Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_021662 Psychrobacter sp. G plasmid PsyG_4, complete sequence 0 crisprs NA 0 0 0 0
NC_021669 Psychrobacter sp. G plasmid PsyG_3, complete sequence 1 crisprs NA 0 1 0 0
NC_021661 Psychrobacter sp. G, complete sequence 2 crisprs c2c9_V-U4,DEDDh,WYL,csa3,cas1,cas3f,cas8f,cas5f,cas7f,cas6f,RT,cas3 0 3 3 0
NC_021668 Psychrobacter sp. G plasmid PsyG_26, complete sequence 0 crisprs NA 0 0 3 0

Results visualization

1. NC_021661
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021661_1 1340645-1340744 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021661_2 2135301-2135862 TypeI-F NA
9 spacers
cas6f,cas7f,cas5f,cas8f,cas3f,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_021661_2 2.7|2135689|26|NC_021661|CRISPRCasFinder,PILER-CR 2135689-2135714 26 MK630230 Klebsiella phage Spivey, complete genome 106099-106124 4 0.846
NC_021661_2 2.7|2135689|26|NC_021661|CRISPRCasFinder,PILER-CR 2135689-2135714 26 MN163280 Klebsiella phage KpGranit, complete genome 14636-14661 4 0.846
NC_021661_2 2.7|2135689|26|NC_021661|CRISPRCasFinder,PILER-CR 2135689-2135714 26 MG459987 Klebsiella phage Sugarland, complete genome 15024-15049 4 0.846
NC_021661_2 2.7|2135689|26|NC_021661|CRISPRCasFinder,PILER-CR 2135689-2135714 26 MK521907 Klebsiella phage vB_KpnS_FZ41, complete genome 4560-4585 4 0.846
NC_021661_2 2.7|2135689|26|NC_021661|CRISPRCasFinder,PILER-CR 2135689-2135714 26 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 14624-14649 4 0.846
NC_021661_2 2.5|2135569|32|NC_021661|CRISPRCasFinder,PILER-CR 2135569-2135600 32 NC_010632 Nostoc punctiforme PCC 73102 plasmid pNPUN02, complete sequence 194852-194883 7 0.781
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 MK630230 Klebsiella phage Spivey, complete genome 106093-106124 7 0.781
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 MK521907 Klebsiella phage vB_KpnS_FZ41, complete genome 4560-4591 7 0.781
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 14624-14655 7 0.781
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP022495 Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence 233838-233869 8 0.75
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_KX832927 Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence 183453-183484 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP045446 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence 229792-229823 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_LT904879 Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2 2596-2627 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_KU355873 Escherichia coli strain FAM22871 plasmid pFAM22871_1, complete sequence 124675-124706 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_015965 Salmonella enterica subsp. enterica serovar Typhimurium plasmid R621a, complete sequence 27979-28010 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_KM406488 Salmonella enterica subsp. enterica serovar Paratyphi B strain R69 plasmid R69, complete sequence 76249-76280 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP010141 Escherichia coli strain D3 plasmid A, complete sequence 14207-14238 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP010141 Escherichia coli strain D3 plasmid A, complete sequence 24401-24432 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP010373 Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence 91555-91586 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP044256 Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence 240365-240396 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP045449 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence 229791-229822 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_009981 Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence 73865-73896 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP021087 Escherichia coli strain 13P460A plasmid p13P460A-2, complete sequence 58619-58650 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029645 Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence 165710-165741 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 59336-59367 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP019559 Escherichia coli strain KSC207 plasmid pMRGN207, complete sequence 125491-125522 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP039717 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence 233082-233113 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 KP899804 Salmonella enterica strain F8475 plasmid pF8475, complete sequence 39417-39448 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 KP899805 Salmonella enterica strain 109/9 plasmid p109/9, complete sequence 30411-30442 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 KP899806 Salmonella enterica strain B71 plasmid pB71, complete sequence 18364-18395 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP037875 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence 25167-25198 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP018652 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence 91784-91815 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP019251 Escherichia coli strain 13KWH46 plasmid p13KWH46-1, complete sequence 27947-27978 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_025127 Vibrio sp. 04Ya090 plasmid pAQU2 DNA, complete sequence 119930-119961 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP019268 Escherichia coli strain 13C1079T plasmid p13C1079T-1, complete sequence 16479-16510 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_018998 Escherichia coli F18+ plasmid pTC1, complete sequence 37486-37517 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_003384 Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence 181813-181844 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP025277 Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60984 plasmid pSJO-60984, complete sequence 202391-202422 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP030182 Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence 89476-89507 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP030329 Escherichia coli strain AR_452 plasmid unnamed1, complete sequence 64040-64071 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP039559 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence 231234-231265 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP024652 Escherichia coli strain BH100 substr. MG2014 plasmid pBH100-1, complete sequence 34012-34043 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 CP031284 Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence 157672-157703 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 MK492260 Escherichia coli strain MG1655 K12 plasmid F-Tn10, complete sequence 21443-21474 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 LC081338 Vibrio sp. 04Ya108 plasmid pSEA1 DNA, complete genome 205093-205124 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP040928 Escherichia coli strain YY76-1 plasmid pYY76-1-1, complete sequence 75421-75452 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_008690 Vibrio sp. TC68 plasmid pTC68, complete sequence 7665-7696 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_024960 Escherichia coli plasmid pIS04_68, strain ISO4, complete sequence 17803-17834 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_005014 Salmonella enterica subsp. enterica serovar Typhimurium plasmid R64, complete sequence 15389-15420 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP017221 Escherichia coli strain FAM21845 plasmid pFAM21845_1, complete sequence 20552-20583 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_LT985319 Escherichia coli strain ECOR 30 genome assembly, plasmid: RCS96_pII 54029-54060 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 71314-71345 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_009139 Yersinia ruckeri YR71 plasmid pYR1, complete sequence 133432-133463 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_023911 Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence 38176-38207 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP013027 Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence 134316-134347 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP030921 Escherichia coli strain KL53 plasmid pKL53-M, complete sequence 6579-6610 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_019122 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH163_120, complete sequence 103853-103884 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP025751 Escherichia coli strain CV839-06 plasmid pCV839-06-p1, complete sequence 22660-22691 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP024254 Escherichia coli strain ATCC 43886 plasmid unnamed1, complete sequence 22251-22282 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 CP043758 Escherichia coli strain CVM N55972 plasmid pN55972-2, complete sequence 529-560 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP024129 Escherichia coli strain 14EC001 plasmid p14EC001b, complete sequence 56142-56173 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_002305 Salmonella typhi plasmid R27, complete sequence 76681-76712 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 CP022610 Escherichia coli strain ATCC 700415 plasmid unnamed, complete sequence 112141-112172 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP012931 Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence 22326-22357 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029895 Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence 166031-166062 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029877 Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence 165829-165860 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_005211 Serratia marcescens plasmid R478, complete sequence 209226-209257 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 17858-17889 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP023959 Escherichia coli strain FDAARGOS_448 plasmid unnamed1, complete sequence 80035-80066 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_002134 Shigella flexneri 2b plasmid R100 DNA, complete sequence 38834-38865 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_016983 Photobacterium damselae subsp. damselae plasmid pAQU1, complete sequence 163323-163354 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 LT905061 Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2 53360-53391 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029248 Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_D, complete sequence 127742-127773 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029926 Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence 107958-107989 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029947 Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence 167374-167405 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 CP051274 Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Partridge_SW-37 plasmid pSW37-267109, complete sequence 69541-69572 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_009133 Escherichia coli plasmid NR1, complete sequence 38834-38865 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP044968 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence 82867-82898 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP044958 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence 15091-15122 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029979 Escherichia coli strain 99-3165 plasmid unnamed1 8408-8439 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_011743 Escherichia fergusonii ATCC 35469 plasmid pEFER, complete sequence 44952-44983 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 CP051271 Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Quail_SW-70 plasmid pSW37-267106, complete sequence 52929-52960 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 KX957968 Vibrio alginolyticus plasmid pVAS19, complete sequence 102524-102555 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029943 Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence 165818-165849 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029953 Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence 166141-166172 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029955 Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence 166086-166117 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP022495 Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence 18752-18783 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP025139 Escherichia coli strain BH100L substr. MG2017 plasmid pBH100alpha, complete sequence 38936-38967 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_LR740759 Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid paAPEC5202 82046-82077 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029924 Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence 32693-32724 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029934 Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence 165829-165860 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_019117 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH696_117, complete sequence 100473-100504 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029744 Escherichia coli strain AR_0085 plasmid unnamed3, complete sequence 83633-83664 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 CP052139 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence 31057-31088 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP022673 Shigella sonnei strain 866 plasmid p866, complete sequence 68749-68780 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_013365 Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence 93994-94025 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP015836 Escherichia coli strain MS6198 plasmid pMS6198B, complete sequence 33427-33458 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 137772-137803 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029939 Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence 164539-164570 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_018954 Salmonella enterica subsp. enterica serovar Kentucky plasmid pCS0010A, complete sequence 12359-12390 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_018966 Salmonella enterica subsp. enterica serovar Kentucky plasmid pSSAP03302A, complete sequence 12359-12390 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029957 Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence 165594-165625 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029941 Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence 165921-165952 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029910 Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence 165829-165860 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_AP018352 Enterobacter hormaechei strain TUM11043 plasmid pMTY11043_IncHI2, complete sequence 77319-77350 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_011812 Escherichia coli plasmid pO26-L, complete sequence 15558-15589 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029887 Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence 165655-165686 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029948 Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence 166031-166062 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029937 Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence 165557-165588 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029879 Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence 163343-163374 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP025253 Escherichia coli strain BH100 substr. MG2017 plasmid pBH100-1, complete sequence 34016-34047 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 MH114596 Salmonella enterica strain 13-1681 plasmid p131681, complete sequence 139589-139620 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP024910 Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L plasmid pOSUKPC4, complete sequence 126517-126548 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP018656 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence 157673-157704 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_016825 Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence 147067-147098 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029931 Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence 165662-165693 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP029935 Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence 165446-165477 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP044051 Klebsiella variicola strain FDAARGOS_627 plasmid unnamed2, complete sequence 65299-65330 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP025254 Escherichia coli strain BH100L substr. MG2014 plasmid pBH100alpha, complete sequence 34010-34041 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP014320 Escherichia coli JJ1887 plasmid pJJ1887-5, complete sequence 59640-59671 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_LT985304 Escherichia coli strain ECOR 31 plasmid RCS89_p, complete sequence 89206-89237 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_LT985296 Escherichia coli strain 1454 plasmid RCS78_p, complete sequence 235119-235150 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP026934 Escherichia coli strain CFS3273 plasmid pCFS3273-2, complete sequence 39943-39974 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_MK291500 Escherichia coli strain 15978 plasmid pHN15978-1, complete sequence 80036-80067 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_MK878891 Escherichia coli strain J53 plasmid pMG336, complete sequence 63562-63593 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_MK878890 Escherichia coli strain J53 plasmid pMG337, complete sequence 64019-64050 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_MK758104 Escherichia coli strain 0126:B16 plasmid R16, complete sequence 16590-16621 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 301072-301103 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP018299 Photobacterium damselae strain Phdp Wu-1 plasmid plas1, complete sequence 112917-112948 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_MH105051 Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncHI2, complete sequence 103723-103754 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_MH422552 Escherichia coli strain L-I1 plasmid pIncFIB, complete sequence 49690-49721 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_MH626558 Salmonella enterica subsp. enterica serovar Typhimurium strain ST1007 plasmid pST1007-1B, complete sequence 91709-91740 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_MH760469 Salmonella enterica strain 2016K-0796 plasmid p2016K-0796, complete sequence 140370-140401 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_MK169211 Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence 174558-174589 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP006635 Escherichia coli PCN033 plasmid p3PCN033, complete sequence 157540-157571 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_MG904992 Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence 123501-123532 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_MF174860 Escherichia coli strain 6/14/6b plasmid pIncF-MU4, complete sequence 60817-60848 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_MF344581 Enterobacter cloacae strain 13E573 plasmid p13E573-HI2, complete sequence 190356-190387 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_MH202955 Escherichia coli strain HXH-1 plasmid pHXH-1, complete sequence 41610-41641 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_MG948335 Escherichia coli strain 3498 plasmid p3498, complete sequence 132184-132215 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_023277 Escherichia coli strain 63743 plasmid pEQ2, complete sequence 100786-100817 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NC_023289 Escherichia coli strain T23 plasmid pEQ1, complete sequence 100835-100866 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 NZ_CP044190 Salmonella enterica subsp. enterica strain AR-0401 plasmid pAR-0401-2, complete sequence 150-181 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 MN163280 Klebsiella phage KpGranit, complete genome 14636-14667 9 0.719
NC_021661_2 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR 2135743-2135774 32 MG459987 Klebsiella phage Sugarland, complete genome 15024-15055 9 0.719

1. spacer 2.7|2135689|26|NC_021661|CRISPRCasFinder,PILER-CR matches to MK630230 (Klebsiella phage Spivey, complete genome) position: , mismatch: 4, identity: 0.846

atcagctcatcacgttcttcgtttac	CRISPR spacer
ctcagctcaacacgttcttcgtctag	Protospacer
 ******** ************.** 

2. spacer 2.7|2135689|26|NC_021661|CRISPRCasFinder,PILER-CR matches to MN163280 (Klebsiella phage KpGranit, complete genome) position: , mismatch: 4, identity: 0.846

atcagctcatcacgttcttcgtttac	CRISPR spacer
ctcagctcaacacgttcttcgtctag	Protospacer
 ******** ************.** 

3. spacer 2.7|2135689|26|NC_021661|CRISPRCasFinder,PILER-CR matches to MG459987 (Klebsiella phage Sugarland, complete genome) position: , mismatch: 4, identity: 0.846

atcagctcatcacgttcttcgtttac	CRISPR spacer
ctcagctcaacacgttcttcgtctag	Protospacer
 ******** ************.** 

4. spacer 2.7|2135689|26|NC_021661|CRISPRCasFinder,PILER-CR matches to MK521907 (Klebsiella phage vB_KpnS_FZ41, complete genome) position: , mismatch: 4, identity: 0.846

atcagctcatcacgttcttcgtttac	CRISPR spacer
ctcagctcaacacgttcttcgtctaa	Protospacer
 ******** ************.** 

5. spacer 2.7|2135689|26|NC_021661|CRISPRCasFinder,PILER-CR matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 4, identity: 0.846

atcagctcatcacgttcttcgtttac	CRISPR spacer
ctcagctcaacacgttcttcgtctag	Protospacer
 ******** ************.** 

6. spacer 2.5|2135569|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_010632 (Nostoc punctiforme PCC 73102 plasmid pNPUN02, complete sequence) position: , mismatch: 7, identity: 0.781

--gccatcggtcaatagctactggaaaagaaaca	CRISPR spacer
cagtaat--atcaattgctactggaaacgaaaca	Protospacer
  *. **  .***** *********** ******

7. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to MK630230 (Klebsiella phage Spivey, complete genome) position: , mismatch: 7, identity: 0.781

atcagctcatcacgttcttcgttta-cttttgc	CRISPR spacer
ctcagctcaacacgttcttcgtctagcgcctg-	Protospacer
 ******** ************.** * ..** 

8. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to MK521907 (Klebsiella phage vB_KpnS_FZ41, complete genome) position: , mismatch: 7, identity: 0.781

atcagctcatcacgttcttcgttt-acttttgc	CRISPR spacer
ctcagctcaacacgttcttcgtctaacgcctg-	Protospacer
 ******** ************.* ** ..** 

9. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 7, identity: 0.781

atcagctcatcacgttcttcgttta-cttttgc	CRISPR spacer
ctcagctcaacacgttcttcgtctagcgcctg-	Protospacer
 ******** ************.** * ..** 

10. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

--atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
tgataaa--aatcaggttattcgtttacttttga	Protospacer
  ** *.   **** *** ************** 

11. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_KX832927 (Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

12. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

13. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

14. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_KU355873 (Escherichia coli strain FAM22871 plasmid pFAM22871_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

15. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_015965 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R621a, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

16. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_KM406488 (Salmonella enterica subsp. enterica serovar Paratyphi B strain R69 plasmid R69, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

17. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP010141 (Escherichia coli strain D3 plasmid A, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

18. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP010141 (Escherichia coli strain D3 plasmid A, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

19. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

20. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP044256 (Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

21. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

22. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_009981 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

23. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP021087 (Escherichia coli strain 13P460A plasmid p13P460A-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

24. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

25. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

26. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP019559 (Escherichia coli strain KSC207 plasmid pMRGN207, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

27. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

28. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to KP899804 (Salmonella enterica strain F8475 plasmid pF8475, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

29. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to KP899805 (Salmonella enterica strain 109/9 plasmid p109/9, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

30. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to KP899806 (Salmonella enterica strain B71 plasmid pB71, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

31. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

32. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

33. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP019251 (Escherichia coli strain 13KWH46 plasmid p13KWH46-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

34. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_025127 (Vibrio sp. 04Ya090 plasmid pAQU2 DNA, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

35. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP019268 (Escherichia coli strain 13C1079T plasmid p13C1079T-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

36. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_018998 (Escherichia coli F18+ plasmid pTC1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

37. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_003384 (Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

38. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP025277 (Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60984 plasmid pSJO-60984, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

39. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

40. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP030329 (Escherichia coli strain AR_452 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

41. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

42. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP024652 (Escherichia coli strain BH100 substr. MG2014 plasmid pBH100-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

43. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

44. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to MK492260 (Escherichia coli strain MG1655 K12 plasmid F-Tn10, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

45. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to LC081338 (Vibrio sp. 04Ya108 plasmid pSEA1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

46. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP040928 (Escherichia coli strain YY76-1 plasmid pYY76-1-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

47. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_008690 (Vibrio sp. TC68 plasmid pTC68, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

48. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_024960 (Escherichia coli plasmid pIS04_68, strain ISO4, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

49. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_005014 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R64, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

50. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP017221 (Escherichia coli strain FAM21845 plasmid pFAM21845_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

51. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_LT985319 (Escherichia coli strain ECOR 30 genome assembly, plasmid: RCS96_pII) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

52. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

53. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_009139 (Yersinia ruckeri YR71 plasmid pYR1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

54. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_023911 (Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

55. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP013027 (Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

56. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP030921 (Escherichia coli strain KL53 plasmid pKL53-M, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

57. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_019122 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH163_120, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

58. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP025751 (Escherichia coli strain CV839-06 plasmid pCV839-06-p1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

59. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP024254 (Escherichia coli strain ATCC 43886 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

60. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to CP043758 (Escherichia coli strain CVM N55972 plasmid pN55972-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

61. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP024129 (Escherichia coli strain 14EC001 plasmid p14EC001b, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

62. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

63. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to CP022610 (Escherichia coli strain ATCC 700415 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

64. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP012931 (Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

65. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

66. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

67. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_005211 (Serratia marcescens plasmid R478, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

68. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

69. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP023959 (Escherichia coli strain FDAARGOS_448 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

70. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_002134 (Shigella flexneri 2b plasmid R100 DNA, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

71. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_016983 (Photobacterium damselae subsp. damselae plasmid pAQU1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

72. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

73. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029248 (Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_D, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

74. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

75. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

76. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to CP051274 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Partridge_SW-37 plasmid pSW37-267109, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

77. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_009133 (Escherichia coli plasmid NR1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

78. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP044968 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

79. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

80. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029979 (Escherichia coli strain 99-3165 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

81. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_011743 (Escherichia fergusonii ATCC 35469 plasmid pEFER, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

82. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to CP051271 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Quail_SW-70 plasmid pSW37-267106, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

83. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to KX957968 (Vibrio alginolyticus plasmid pVAS19, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

84. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

85. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

86. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

87. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

88. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP025139 (Escherichia coli strain BH100L substr. MG2017 plasmid pBH100alpha, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

89. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_LR740759 (Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid paAPEC5202) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

90. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

91. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

92. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_019117 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH696_117, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

93. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029744 (Escherichia coli strain AR_0085 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

94. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to CP052139 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

95. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP022673 (Shigella sonnei strain 866 plasmid p866, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

96. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_013365 (Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

97. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP015836 (Escherichia coli strain MS6198 plasmid pMS6198B, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

98. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

99. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

100. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_018954 (Salmonella enterica subsp. enterica serovar Kentucky plasmid pCS0010A, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

101. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_018966 (Salmonella enterica subsp. enterica serovar Kentucky plasmid pSSAP03302A, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

102. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

103. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

104. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

105. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_AP018352 (Enterobacter hormaechei strain TUM11043 plasmid pMTY11043_IncHI2, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

106. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_011812 (Escherichia coli plasmid pO26-L, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

107. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

108. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

109. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

110. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

111. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP025253 (Escherichia coli strain BH100 substr. MG2017 plasmid pBH100-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

112. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to MH114596 (Salmonella enterica strain 13-1681 plasmid p131681, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

113. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP024910 (Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L plasmid pOSUKPC4, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

114. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

115. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

116. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

117. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

118. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP044051 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

119. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP025254 (Escherichia coli strain BH100L substr. MG2014 plasmid pBH100alpha, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

120. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP014320 (Escherichia coli JJ1887 plasmid pJJ1887-5, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

121. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_LT985304 (Escherichia coli strain ECOR 31 plasmid RCS89_p, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

122. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_LT985296 (Escherichia coli strain 1454 plasmid RCS78_p, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

123. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP026934 (Escherichia coli strain CFS3273 plasmid pCFS3273-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

124. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_MK291500 (Escherichia coli strain 15978 plasmid pHN15978-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

125. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_MK878891 (Escherichia coli strain J53 plasmid pMG336, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

126. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_MK878890 (Escherichia coli strain J53 plasmid pMG337, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

127. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_MK758104 (Escherichia coli strain 0126:B16 plasmid R16, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

128. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

129. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP018299 (Photobacterium damselae strain Phdp Wu-1 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

130. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_MH105051 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncHI2, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

131. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_MH422552 (Escherichia coli strain L-I1 plasmid pIncFIB, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

132. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_MH626558 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST1007 plasmid pST1007-1B, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

133. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_MH760469 (Salmonella enterica strain 2016K-0796 plasmid p2016K-0796, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

134. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_MK169211 (Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

135. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP006635 (Escherichia coli PCN033 plasmid p3PCN033, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

136. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_MG904992 (Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

137. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_MF174860 (Escherichia coli strain 6/14/6b plasmid pIncF-MU4, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

138. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_MF344581 (Enterobacter cloacae strain 13E573 plasmid p13E573-HI2, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

139. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_MH202955 (Escherichia coli strain HXH-1 plasmid pHXH-1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

140. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_MG948335 (Escherichia coli strain 3498 plasmid p3498, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

141. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_023277 (Escherichia coli strain 63743 plasmid pEQ2, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

142. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NC_023289 (Escherichia coli strain T23 plasmid pEQ1, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

143. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to NZ_CP044190 (Salmonella enterica subsp. enterica strain AR-0401 plasmid pAR-0401-2, complete sequence) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
gataaaacatcaggttattcgtttacttttga	Protospacer
. .*.  ***** *** ************** 

144. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to MN163280 (Klebsiella phage KpGranit, complete genome) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
ctcagctcaacacgttcttcgtctagtgcctg	Protospacer
 ******** ************.** * ..  

145. spacer 2.8|2135743|32|NC_021661|CRISPRCasFinder,PILER-CR matches to MG459987 (Klebsiella phage Sugarland, complete genome) position: , mismatch: 9, identity: 0.719

atcagctcatcacgttcttcgtttacttttgc	CRISPR spacer
ctcagctcaacacgttcttcgtctagtgcctg	Protospacer
 ******** ************.** * ..  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 724753 : 733026 7 Megavirus(16.67%) NA NA
DBSCAN-SWA_2 737695 : 761057 23 Powai_lake_megavirus(28.57%) transposase NA
DBSCAN-SWA_3 2246609 : 2321204 79 uncultured_Caudovirales_phage(53.33%) capsid,terminase,portal,coat,tRNA,tail,head,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_021669
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021669_1 2542-2633 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_021669_1 1.1|2570|36|NC_021669|CRISPRCasFinder 2570-2605 36 NC_021669 Psychrobacter sp. G plasmid PsyG_3, complete sequence 2570-2605 0 1.0

1. spacer 1.1|2570|36|NC_021669|CRISPRCasFinder matches to NC_021669 (Psychrobacter sp. G plasmid PsyG_3, complete sequence) position: , mismatch: 0, identity: 1.0

gaaactagcattgaagtgggaagaaactagcattaa	CRISPR spacer
gaaactagcattgaagtgggaagaaactagcattaa	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_021668
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 1863 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_2 10095 : 15690 6 Stenotrophomonas_phage(33.33%) NA NA
DBSCAN-SWA_3 21237 : 22248 1 Thermus_virus(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage