Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_022092 Geobacillus genomosp. 3 plasmid pBt40, complete sequence 1 crisprs NA 0 1 0 0
NC_022080 Geobacillus genomosp. 3, complete sequence 4 crisprs cas2,cas1,cas9,cas14j,csa3,DEDDh,c2c10_CAS-V-U3,cas3,DinG,RT 0 6 8 0

Results visualization

1. NC_022092
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022092_1 32525-32663 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_022092_1 1.1|32558|73|NC_022092|CRISPRCasFinder 32558-32630 73 NC_022092 Geobacillus genomosp. 3 plasmid pBt40, complete sequence 32558-32630 13 0.822

1. spacer 1.1|32558|73|NC_022092|CRISPRCasFinder matches to NC_022092 (Geobacillus genomosp. 3 plasmid pBt40, complete sequence) position: , mismatch: 13, identity: 0.822

tttatctcatacatttttggtgttaggcgtacatttttggtgtttatctcgtacattttt	CRISPR spacer
tttatctcatacatttttggtgttaggcgtacatttttggtgtttatctcgtacattttt	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_022080
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022080_1 301645-302140 orTypeII NA
7 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022080_2 1885394-1885564 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022080_3 1985340-1985438 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022080_4 3406240-3406389 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_022080_1 1.2|301747|29|NC_022080|PILER-CR,CRISPRCasFinder,CRT 301747-301775 29 NZ_AP022559 Geobacillus subterraneus strain E55-1 plasmid pGspE55-2, complete sequence 2942-2970 0 1.0
NC_022080_1 1.4|301878|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT 301878-301907 30 NZ_AP022559 Geobacillus subterraneus strain E55-1 plasmid pGspE55-2, complete sequence 27096-27125 1 0.967
NC_022080_1 1.5|301944|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT 301944-301973 30 NC_009552 Geobacillus virus E2, complete genome 37407-37436 1 0.967
NC_022080_1 1.3|301812|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT 301812-301841 30 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 2559981-2560010 5 0.833
NC_022080_1 1.3|301812|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT 301812-301841 30 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1067325-1067354 5 0.833
NC_022080_1 1.3|301812|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT 301812-301841 30 KY940711 Bradyrhizobium phage BDU-MI-1, complete genome 111867-111896 5 0.833
NC_022080_1 1.6|302010|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT 302010-302039 30 NC_012109 Desulfobacterium autotrophicum HRM2 plasmid pHRM2a, complete sequence 1258-1287 7 0.767
NC_022080_1 1.6|302010|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT 302010-302039 30 MT700412 Bacillus phage 1_ICo-2020, complete genome 25789-25818 7 0.767
NC_022080_1 1.1|301681|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT 301681-301710 30 NZ_CP051164 Geobacillus subterraneus strain CPW16 plasmid pBsrF30, complete sequence 4757-4786 8 0.733
NC_022080_1 1.5|301944|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT 301944-301973 30 MN694548 Marine virus AFVG_250M139, complete genome 6291-6320 8 0.733

1. spacer 1.2|301747|29|NC_022080|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022559 (Geobacillus subterraneus strain E55-1 plasmid pGspE55-2, complete sequence) position: , mismatch: 0, identity: 1.0

tcctgcaacgtggtaatctcatcatgctc	CRISPR spacer
tcctgcaacgtggtaatctcatcatgctc	Protospacer
*****************************

2. spacer 1.4|301878|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022559 (Geobacillus subterraneus strain E55-1 plasmid pGspE55-2, complete sequence) position: , mismatch: 1, identity: 0.967

ctacgggcgcgagagaggccttctcgaagc	CRISPR spacer
atacgggcgcgagagaggccttctcgaagc	Protospacer
 *****************************

3. spacer 1.5|301944|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT matches to NC_009552 (Geobacillus virus E2, complete genome) position: , mismatch: 1, identity: 0.967

taataccatgaaggcatggctgagatcgtg	CRISPR spacer
aaataccatgaaggcatggctgagatcgtg	Protospacer
 *****************************

4. spacer 1.3|301812|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.833

cggcgtgtt--cctcgaacatgcgccagccga	CRISPR spacer
--gcgtcctggcctcgaacatgcgccacccga	Protospacer
  **** .*  **************** ****

5. spacer 1.3|301812|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 5, identity: 0.833

cggcgtgtt--cctcgaacatgcgccagccga	CRISPR spacer
--gcgtcctggcctcgaacatgcgccacccga	Protospacer
  **** .*  **************** ****

6. spacer 1.3|301812|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT matches to KY940711 (Bradyrhizobium phage BDU-MI-1, complete genome) position: , mismatch: 5, identity: 0.833

cggcgtg-ttcctcgaacatgcgccagccga	CRISPR spacer
-ggcaggcttcctcgaacttgcgccagcaga	Protospacer
 ***. * ********** ********* **

7. spacer 1.6|302010|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT matches to NC_012109 (Desulfobacterium autotrophicum HRM2 plasmid pHRM2a, complete sequence) position: , mismatch: 7, identity: 0.767

--ataacgaacagcaagtgaacaggaggacaa	CRISPR spacer
gagcaacag--agcaagtgaacaagaggacaa	Protospacer
  ..***..  ************.********

8. spacer 1.6|302010|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT matches to MT700412 (Bacillus phage 1_ICo-2020, complete genome) position: , mismatch: 7, identity: 0.767

ataacgaacagcaagtgaacaggaggacaa	CRISPR spacer
ggaaatgacagtaattgaacaggaggacaa	Protospacer
. **  .****.** ***************

9. spacer 1.1|301681|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051164 (Geobacillus subterraneus strain CPW16 plasmid pBsrF30, complete sequence) position: , mismatch: 8, identity: 0.733

aaattcaaaacagaaataccgtttcttgta	CRISPR spacer
tgtatcaaaacagaaacaccgtttgtttca	Protospacer
 .  ************.******* ** .*

10. spacer 1.5|301944|30|NC_022080|PILER-CR,CRISPRCasFinder,CRT matches to MN694548 (Marine virus AFVG_250M139, complete genome) position: , mismatch: 8, identity: 0.733

taataccatgaaggcatggctgagatcgtg	CRISPR spacer
gcaccccatgaaggcatggctgggatgtcg	Protospacer
  *. *****************.***  .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 259204 : 267562 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 284506 : 331426 37 Pandoravirus(10.0%) tRNA,transposase,holin NA
DBSCAN-SWA_3 898536 : 906493 12 Pneumococcus_phage(33.33%) NA NA
DBSCAN-SWA_4 1398205 : 1463943 59 Anomala_cuprea_entomopoxvirus(16.67%) transposase,coat,integrase attL 1385980:1385996|attR 1458755:1458771
DBSCAN-SWA_5 2129117 : 2139825 13 Pandoravirus(25.0%) NA NA
DBSCAN-SWA_6 2202735 : 2212020 11 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_7 2986409 : 2995002 10 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_8 3416198 : 3425939 8 uncultured_Mediterranean_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage