Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_022567 Adlercreutzia equolifaciens DSM 19450, complete genome 9 crisprs cas14j,WYL,RT,cas2,csa3 0 2 1 0

Results visualization

1. NC_022567
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022567_1 369524-369600 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022567_2 843953-844039 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022567_4 944450-944532 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022567_3 944144-944350 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022567_5 1433965-1434041 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022567_6 1545753-1545837 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022567_7 1567528-1567602 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022567_8 2317032-2317111 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022567_9 2768337-2768412 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_022567_9 9.1|2768361|28|NC_022567|CRISPRCasFinder 2768361-2768388 28 NC_048743 Mycobacterium phage DrLupo, complete genome 61250-61277 5 0.821
NC_022567_7 7.1|1567551|29|NC_022567|CRISPRCasFinder 1567551-1567579 29 NZ_CP022346 Bacillus thuringiensis strain c25 plasmid unnamed1, complete sequence 194522-194550 7 0.759

1. spacer 9.1|2768361|28|NC_022567|CRISPRCasFinder matches to NC_048743 (Mycobacterium phage DrLupo, complete genome) position: , mismatch: 5, identity: 0.821

gcacgacaaccccgaatcagc---gattcag	CRISPR spacer
gcacgactaccccgaatcagccgtgatc---	Protospacer
******* *************   ***.   

2. spacer 7.1|1567551|29|NC_022567|CRISPRCasFinder matches to NZ_CP022346 (Bacillus thuringiensis strain c25 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

tcgacgggccaaagaaaaagcacgcgaaa	CRISPR spacer
ctgaaaaaccaaagaaaaagcactcgaaa	Protospacer
..** ...*************** *****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1968379 : 1977420 7 Catovirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage