Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_021877 Burkholderia pseudomallei MSHR305 chromosome 2, complete sequence 2 crisprs csa3,cas3,RT 1 0 4 0
NC_021884 Burkholderia pseudomallei MSHR305 chromosome 1, complete sequence 2 crisprs DinG,DEDDh,WYL,cas3,csa3 0 0 9 0

Results visualization

1. NC_021877
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021877_1 2608739-2608901 Orphan NA
2 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021877_2 2802757-2802842 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_021877_1 1.2|2608854|21|NC_021877|CRISPRCasFinder 2608854-2608874 21 NC_021877.1 2608886-2608906 0 1.0
NC_021877_1 1.2|2608854|21|NC_021877|CRISPRCasFinder 2608854-2608874 21 NC_021877.1 2608894-2608914 0 1.0
NC_021877_1 1.2|2608854|21|NC_021877|CRISPRCasFinder 2608854-2608874 21 NC_021877.1 2608902-2608922 0 1.0

1. spacer 1.2|2608854|21|NC_021877|CRISPRCasFinder matches to position: 2608886-2608906, mismatch: 0, identity: 1.0

gacagcacgacagcacgacag	CRISPR spacer
gacagcacgacagcacgacag	Protospacer
*********************

2. spacer 1.2|2608854|21|NC_021877|CRISPRCasFinder matches to position: 2608894-2608914, mismatch: 0, identity: 1.0

gacagcacgacagcacgacag	CRISPR spacer
gacagcacgacagcacgacag	Protospacer
*********************

3. spacer 1.2|2608854|21|NC_021877|CRISPRCasFinder matches to position: 2608902-2608922, mismatch: 0, identity: 1.0

gacagcacgacagcacgacag	CRISPR spacer
gacagcacgacagcacgacag	Protospacer
*********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 259712 : 331228 53 Vibrio_phage(25.0%) plate,holin NA
DBSCAN-SWA_2 1065273 : 1072034 8 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_3 2049365 : 2131656 44 Leptospira_phage(18.18%) portal,transposase,protease,tRNA NA
DBSCAN-SWA_4 2502762 : 2574069 47 Planktothrix_phage(14.29%) plate,transposase,integrase attL 2497390:2497409|attR 2577668:2577687
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_021884
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021884_1 906583-906724 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021884_2 2191135-2191214 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1354755 : 1365712 10 Agrobacterium_phage(16.67%) protease NA
DBSCAN-SWA_2 2120502 : 2185668 58 Streptococcus_phage(12.5%) transposase,portal,protease,tRNA NA
DBSCAN-SWA_3 2400031 : 2411250 10 Burkholderia_virus(22.22%) integrase attL 2397444:2397461|attR 2414030:2414047
DBSCAN-SWA_4 2655509 : 2682071 30 Burkholderia_phage(44.44%) tail,protease,plate,integrase attL 2656082:2656128|attR 2671559:2671605
DBSCAN-SWA_5 3031530 : 3040775 7 Hokovirus(16.67%) NA NA
DBSCAN-SWA_6 3378977 : 3387792 8 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_7 3462894 : 3542132 81 Burkholderia_virus(30.3%) portal,head,terminase,integrase,holin,tail,protease attL 3469440:3469457|attR 3492230:3492247
DBSCAN-SWA_8 3692675 : 3785056 100 uncultured_Caudovirales_phage(22.73%) capsid,portal,head,lysis,terminase,plate,integrase,tail,tRNA,protease attL 3701447:3701465|attR 3759628:3759646
DBSCAN-SWA_9 3978101 : 3986294 12 Burkholderia_virus(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage