Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_021234 Lactobacillus plantarum subsp. plantarum P-8 plasmid LBPp4, complete sequence 0 crisprs NA 0 0 3 0
NC_021227 Lactobacillus plantarum subsp. plantarum P-8 plasmid LBPp5, complete sequence 0 crisprs NA 0 0 0 0
NC_021226 Lactobacillus plantarum subsp. plantarum P-8 plasmid LBPp3, complete sequence 0 crisprs NA 0 0 0 0
NC_021224 Lactobacillus plantarum subsp. plantarum P-8, complete sequence 2 crisprs csa3,DinG,cas3,DEDDh 1 2 8 0
NC_021233 Lactobacillus plantarum subsp. plantarum P-8 plasmid LBPp1, complete sequence 0 crisprs NA 0 0 0 0
NC_021228 Lactobacillus plantarum subsp. plantarum P-8 plasmid LBPp6, complete sequence 0 crisprs NA 0 0 0 0
NC_021225 Lactobacillus plantarum subsp. plantarum P-8 plasmid LBPp2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP010527 Lactobacillus plantarum subsp. plantarum P-8 plasmid LBPp7, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_021234
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 5225 2 Staphylococcus_phage(100.0%) transposase NA
DBSCAN-SWA_2 11587 : 14028 3 unidentified_phage(50.0%) transposase NA
DBSCAN-SWA_3 20006 : 30033 7 Staphylococcus_phage(50.0%) holin,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_021224
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021224_1 346707-347168 Orphan NA
12 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021224_2 2625985-2626115 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_021224_1 1.1|346725|18|NC_021224|CRT 346725-346742 18 NC_021224.2 2810993-2811010 2 0.889

1. spacer 1.1|346725|18|NC_021224|CRT matches to position: 2810993-2811010, mismatch: 2, identity: 0.889

gccgctaagaaacataag	CRISPR spacer
gccgctaaggaacatcag	Protospacer
*********.***** **

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_021224_2 2.2|2626062|31|NC_021224|CRISPRCasFinder 2626062-2626092 31 NZ_CP034567 Vibrio parahaemolyticus strain D3112 plasmid p1, complete sequence 30785-30815 6 0.806
NC_021224_2 2.2|2626062|31|NC_021224|CRISPRCasFinder 2626062-2626092 31 NZ_CP033143 Vibrio parahaemolyticus strain 160807 plasmid pVPWZ1, complete sequence 85109-85139 6 0.806
NC_021224_2 2.2|2626062|31|NC_021224|CRISPRCasFinder 2626062-2626092 31 NZ_CP034300 Vibrio parahaemolyticus strain 20160303005-1 plasmid pVPSD2016-1, complete sequence 82262-82292 6 0.806
NC_021224_2 2.2|2626062|31|NC_021224|CRISPRCasFinder 2626062-2626092 31 NZ_CP033139 Vibrio owensii strain 1700302 plasmid pVOWZ1, complete sequence 19890-19920 6 0.806
NC_021224_1 1.2|346761|30|NC_021224|CRT 346761-346790 30 NZ_CP006988 Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence 31047-31076 7 0.767
NC_021224_1 1.2|346761|30|NC_021224|CRT 346761-346790 30 NC_042345 Phage Salvo, complete genome 4721-4750 8 0.733
NC_021224_2 2.2|2626062|31|NC_021224|CRISPRCasFinder 2626062-2626092 31 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1245593-1245623 8 0.742

1. spacer 2.2|2626062|31|NC_021224|CRISPRCasFinder matches to NZ_CP034567 (Vibrio parahaemolyticus strain D3112 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.806

aaacccagcgccacaaccaaacccggcgccg	CRISPR spacer
catcaaagcgccactaccaaacgcggcgccg	Protospacer
 * *  ******** ******* ********

2. spacer 2.2|2626062|31|NC_021224|CRISPRCasFinder matches to NZ_CP033143 (Vibrio parahaemolyticus strain 160807 plasmid pVPWZ1, complete sequence) position: , mismatch: 6, identity: 0.806

aaacccagcgccacaaccaaacccggcgccg	CRISPR spacer
catcaaagcgccactaccaaacgcggcgccg	Protospacer
 * *  ******** ******* ********

3. spacer 2.2|2626062|31|NC_021224|CRISPRCasFinder matches to NZ_CP034300 (Vibrio parahaemolyticus strain 20160303005-1 plasmid pVPSD2016-1, complete sequence) position: , mismatch: 6, identity: 0.806

aaacccagcgccacaaccaaacccggcgccg	CRISPR spacer
catcaaagcgccactaccaaacgcggcgccg	Protospacer
 * *  ******** ******* ********

4. spacer 2.2|2626062|31|NC_021224|CRISPRCasFinder matches to NZ_CP033139 (Vibrio owensii strain 1700302 plasmid pVOWZ1, complete sequence) position: , mismatch: 6, identity: 0.806

aaacccagcgccacaaccaaacccggcgccg	CRISPR spacer
catcaaagcgccactaccaaacgcggcgccg	Protospacer
 * *  ******** ******* ********

5. spacer 1.2|346761|30|NC_021224|CRT matches to NZ_CP006988 (Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence) position: , mismatch: 7, identity: 0.767

cacaagaagaaagcggccaagaaacataag	CRISPR spacer
cacaagaataaagccgccaagaagctccgg	Protospacer
******** ***** ********.* . .*

6. spacer 1.2|346761|30|NC_021224|CRT matches to NC_042345 (Phage Salvo, complete genome) position: , mismatch: 8, identity: 0.733

cacaagaagaaagcggccaagaaacataag	CRISPR spacer
ccggggaagtaagcggacaagaaacatact	Protospacer
*  ..**** ****** ***********  

7. spacer 2.2|2626062|31|NC_021224|CRISPRCasFinder matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

aaacccagcgccacaaccaaacccggcgccg	CRISPR spacer
ccgctgagcgacacaaccaaaccctgcgcct	Protospacer
  .*. **** ************* ***** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 300591 : 356246 48 unidentified_phage(28.57%) bacteriocin,transposase,protease NA
DBSCAN-SWA_2 541302 : 549927 11 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_3 749006 : 777815 21 unidentified_phage(28.57%) integrase,transposase,protease attL 775608:775629|attR 778379:778400
DBSCAN-SWA_4 1144276 : 1154114 9 Lactobacillus_phage(87.5%) NA NA
DBSCAN-SWA_5 1650569 : 1736475 95 Lactobacillus_phage(77.55%) protease,tRNA,terminase,tail,integrase,capsid,portal,head attL 1676115:1676132|attR 1743406:1743423
DBSCAN-SWA_6 2006734 : 2101427 99 Lactobacillus_phage(34.88%) plate,terminase,tail,integrase,capsid,portal,transposase,head attL 2070034:2070055|attR 2084157:2084178
DBSCAN-SWA_7 2275520 : 2284031 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_8 2942671 : 3014382 58 unidentified_phage(37.5%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage