27, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

61. spacer 3.11|966408|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NC_048642 (Clostridium phage CDKM9, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

62. spacer 3.11|966408|32|NZ_CP017728|CRISPRCasFinder,CRT matches to KX228400 (Clostridium phage CDKM15, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

63. spacer 4.9|967305|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

64. spacer 4.9|967305|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

65. spacer 2.1|948538|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 11, identity: 0.656

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgacgagatcgccttccagaccaaccttttgg	Protospacer
.     **** ************ *****  .

66. spacer 2.1|948538|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 11, identity: 0.656

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgacgagatcgccttccagaccaaccttttgg	Protospacer
.     **** ************ *****  .

67. spacer 2.1|948538|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP040822 (Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence) position: , mismatch: 11, identity: 0.656

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgactcgatcgccttccagaccaaccttctgg	Protospacer
.   .***** ************ ****.  .

68. spacer 2.1|948538|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 11, identity: 0.656

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgacgagatcgccttccagaccaaccttttgg	Protospacer
.     **** ************ *****  .

69. spacer 2.1|948538|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 11, identity: 0.656

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgacgagatcgccttccagaccaaccttttgg	Protospacer
.     **** ************ *****  .

70. spacer 2.6|948843|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 11, identity: 0.656

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ttccgatcagcgccgatccgctcctagtctat	Protospacer
..   ***************.** **** . .

71. spacer 2.6|948843|32|NZ_CP017728|CRISPRCasFinder,CRT matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 11, identity: 0.656

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ttccgatcagcgccgatccgctcctagtctat	Protospacer
..   ***************.** **** . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1220522 : 1297254 87 Salmonella_phage(42.11%) protease,lysis,capsid,terminase,tail,transposase,tRNA,integrase,holin,head,portal attL 1213979:1213995|attR 1303101:1303117
DBSCAN-SWA_2 1649940 : 1679534 31 Salmonella_phage(41.67%) protease,holin,tail NA
DBSCAN-SWA_3 1751096 : 1760267 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_4 1828575 : 1839081 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_5 1925074 : 1975834 67 Salmonella_phage(90.32%) protease,lysis,terminase,plate,tail,integrase,holin,head,portal attL 1919653:1919667|attR 1936128:1936142
DBSCAN-SWA_6 2605116 : 2661542 62 Saccharomonospora_phage(11.11%) protease,tail,transposase,tRNA,integrase attL 2649596:2649618|attR 2659311:2659333
DBSCAN-SWA_7 2876268 : 2960985 92 Salmonella_phage(44.44%) protease,lysis,terminase,tail,tRNA,holin,portal NA
DBSCAN-SWA_8 3025151 : 3033883 7 Enterobacteria_phage(14.29%) protease,transposase NA
DBSCAN-SWA_9 4399787 : 4444306 46 Burkholderia_phage(42.86%) plate,holin,tRNA,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage