Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_021872 Lactobacillus reuteri TD1, complete sequence 1 crisprs cas14j,cas3,DEDDh,RT,DinG,csn2,cas2,cas1,csa3 0 3 4 0

Results visualization

1. NC_021872
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021872_1 1286441-1286805 TypeII-A,TypeV NA
5 spacers
cas14j,csn2,cas2,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_021872_1 1.1|1286476|31|NC_021872|CRT 1286476-1286506 31 NZ_CP041677 Lactobacillus reuteri strain LL7 plasmid unnamed, complete sequence 110812-110842 1 0.968
NC_021872_1 1.1|1286476|31|NC_021872|CRT 1286476-1286506 31 NZ_CP030090 Lactobacillus reuteri strain YSJL-12 plasmid unnamed1, complete sequence 32973-33003 2 0.935
NC_021872_1 1.1|1286476|31|NC_021872|CRT 1286476-1286506 31 NC_042091 Pseudomonas phage nickie, complete genome 8537-8567 6 0.806
NC_021872_1 1.6|1286543|30|NC_021872|PILER-CR 1286543-1286572 30 NZ_CP011133 Citrobacter amalonaticus Y19 plasmid unnamed, complete sequence 40215-40244 8 0.733
NC_021872_1 1.2|1286542|31|NC_021872|CRT,CRISPRCasFinder 1286542-1286572 31 NZ_CP011133 Citrobacter amalonaticus Y19 plasmid unnamed, complete sequence 40214-40244 9 0.71

1. spacer 1.1|1286476|31|NC_021872|CRT matches to NZ_CP041677 (Lactobacillus reuteri strain LL7 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.968

cttcattggagttccaggacatcttcccaga	CRISPR spacer
cttcattggagttccaggacatcttcccagt	Protospacer
****************************** 

2. spacer 1.1|1286476|31|NC_021872|CRT matches to NZ_CP030090 (Lactobacillus reuteri strain YSJL-12 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.935

cttcattggagttccaggacatcttcccaga	CRISPR spacer
cttcattggagctccaggacatcttcccagt	Protospacer
***********.****************** 

3. spacer 1.1|1286476|31|NC_021872|CRT matches to NC_042091 (Pseudomonas phage nickie, complete genome) position: , mismatch: 6, identity: 0.806

cttcattg--gagttccaggacatcttcccaga	CRISPR spacer
--tgatggacgagttccaggacatccgcccaga	Protospacer
  * ** *  ***************. ******

4. spacer 1.6|1286543|30|NC_021872|PILER-CR matches to NZ_CP011133 (Citrobacter amalonaticus Y19 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

ggaggtattacatgaatgcacaataatcta	CRISPR spacer
acttgcattaagtgaatgcacaataatctt	Protospacer
.   *.**** .***************** 

5. spacer 1.2|1286542|31|NC_021872|CRT,CRISPRCasFinder matches to NZ_CP011133 (Citrobacter amalonaticus Y19 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

ggaggtattacatgaatgcacaataatctag	CRISPR spacer
acttgcattaagtgaatgcacaataatcttt	Protospacer
.   *.**** .*****************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 950687 : 958752 8 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_2 1285101 : 1339578 78 Lactobacillus_phage(29.41%) capsid,integrase,portal,plate,terminase,transposase attL 1335103:1335118|attR 1345083:1345098
DBSCAN-SWA_3 1623501 : 1633084 8 Paenibacillus_phage(33.33%) transposase NA
DBSCAN-SWA_4 1763620 : 1852392 54 Paenibacillus_phage(28.57%) protease,integrase,transposase attL 1757328:1757344|attR 1850173:1850189
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage