Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_021987 Enterococcus faecium Aus0085 plasmid p1, complete sequence 1 crisprs cas14j 0 2 1 0
NC_021994 Enterococcus faecium Aus0085, complete sequence 1 crisprs RT,DEDDh,cas14j,cas2,DinG,cas3,csa3 0 0 13 0
NC_021995 Enterococcus faecium Aus0085 plasmid p2, complete sequence 0 crisprs cas14j 0 0 0 0
NC_021989 Enterococcus faecium Aus0085 plasmid p4, complete sequence 1 crisprs NA 0 1 0 0
NC_021996 Enterococcus faecium Aus0085 plasmid p5, complete sequence 0 crisprs NA 0 0 0 0
NC_021990 Enterococcus faecium Aus0085 plasmid p6, complete sequence 0 crisprs NA 0 0 0 0
NC_021988 Enterococcus faecium Aus0085 plasmid p3, complete sequence 0 crisprs cas14j 0 0 2 0

Results visualization

1. NC_021989
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021989_1 9164-9267 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NC_021989 Enterococcus faecium Aus0085 plasmid p4, complete sequence 9201-9230 0 1.0
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NC_021989 Enterococcus faecium Aus0085 plasmid p4, complete sequence 9178-9207 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NC_021989 Enterococcus faecium Aus0085 plasmid p4, complete sequence 9223-9252 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP016167 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p4, complete sequence 2027-2056 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP016167 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p4, complete sequence 2049-2078 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135291 Enterococcus faecium isolate E7199 plasmid 5 7790-7819 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135291 Enterococcus faecium isolate E7199 plasmid 5 7812-7841 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135291 Enterococcus faecium isolate E7199 plasmid 5 7834-7863 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135262 Enterococcus faecium isolate E4457 plasmid 5 1580-1609 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135262 Enterococcus faecium isolate E4457 plasmid 5 1602-1631 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135262 Enterococcus faecium isolate E4457 plasmid 5 1624-1653 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135432 Enterococcus faecium isolate E8927 plasmid 5 5677-5706 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135432 Enterococcus faecium isolate E8927 plasmid 5 5699-5728 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135432 Enterococcus faecium isolate E8927 plasmid 5 5721-5750 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135208 Enterococcus faecium isolate E7171 plasmid 6 5027-5056 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135208 Enterococcus faecium isolate E7171 plasmid 6 5049-5078 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135208 Enterococcus faecium isolate E7171 plasmid 6 5071-5100 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135348 Enterococcus faecium isolate E8202 plasmid 5 7297-7326 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135348 Enterococcus faecium isolate E8202 plasmid 5 7319-7348 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135348 Enterococcus faecium isolate E8202 plasmid 5 7341-7370 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135411 Enterococcus faecium isolate E8284 plasmid 4 3974-4003 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135411 Enterococcus faecium isolate E8284 plasmid 4 3996-4025 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135411 Enterococcus faecium isolate E8284 plasmid 4 4018-4047 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135377 Enterococcus faecium isolate E8172 plasmid 6 2892-2921 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135377 Enterococcus faecium isolate E8172 plasmid 6 2914-2943 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135377 Enterococcus faecium isolate E8172 plasmid 6 2936-2965 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP011831 Enterococcus faecium strain UW8175 plasmid unnamed3, complete sequence 10719-10748 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP011831 Enterococcus faecium strain UW8175 plasmid unnamed3, complete sequence 10741-10770 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP011831 Enterococcus faecium strain UW8175 plasmid unnamed3, complete sequence 10763-10792 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP040703 Enterococcus faecium strain HOU503 plasmid p3, complete sequence 10541-10570 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP040703 Enterococcus faecium strain HOU503 plasmid p3, complete sequence 10563-10592 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP040703 Enterococcus faecium strain HOU503 plasmid p3, complete sequence 10585-10614 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP033209 Enterococcus faecium strain RBWH1 plasmid pRBWH1.3, complete sequence 3458-3487 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP033209 Enterococcus faecium strain RBWH1 plasmid pRBWH1.3, complete sequence 3480-3509 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP033209 Enterococcus faecium strain RBWH1 plasmid pRBWH1.3, complete sequence 3502-3531 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135250 Enterococcus faecium isolate E6988 plasmid 8 6750-6779 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135250 Enterococcus faecium isolate E6988 plasmid 8 6772-6801 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135250 Enterococcus faecium isolate E6988 plasmid 8 6794-6823 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135201 Enterococcus faecium isolate E6055 plasmid 5 4356-4385 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135201 Enterococcus faecium isolate E6055 plasmid 5 4378-4407 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135201 Enterococcus faecium isolate E6055 plasmid 5 4400-4429 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135438 Enterococcus faecium isolate E8691 plasmid 4 9008-9037 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135438 Enterococcus faecium isolate E8691 plasmid 4 9030-9059 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135438 Enterococcus faecium isolate E8691 plasmid 4 9052-9081 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135232 Enterococcus faecium isolate E7025 plasmid 7 1336-1365 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135225 Enterococcus faecium isolate E7040 plasmid 7 3961-3990 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135225 Enterococcus faecium isolate E7040 plasmid 7 3983-4012 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135404 Enterococcus faecium isolate E8377 plasmid 4 3166-3195 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135404 Enterococcus faecium isolate E8377 plasmid 4 3188-3217 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135404 Enterococcus faecium isolate E8377 plasmid 4 3210-3239 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135397 Enterococcus faecium isolate E8290 plasmid 4 7092-7121 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135397 Enterococcus faecium isolate E8290 plasmid 4 7114-7143 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135397 Enterococcus faecium isolate E8290 plasmid 4 7136-7165 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135388 Enterococcus faecium isolate E7933 plasmid 5 3739-3768 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135388 Enterococcus faecium isolate E7933 plasmid 5 3761-3790 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135388 Enterococcus faecium isolate E7933 plasmid 5 3783-3812 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR134113 Enterococcus faecium isolate E6043 plasmid 0 2249-2278 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR134113 Enterococcus faecium isolate E6043 plasmid 0 2271-2300 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NC_008259 Enterococcus faecium plasmid pCIZ2, complete sequence 5549-5578 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NC_008259 Enterococcus faecium plasmid pCIZ2, complete sequence 5571-5600 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NC_008259 Enterococcus faecium plasmid pCIZ2, complete sequence 5593-5622 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP014532 Enterococcus faecium strain E745 plasmid pl3, complete sequence 3101-3130 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP014532 Enterococcus faecium strain E745 plasmid pl3, complete sequence 3123-3152 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP014532 Enterococcus faecium strain E745 plasmid pl3, complete sequence 3145-3174 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP023427 Enterococcus faecium strain K60-39 plasmid pTT39_p4 9965-9994 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP023427 Enterococcus faecium strain K60-39 plasmid pTT39_p4 9987-10016 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP023427 Enterococcus faecium strain K60-39 plasmid pTT39_p4 10009-10038 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP044277 Enterococcus faecium strain V2937 plasmid pHVH-V2937-3, complete sequence 10351-10380 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP044277 Enterococcus faecium strain V2937 plasmid pHVH-V2937-3, complete sequence 10373-10402 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP044277 Enterococcus faecium strain V2937 plasmid pHVH-V2937-3, complete sequence 10395-10424 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP017796 Enterococcus faecium strain E240 plasmid unnamed4, complete sequence 10242-10271 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP017796 Enterococcus faecium strain E240 plasmid unnamed4, complete sequence 10264-10293 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP017796 Enterococcus faecium strain E240 plasmid unnamed4, complete sequence 10286-10315 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135194 Enterococcus faecium isolate E4438 plasmid 4 565-594 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135194 Enterococcus faecium isolate E4438 plasmid 4 587-616 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135194 Enterococcus faecium isolate E4438 plasmid 4 609-638 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NC_019240 Enterococcus durans plasmid pGL, complete sequence 109-138 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NC_019240 Enterococcus durans plasmid pGL, complete sequence 131-160 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NC_019240 Enterococcus durans plasmid pGL, complete sequence 153-182 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 LR135187 Enterococcus faecium isolate E4413 genome assembly, plasmid: 3 6211-6240 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 LR135187 Enterococcus faecium isolate E4413 genome assembly, plasmid: 3 6233-6262 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 LR135187 Enterococcus faecium isolate E4413 genome assembly, plasmid: 3 6255-6284 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 MT074685 Enterococcus faecium strain T-E1077-31 plasmid pT-E1077-31, complete sequence 18130-18159 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 MT074685 Enterococcus faecium strain T-E1077-31 plasmid pT-E1077-31, complete sequence 18152-18181 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 MT074685 Enterococcus faecium strain T-E1077-31 plasmid pT-E1077-31, complete sequence 18174-18203 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 MT074684 Enterococcus faecium strain E1077 plasmid pE1077-23, complete sequence 18138-18167 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 MT074684 Enterococcus faecium strain E1077 plasmid pE1077-23, complete sequence 18160-18189 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 MT074684 Enterococcus faecium strain E1077 plasmid pE1077-23, complete sequence 18182-18211 1 0.967
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135232 Enterococcus faecium isolate E7025 plasmid 7 1358-1387 2 0.933
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR134113 Enterococcus faecium isolate E6043 plasmid 0 2293-2322 2 0.933
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135232 Enterococcus faecium isolate E7025 plasmid 7 1380-1409 3 0.9
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP016167 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p4, complete sequence 2004-2033 5 0.833
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NC_021989 Enterococcus faecium Aus0085 plasmid p4, complete sequence 9156-9185 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP016167 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p4, complete sequence 2092-2121 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135291 Enterococcus faecium isolate E7199 plasmid 5 7856-7885 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135262 Enterococcus faecium isolate E4457 plasmid 5 1646-1675 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135432 Enterococcus faecium isolate E8927 plasmid 5 5743-5772 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135208 Enterococcus faecium isolate E7171 plasmid 6 5093-5122 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135348 Enterococcus faecium isolate E8202 plasmid 5 7363-7392 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135411 Enterococcus faecium isolate E8284 plasmid 4 4040-4069 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135377 Enterococcus faecium isolate E8172 plasmid 6 2958-2987 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP011831 Enterococcus faecium strain UW8175 plasmid unnamed3, complete sequence 10785-10814 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP040703 Enterococcus faecium strain HOU503 plasmid p3, complete sequence 10607-10636 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP033209 Enterococcus faecium strain RBWH1 plasmid pRBWH1.3, complete sequence 3524-3553 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135250 Enterococcus faecium isolate E6988 plasmid 8 6728-6757 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135201 Enterococcus faecium isolate E6055 plasmid 5 4334-4363 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135438 Enterococcus faecium isolate E8691 plasmid 4 8986-9015 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135232 Enterococcus faecium isolate E7025 plasmid 7 1314-1343 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135225 Enterococcus faecium isolate E7040 plasmid 7 3939-3968 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135404 Enterococcus faecium isolate E8377 plasmid 4 3144-3173 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135397 Enterococcus faecium isolate E8290 plasmid 4 7070-7099 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135388 Enterococcus faecium isolate E7933 plasmid 5 3717-3746 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR134113 Enterococcus faecium isolate E6043 plasmid 0 2227-2256 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP014532 Enterococcus faecium strain E745 plasmid pl3, complete sequence 3079-3108 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP023427 Enterococcus faecium strain K60-39 plasmid pTT39_p4 9943-9972 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP044277 Enterococcus faecium strain V2937 plasmid pHVH-V2937-3, complete sequence 10329-10358 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_CP017796 Enterococcus faecium strain E240 plasmid unnamed4, complete sequence 10220-10249 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NZ_LR135194 Enterococcus faecium isolate E4438 plasmid 4 543-572 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NC_019240 Enterococcus durans plasmid pGL, complete sequence 87-116 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 LR135187 Enterococcus faecium isolate E4413 genome assembly, plasmid: 3 6189-6218 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 MT074685 Enterococcus faecium strain T-E1077-31 plasmid pT-E1077-31, complete sequence 18108-18137 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 MT074684 Enterococcus faecium strain E1077 plasmid pE1077-23, complete sequence 18116-18145 7 0.767
NC_021989_1 1.1|9201|30|NC_021989|CRISPRCasFinder 9201-9230 30 NC_008259 Enterococcus faecium plasmid pCIZ2, complete sequence 5527-5556 8 0.733

1. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NC_021989 (Enterococcus faecium Aus0085 plasmid p4, complete sequence) position: , mismatch: 0, identity: 1.0

cacactatggggggataaattgtcacacta	CRISPR spacer
cacactatggggggataaattgtcacacta	Protospacer
******************************

2. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NC_021989 (Enterococcus faecium Aus0085 plasmid p4, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

3. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NC_021989 (Enterococcus faecium Aus0085 plasmid p4, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

4. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP016167 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p4, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

5. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP016167 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p4, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

6. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135291 (Enterococcus faecium isolate E7199 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

7. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135291 (Enterococcus faecium isolate E7199 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

8. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135291 (Enterococcus faecium isolate E7199 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

9. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135262 (Enterococcus faecium isolate E4457 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

10. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135262 (Enterococcus faecium isolate E4457 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

11. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135262 (Enterococcus faecium isolate E4457 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

12. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135432 (Enterococcus faecium isolate E8927 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

13. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135432 (Enterococcus faecium isolate E8927 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

14. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135432 (Enterococcus faecium isolate E8927 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

15. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135208 (Enterococcus faecium isolate E7171 plasmid 6) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

16. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135208 (Enterococcus faecium isolate E7171 plasmid 6) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

17. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135208 (Enterococcus faecium isolate E7171 plasmid 6) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

18. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135348 (Enterococcus faecium isolate E8202 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

19. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135348 (Enterococcus faecium isolate E8202 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

20. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135348 (Enterococcus faecium isolate E8202 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

21. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135411 (Enterococcus faecium isolate E8284 plasmid 4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

22. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135411 (Enterococcus faecium isolate E8284 plasmid 4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

23. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135411 (Enterococcus faecium isolate E8284 plasmid 4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

24. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135377 (Enterococcus faecium isolate E8172 plasmid 6) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

25. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135377 (Enterococcus faecium isolate E8172 plasmid 6) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

26. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135377 (Enterococcus faecium isolate E8172 plasmid 6) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

27. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP011831 (Enterococcus faecium strain UW8175 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

28. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP011831 (Enterococcus faecium strain UW8175 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

29. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP011831 (Enterococcus faecium strain UW8175 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

30. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP040703 (Enterococcus faecium strain HOU503 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

31. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP040703 (Enterococcus faecium strain HOU503 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

32. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP040703 (Enterococcus faecium strain HOU503 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

33. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP033209 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.3, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

34. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP033209 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.3, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

35. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP033209 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.3, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

36. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135250 (Enterococcus faecium isolate E6988 plasmid 8) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

37. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135250 (Enterococcus faecium isolate E6988 plasmid 8) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

38. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135250 (Enterococcus faecium isolate E6988 plasmid 8) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

39. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135201 (Enterococcus faecium isolate E6055 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

40. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135201 (Enterococcus faecium isolate E6055 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

41. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135201 (Enterococcus faecium isolate E6055 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

42. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135438 (Enterococcus faecium isolate E8691 plasmid 4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

43. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135438 (Enterococcus faecium isolate E8691 plasmid 4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

44. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135438 (Enterococcus faecium isolate E8691 plasmid 4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

45. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135232 (Enterococcus faecium isolate E7025 plasmid 7) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

46. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135225 (Enterococcus faecium isolate E7040 plasmid 7) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

47. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135225 (Enterococcus faecium isolate E7040 plasmid 7) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

48. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135404 (Enterococcus faecium isolate E8377 plasmid 4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

49. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135404 (Enterococcus faecium isolate E8377 plasmid 4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

50. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135404 (Enterococcus faecium isolate E8377 plasmid 4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

51. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135397 (Enterococcus faecium isolate E8290 plasmid 4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

52. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135397 (Enterococcus faecium isolate E8290 plasmid 4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

53. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135397 (Enterococcus faecium isolate E8290 plasmid 4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

54. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135388 (Enterococcus faecium isolate E7933 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

55. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135388 (Enterococcus faecium isolate E7933 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

56. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135388 (Enterococcus faecium isolate E7933 plasmid 5) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

57. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR134113 (Enterococcus faecium isolate E6043 plasmid 0) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

58. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR134113 (Enterococcus faecium isolate E6043 plasmid 0) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

59. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NC_008259 (Enterococcus faecium plasmid pCIZ2, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

60. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NC_008259 (Enterococcus faecium plasmid pCIZ2, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

61. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NC_008259 (Enterococcus faecium plasmid pCIZ2, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

62. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP014532 (Enterococcus faecium strain E745 plasmid pl3, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

63. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP014532 (Enterococcus faecium strain E745 plasmid pl3, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

64. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP014532 (Enterococcus faecium strain E745 plasmid pl3, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

65. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP023427 (Enterococcus faecium strain K60-39 plasmid pTT39_p4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

66. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP023427 (Enterococcus faecium strain K60-39 plasmid pTT39_p4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

67. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP023427 (Enterococcus faecium strain K60-39 plasmid pTT39_p4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

68. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP044277 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-3, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

69. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP044277 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-3, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

70. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP044277 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-3, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

71. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP017796 (Enterococcus faecium strain E240 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

72. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP017796 (Enterococcus faecium strain E240 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

73. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP017796 (Enterococcus faecium strain E240 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

74. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135194 (Enterococcus faecium isolate E4438 plasmid 4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

75. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135194 (Enterococcus faecium isolate E4438 plasmid 4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

76. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135194 (Enterococcus faecium isolate E4438 plasmid 4) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

77. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NC_019240 (Enterococcus durans plasmid pGL, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

78. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NC_019240 (Enterococcus durans plasmid pGL, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

79. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NC_019240 (Enterococcus durans plasmid pGL, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

80. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to LR135187 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 3) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

81. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to LR135187 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 3) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

82. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to LR135187 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 3) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

83. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to MT074685 (Enterococcus faecium strain T-E1077-31 plasmid pT-E1077-31, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

84. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to MT074685 (Enterococcus faecium strain T-E1077-31 plasmid pT-E1077-31, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

85. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to MT074685 (Enterococcus faecium strain T-E1077-31 plasmid pT-E1077-31, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

86. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to MT074684 (Enterococcus faecium strain E1077 plasmid pE1077-23, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

87. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to MT074684 (Enterococcus faecium strain E1077 plasmid pE1077-23, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

88. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to MT074684 (Enterococcus faecium strain E1077 plasmid pE1077-23, complete sequence) position: , mismatch: 1, identity: 0.967

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacacta	Protospacer
 ******** *********************

89. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135232 (Enterococcus faecium isolate E7025 plasmid 7) position: , mismatch: 2, identity: 0.933

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacgcta	Protospacer
 ******** *****************.***

90. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR134113 (Enterococcus faecium isolate E6043 plasmid 0) position: , mismatch: 2, identity: 0.933

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacactat-gggggataaattgtcacgcta	Protospacer
 ******** *****************.***

91. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135232 (Enterococcus faecium isolate E7025 plasmid 7) position: , mismatch: 3, identity: 0.9

-cacactatggggggataaattgtcacacta	CRISPR spacer
tcacgctat-gggggataaatcgtcacacta	Protospacer
 ***.**** ***********.*********

92. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP016167 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p4, complete sequence) position: , mismatch: 5, identity: 0.833

cacactatggggggataaattg----tcacacta	CRISPR spacer
cacactatggggggataaattgtgttttac----	Protospacer
**********************    *.**    

93. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NC_021989 (Enterococcus faecium Aus0085 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

94. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP016167 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p4, complete sequence) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

95. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135291 (Enterococcus faecium isolate E7199 plasmid 5) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

96. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135262 (Enterococcus faecium isolate E4457 plasmid 5) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

97. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135432 (Enterococcus faecium isolate E8927 plasmid 5) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

98. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135208 (Enterococcus faecium isolate E7171 plasmid 6) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

99. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135348 (Enterococcus faecium isolate E8202 plasmid 5) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

100. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135411 (Enterococcus faecium isolate E8284 plasmid 4) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

101. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135377 (Enterococcus faecium isolate E8172 plasmid 6) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

102. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP011831 (Enterococcus faecium strain UW8175 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

103. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP040703 (Enterococcus faecium strain HOU503 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

104. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP033209 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.3, complete sequence) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

105. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135250 (Enterococcus faecium isolate E6988 plasmid 8) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

106. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135201 (Enterococcus faecium isolate E6055 plasmid 5) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

107. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135438 (Enterococcus faecium isolate E8691 plasmid 4) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

108. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135232 (Enterococcus faecium isolate E7025 plasmid 7) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

109. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135225 (Enterococcus faecium isolate E7040 plasmid 7) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

110. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135404 (Enterococcus faecium isolate E8377 plasmid 4) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

111. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135397 (Enterococcus faecium isolate E8290 plasmid 4) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

112. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135388 (Enterococcus faecium isolate E7933 plasmid 5) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

113. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR134113 (Enterococcus faecium isolate E6043 plasmid 0) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

114. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP014532 (Enterococcus faecium strain E745 plasmid pl3, complete sequence) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

115. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP023427 (Enterococcus faecium strain K60-39 plasmid pTT39_p4) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

116. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP044277 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-3, complete sequence) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

117. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_CP017796 (Enterococcus faecium strain E240 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

118. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NZ_LR135194 (Enterococcus faecium isolate E4438 plasmid 4) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

119. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NC_019240 (Enterococcus durans plasmid pGL, complete sequence) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtaatgggggataaattgtcacacta	Protospacer
   . **  *********************

120. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to LR135187 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 3) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

121. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to MT074685 (Enterococcus faecium strain T-E1077-31 plasmid pT-E1077-31, complete sequence) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

122. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to MT074684 (Enterococcus faecium strain E1077 plasmid pE1077-23, complete sequence) position: , mismatch: 7, identity: 0.767

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataaattgtcacacta	Protospacer
   . **  *********************

123. spacer 1.1|9201|30|NC_021989|CRISPRCasFinder matches to NC_008259 (Enterococcus faecium plasmid pCIZ2, complete sequence) position: , mismatch: 8, identity: 0.733

cacactatggggggataaattgtcacacta	CRISPR spacer
ataggtagtgggggataatttgtcacacta	Protospacer
   . **  ********* ***********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_021987
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021987_1 107175-107302 TypeV NA
2 spacers
cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP011282 Enterococcus faecium strain E39 plasmid p1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP025426 Enterococcus faecium strain SC4 plasmid p1, complete sequence 221215-221254 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 LT603679 Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2 452-491 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP018832 Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence 244126-244165 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP040369 Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP043485 Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence 27883-27922 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP020485 Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence 96547-96586 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP041262 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence 454-493 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP012385 Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence 95091-95130 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP013995 Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence 358204-358243 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP014450 Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence 119936-119975 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP018073 Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence 111370-111409 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP027518 Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP027498 Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP027507 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP027502 Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135298 Enterococcus faecium isolate E7429 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135288 Enterococcus faecium isolate E7199 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135333 Enterococcus faecium isolate E7471 plasmid 3 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135340 Enterococcus faecium isolate E7356 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP046076 Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 MT074686 Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP025756 Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence 126934-126973 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP027513 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135244 Enterococcus faecium isolate E6988 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135279 Enterococcus faecium isolate E6975 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135783 Enterococcus faecium isolate E4239 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135294 Enterococcus faecium isolate E7237 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135255 Enterococcus faecium isolate E7098 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135236 Enterococcus faecium isolate E7067 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135198 Enterococcus faecium isolate E6055 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135259 Enterococcus faecium isolate E4457 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135182 Enterococcus faecium isolate E1774 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP040905 Enterococcus faecium strain N56454 plasmid unnamed, complete sequence 153620-153659 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP041256 Enterococcus faecium strain 515 plasmid p26, complete sequence 129211-129250 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP019209 Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence 71269-71308 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP019989 Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence 249117-249156 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP017798 Enterococcus faecium strain E243 plasmid unnamed1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135429 Enterococcus faecium isolate E8927 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135436 Enterococcus faecium isolate E8691 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135483 Enterococcus faecium isolate E4456 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135476 Enterococcus faecium isolate E8423 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135204 Enterococcus faecium isolate E7171 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135180 Enterococcus faecium isolate E0595 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135227 Enterococcus faecium isolate E7025 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135489 Enterococcus faecium isolate E8414 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135365 Enterococcus faecium isolate E8195 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135220 Enterococcus faecium isolate E7040 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135415 Enterococcus faecium isolate E8328 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135395 Enterococcus faecium isolate E8290 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NC_021987 Enterococcus faecium Aus0085 plasmid p1, complete sequence 107198-107237 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135345 Enterococcus faecium isolate E8202 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135325 Enterococcus faecium isolate E7654 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135358 Enterococcus faecium isolate E7948 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135409 Enterococcus faecium isolate E8284 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135352 Enterococcus faecium isolate E8014 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP050649 Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE 91401-91440 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP050651 Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT 102425-102464 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135385 Enterococcus faecium isolate E7933 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP044265 Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135318 Enterococcus faecium isolate E7663 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR134106 Enterococcus faecium isolate E6043 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135373 Enterococcus faecium isolate E8172 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP006031 Enterococcus faecium T110 plasmid pEFT110, complete sequence 1397-1436 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP011829 Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence 60361-60400 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR132068 Enterococcus faecium isolate E0139 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_AP019395 Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LN999988 Enterococcus faecium isolate EFE11651 plasmid II, complete sequence 97676-97715 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP033042 Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence 52636-52675 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP025687 Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence 102650-102689 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP040741 Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP014530 Enterococcus faecium strain E745 plasmid pl1, complete sequence 200630-200669 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP023424 Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_AP022342 Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP040877 Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence 56542-56581 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP032307 Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence 65332-65371 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP040704 Enterococcus faecium strain HOU503 plasmid p1, complete sequence 67328-67367 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP044275 Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP017793 Enterococcus faecium strain E240 plasmid unnamed1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP019993 Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence 14571-14610 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP035655 Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP023790 Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP023800 Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP035137 Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence 178898-178937 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP035661 Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP035667 Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NC_017963 Enterococcus faecium DO plasmid 3, complete sequence 33081-33120 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP035649 Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP040850 Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence 105709-105748 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP042840 Enterococcus sp. DA9 plasmid unnamed4 39886-39925 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135171 Enterococcus faecium isolate E4227 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135192 Enterococcus faecium isolate E4438 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP041271 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP037956 Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence 35165-35204 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135308 Enterococcus faecium isolate E7240 plasmid 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP040237 Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP018066 Enterococcus faecium strain E1 plasmid pE1_230, complete sequence 225612-225651 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP023809 Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP033207 Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence 92045-92084 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP018129 Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence 17088-17127 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP023805 Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP035221 Enterococcus faecium strain SRCM103470 plasmid unnamed1 86167-86206 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_AP019409 Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NC_020208 Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence 61653-61692 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP034948 Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence 5084-5123 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP016164 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence 177278-177317 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP018827 Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence 244126-244165 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 LR135186 Enterococcus faecium isolate E4413 genome assembly, plasmid: 2 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP012461 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence 192112-192151 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP023795 Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_MG674581 Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP023781 Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence 453-492 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LT598664 Enterococcus faecium isolate Ef_aus00233 plasmid 2 168262-168301 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP025426 Enterococcus faecium strain SC4 plasmid p1, complete sequence 221173-221191 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP040906 Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence 51712-51730 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP027401 Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence 109405-109423 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP013995 Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence 358162-358180 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP014450 Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence 119894-119912 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP040905 Enterococcus faecium strain N56454 plasmid unnamed, complete sequence 153578-153596 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP041256 Enterococcus faecium strain 515 plasmid p26, complete sequence 129169-129187 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP019989 Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence 249075-249093 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP050649 Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE 91359-91377 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP050651 Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT 102383-102401 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP011829 Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence 60319-60337 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LN999988 Enterococcus faecium isolate EFE11651 plasmid II, complete sequence 97634-97652 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP033042 Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence 52594-52612 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP025687 Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence 102608-102626 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP040877 Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence 56500-56518 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP032307 Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence 65290-65308 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP019993 Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence 14529-14547 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NC_017963 Enterococcus faecium DO plasmid 3, complete sequence 33039-33057 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP042840 Enterococcus sp. DA9 plasmid unnamed4 39844-39862 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP033207 Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence 92003-92021 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP018129 Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence 17046-17064 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP042833 Enterococcus faecium strain FA3 plasmid unnamed1 47586-47604 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP012461 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence 192070-192088 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LT598664 Enterococcus faecium isolate Ef_aus00233 plasmid 2 168220-168238 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP011282 Enterococcus faecium strain E39 plasmid p1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 LT603679 Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2 515-533 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP018832 Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence 244189-244207 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP040369 Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP043485 Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence 27946-27964 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP020485 Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence 96610-96628 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP041262 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence 517-535 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP018073 Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence 111433-111451 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP027518 Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP027498 Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP027507 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP027502 Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135298 Enterococcus faecium isolate E7429 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135288 Enterococcus faecium isolate E7199 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135333 Enterococcus faecium isolate E7471 plasmid 3 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135340 Enterococcus faecium isolate E7356 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP046076 Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 MT074686 Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP025756 Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence 126997-127015 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP027513 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135244 Enterococcus faecium isolate E6988 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135279 Enterococcus faecium isolate E6975 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135783 Enterococcus faecium isolate E4239 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135294 Enterococcus faecium isolate E7237 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135255 Enterococcus faecium isolate E7098 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135236 Enterococcus faecium isolate E7067 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135198 Enterococcus faecium isolate E6055 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135259 Enterococcus faecium isolate E4457 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135182 Enterococcus faecium isolate E1774 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP019209 Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence 71332-71350 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP017798 Enterococcus faecium strain E243 plasmid unnamed1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135429 Enterococcus faecium isolate E8927 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135436 Enterococcus faecium isolate E8691 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135483 Enterococcus faecium isolate E4456 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135476 Enterococcus faecium isolate E8423 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135204 Enterococcus faecium isolate E7171 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135175 Enterococcus faecium isolate E4402 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135227 Enterococcus faecium isolate E7025 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135489 Enterococcus faecium isolate E8414 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135365 Enterococcus faecium isolate E8195 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135220 Enterococcus faecium isolate E7040 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135415 Enterococcus faecium isolate E8328 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135395 Enterococcus faecium isolate E8290 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NC_021987 Enterococcus faecium Aus0085 plasmid p1, complete sequence 107261-107279 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135345 Enterococcus faecium isolate E8202 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135325 Enterococcus faecium isolate E7654 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135358 Enterococcus faecium isolate E7948 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135409 Enterococcus faecium isolate E8284 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135352 Enterococcus faecium isolate E8014 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135385 Enterococcus faecium isolate E7933 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP044265 Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135318 Enterococcus faecium isolate E7663 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR134106 Enterococcus faecium isolate E6043 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135373 Enterococcus faecium isolate E8172 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP006031 Enterococcus faecium T110 plasmid pEFT110, complete sequence 1460-1478 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_AP019395 Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP045013 Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP040741 Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP014530 Enterococcus faecium strain E745 plasmid pl1, complete sequence 200693-200711 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP023424 Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_AP022342 Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP040704 Enterococcus faecium strain HOU503 plasmid p1, complete sequence 67391-67409 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP040873 Enterococcus faecium strain DB-1 plasmid punnamed1 40046-40064 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP040876 Enterococcus faecium strain DB-1 plasmid punnamed2 2896-2914 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP044275 Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP017793 Enterococcus faecium strain E240 plasmid unnamed1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP035655 Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP023790 Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP023800 Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP035137 Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence 178961-178979 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP035661 Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP035667 Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR134096 Enterococcus faecium isolate E1334 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP035649 Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP040850 Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence 105772-105790 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135171 Enterococcus faecium isolate E4227 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135192 Enterococcus faecium isolate E4438 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP041271 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_LR135308 Enterococcus faecium isolate E7240 plasmid 2 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP040237 Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP018066 Enterococcus faecium strain E1 plasmid pE1_230, complete sequence 225675-225693 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP023809 Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP023805 Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP035221 Enterococcus faecium strain SRCM103470 plasmid unnamed1 86230-86248 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_AP019409 Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NC_020208 Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence 61716-61734 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP034948 Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence 5147-5165 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP016164 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence 177341-177359 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP018827 Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence 244189-244207 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP023795 Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_MG674581 Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence 516-534 0 1.0
NC_021987_1 1.2|107261|19|NC_021987|CRISPRCasFinder 107261-107279 19 NZ_CP023781 Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence 516-534 0 1.0
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP027401 Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence 109447-109486 1 0.975
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR135175 Enterococcus faecium isolate E4402 plasmid 2 453-492 1 0.975
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_LR134096 Enterococcus faecium isolate E1334 plasmid 2 453-492 1 0.975
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP042833 Enterococcus faecium strain FA3 plasmid unnamed1 47628-47667 1 0.975
NC_021987_1 1.1|107198|40|NC_021987|CRISPRCasFinder 107198-107237 40 NZ_CP012367 Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence 3358-3397 5 0.875

1. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP011282 (Enterococcus faecium strain E39 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

2. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

3. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to LT603679 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

4. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

5. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

6. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP043485 (Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

7. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

8. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

9. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP012385 (Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

10. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

11. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

12. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP018073 (Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

13. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

14. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP027498 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

15. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP027507 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

16. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

17. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

18. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135288 (Enterococcus faecium isolate E7199 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

19. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135333 (Enterococcus faecium isolate E7471 plasmid 3) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

20. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

21. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

22. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

23. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

24. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

25. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135244 (Enterococcus faecium isolate E6988 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

26. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135279 (Enterococcus faecium isolate E6975 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

27. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

28. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

29. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135255 (Enterococcus faecium isolate E7098 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

30. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135236 (Enterococcus faecium isolate E7067 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

31. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

32. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

33. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135182 (Enterococcus faecium isolate E1774 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

34. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP040905 (Enterococcus faecium strain N56454 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

35. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP041256 (Enterococcus faecium strain 515 plasmid p26, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

36. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP019209 (Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

37. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

38. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP017798 (Enterococcus faecium strain E243 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

39. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

40. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

41. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

42. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

43. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

44. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135180 (Enterococcus faecium isolate E0595 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

45. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135227 (Enterococcus faecium isolate E7025 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

46. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

47. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

48. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135220 (Enterococcus faecium isolate E7040 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

49. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

50. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

51. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NC_021987 (Enterococcus faecium Aus0085 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

52. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

53. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135325 (Enterococcus faecium isolate E7654 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

54. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

55. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

56. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

57. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

58. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

59. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

60. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

61. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135318 (Enterococcus faecium isolate E7663 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

62. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR134106 (Enterococcus faecium isolate E6043 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

63. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

64. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

65. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

66. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR132068 (Enterococcus faecium isolate E0139 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

67. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

68. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

69. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

70. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

71. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

72. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

73. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

74. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

75. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

76. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

77. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

78. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

79. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP017793 (Enterococcus faecium strain E240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

80. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP019993 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

81. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

82. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

83. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

84. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

85. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

86. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

87. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

88. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

89. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP040850 (Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

90. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

91. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

92. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

93. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

94. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP037956 (Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

95. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135308 (Enterococcus faecium isolate E7240 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

96. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

97. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

98. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

99. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP033207 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

100. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

101. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

102. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

103. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_AP019409 (Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

104. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

105. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

106. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

107. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

108. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to LR135186 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

109. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP012461 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

110. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

111. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_MG674581 (Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

112. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

113. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

114. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

115. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP040906 (Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

116. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP027401 (Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

117. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

118. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

119. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP040905 (Enterococcus faecium strain N56454 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

120. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP041256 (Enterococcus faecium strain 515 plasmid p26, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

121. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

122. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

123. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

124. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

125. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

126. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

127. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

128. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

129. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

130. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP019993 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

131. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

132. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

133. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP033207 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

134. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

135. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

136. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP012461 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

137. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

138. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP011282 (Enterococcus faecium strain E39 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

139. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to LT603679 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

140. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

141. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

142. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP043485 (Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

143. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

144. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

145. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP018073 (Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

146. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

147. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP027498 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

148. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP027507 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

149. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

150. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

151. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135288 (Enterococcus faecium isolate E7199 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

152. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135333 (Enterococcus faecium isolate E7471 plasmid 3) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

153. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

154. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

155. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

156. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

157. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

158. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135244 (Enterococcus faecium isolate E6988 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

159. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135279 (Enterococcus faecium isolate E6975 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

160. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

161. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

162. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135255 (Enterococcus faecium isolate E7098 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

163. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135236 (Enterococcus faecium isolate E7067 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

164. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

165. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

166. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135182 (Enterococcus faecium isolate E1774 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

167. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP019209 (Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

168. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP017798 (Enterococcus faecium strain E243 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

169. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

170. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

171. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

172. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

173. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

174. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135175 (Enterococcus faecium isolate E4402 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

175. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135227 (Enterococcus faecium isolate E7025 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

176. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

177. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

178. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135220 (Enterococcus faecium isolate E7040 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

179. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

180. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

181. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NC_021987 (Enterococcus faecium Aus0085 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

182. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

183. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135325 (Enterococcus faecium isolate E7654 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

184. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

185. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

186. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

187. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

188. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

189. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135318 (Enterococcus faecium isolate E7663 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

190. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR134106 (Enterococcus faecium isolate E6043 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

191. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

192. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

193. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

194. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP045013 (Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

195. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

196. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

197. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

198. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

199. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

200. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP040873 (Enterococcus faecium strain DB-1 plasmid punnamed1) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

201. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP040876 (Enterococcus faecium strain DB-1 plasmid punnamed2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

202. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

203. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP017793 (Enterococcus faecium strain E240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

204. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

205. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

206. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

207. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

208. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

209. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

210. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR134096 (Enterococcus faecium isolate E1334 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

211. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

212. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP040850 (Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

213. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

214. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

215. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

216. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_LR135308 (Enterococcus faecium isolate E7240 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

217. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

218. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

219. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

220. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

221. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

222. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_AP019409 (Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

223. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

224. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

225. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

226. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

227. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

228. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_MG674581 (Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

229. spacer 1.2|107261|19|NC_021987|CRISPRCasFinder matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

230. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP027401 (Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct	Protospacer
********************.*******************

231. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR135175 (Enterococcus faecium isolate E4402 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct	Protospacer
********************.*******************

232. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_LR134096 (Enterococcus faecium isolate E1334 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct	Protospacer
********************.*******************

233. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
catcctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
**.*************************************

234. spacer 1.1|107198|40|NC_021987|CRISPRCasFinder matches to NZ_CP012367 (Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence) position: , mismatch: 5, identity: 0.875

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatccttggggctc	Protospacer
*******************************.* *** ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14292 : 76320 49 Paenibacillus_phage(25.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_021994
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021994_1 2522825-2522934 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 555902 : 563533 9 Streptococcus_phage(87.5%) NA NA
DBSCAN-SWA_2 571818 : 578861 8 Streptococcus_phage(100.0%) integrase attL 567239:567253|attR 579629:579643
DBSCAN-SWA_3 701280 : 709752 9 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_4 776917 : 863318 96 Enterococcus_phage(33.33%) portal,holin,terminase,integrase,head,tRNA,transposase,protease,capsid,tail attL 775324:775338|attR 781538:781552
DBSCAN-SWA_5 877175 : 910779 51 Bacillus_phage(18.52%) portal,holin,terminase,head,integrase,protease,capsid,plate,tail attL 871977:871991|attR 879042:879056
DBSCAN-SWA_6 1239613 : 1248759 9 Lysinibacillus_phage(16.67%) transposase NA
DBSCAN-SWA_7 1819342 : 1870111 49 Streptococcus_phage(30.0%) tRNA,transposase,integrase attL 1856818:1856833|attR 1867552:1867567
DBSCAN-SWA_8 1904766 : 1911040 9 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_9 2165149 : 2227989 60 Enterococcus_phage(25.0%) holin,tRNA,transposase,tail NA
DBSCAN-SWA_10 2232659 : 2251254 25 Enterococcus_phage(44.44%) portal,terminase NA
DBSCAN-SWA_11 2339125 : 2347384 7 Bacillus_virus(33.33%) tRNA,transposase NA
DBSCAN-SWA_12 2435922 : 2503463 73 Enterococcus_phage(31.71%) portal,holin,terminase,head,integrase,bacteriocin,transposase,protease,capsid,plate,tail attL 2447984:2448043|attR 2491648:2491708
DBSCAN-SWA_13 2812492 : 2921023 93 Streptococcus_phage(56.67%) tRNA,transposase,integrase attL 2827141:2827156|attR 2923011:2923025
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_021988
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1879 : 13565 15 Streptococcus_phage(90.0%) transposase NA
DBSCAN-SWA_2 19684 : 30324 15 Bacillus_phage(30.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage