Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_021217 Helicobacter pylori UM037, complete genome 2 crisprs cas14j,cas3,cas2,DEDDh 0 1 1 0

Results visualization

1. NC_021217
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021217_1 498134-498232 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021217_2 734532-734672 Orphan I-B
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_021217_2 2.2|734619|27|NC_021217|CRISPRCasFinder 734619-734645 27 NZ_CP022727 Erwinia persicina strain B64 plasmid pEP2, complete sequence 67408-67434 3 0.889
NC_021217_2 2.2|734619|27|NC_021217|CRISPRCasFinder 734619-734645 27 NZ_CP034186 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence 116558-116584 6 0.778

1. spacer 2.2|734619|27|NC_021217|CRISPRCasFinder matches to NZ_CP022727 (Erwinia persicina strain B64 plasmid pEP2, complete sequence) position: , mismatch: 3, identity: 0.889

ggcaacgccagctttaataacgacacc	CRISPR spacer
ggcaacgccagcgttaataccgacagc	Protospacer
************ ****** ***** *

2. spacer 2.2|734619|27|NC_021217|CRISPRCasFinder matches to NZ_CP034186 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778

ggcaacgccagctttaataacgacacc	CRISPR spacer
ggcagccccagctttaataacgaactg	Protospacer
****.* ****************  . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 386918 : 414706 32 Helicobacter_phage(100.0%) transposase,integrase attL 378191:378250|attR 424096:424368
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage