Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_020816 Xanthomonas citri subsp. citri Aw12879 plasmid pXcaw19, complete sequence 0 crisprs NA 0 0 0 0
NC_020815 Xanthomonas citri subsp. citri Aw12879, complete sequence 8 crisprs cas3,RT,WYL,DEDDh,csa3,DinG,cas8c,cas7,cas4,cas1 3 15 6 4
NC_020817 Xanthomonas citri subsp. citri Aw12879 plasmid pXcaw58, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_020815
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020815_1 27344-27698 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020815_2 742563-742747 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020815_3 2748799-2748869 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020815_4 2766986-2767080 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020815_6 2906087-2906172 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020815_5 2905871-2905960 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020815_7 5155346-5155579 TypeI I-C
3 spacers
cas1,cas4,cas7,cas8c,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020815_8 5157634-5158851 TypeI I-C
18 spacers
cas1,cas4,cas7,cas8c,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_020815_6 6.1|2906110|40|NC_020815|CRISPRCasFinder 2906110-2906149 40 NC_020815.1 2900564-2900603 0 1.0
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 NC_020815.1 1776262-1776292 0 1.0
NC_020815_7 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT 5155449-5155482 34 NC_020815.1 1776259-1776292 0 1.0

1. spacer 6.1|2906110|40|NC_020815|CRISPRCasFinder matches to position: 2900564-2900603, mismatch: 0, identity: 1.0

tccctaagcccttgcctgcatcaagttttgcggcgaccag	CRISPR spacer
tccctaagcccttgcctgcatcaagttttgcggcgaccag	Protospacer
****************************************

2. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to position: 1776262-1776292, mismatch: 0, identity: 1.0

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
ctgttcaagctccgccgcctgatccgcttgc	Protospacer
*******************************

3. spacer 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT matches to position: 1776259-1776292, mismatch: 0, identity: 1.0

ctgttcaagctccgccgcctgatccgcttgccga	CRISPR spacer
ctgttcaagctccgccgcctgatccgcttgccga	Protospacer
**********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 MK512531 Xanthomonas phage Cf2, complete genome 4186-4216 0 1.0
NC_020815_7 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT 5155449-5155482 34 MK512531 Xanthomonas phage Cf2, complete genome 4186-4219 0 1.0
NC_020815_1 1.10|27423|31|NC_020815|CRISPRCasFinder 27423-27453 31 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 841349-841379 6 0.806
NC_020815_1 1.10|27423|31|NC_020815|CRISPRCasFinder 27423-27453 31 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 841095-841125 6 0.806
NC_020815_1 1.10|27423|31|NC_020815|CRISPRCasFinder 27423-27453 31 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 741214-741244 6 0.806
NC_020815_1 1.10|27423|31|NC_020815|CRISPRCasFinder 27423-27453 31 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 811280-811310 6 0.806
NC_020815_1 1.10|27423|31|NC_020815|CRISPRCasFinder 27423-27453 31 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 740329-740359 6 0.806
NC_020815_1 1.10|27423|31|NC_020815|CRISPRCasFinder 27423-27453 31 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 742907-742937 6 0.806
NC_020815_1 1.10|27423|31|NC_020815|CRISPRCasFinder 27423-27453 31 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 742896-742926 6 0.806
NC_020815_1 1.10|27423|31|NC_020815|CRISPRCasFinder 27423-27453 31 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 741201-741231 6 0.806
NC_020815_1 1.10|27423|31|NC_020815|CRISPRCasFinder 27423-27453 31 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 741220-741250 6 0.806
NC_020815_1 1.10|27423|31|NC_020815|CRISPRCasFinder 27423-27453 31 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 741198-741228 6 0.806
NC_020815_1 1.10|27423|31|NC_020815|CRISPRCasFinder 27423-27453 31 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 841418-841448 6 0.806
NC_020815_1 1.10|27423|31|NC_020815|CRISPRCasFinder 27423-27453 31 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 841417-841447 6 0.806
NC_020815_1 1.10|27423|31|NC_020815|CRISPRCasFinder 27423-27453 31 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 841402-841432 6 0.806
NC_020815_1 1.11|27477|31|NC_020815|CRISPRCasFinder 27477-27507 31 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 934481-934511 6 0.806
NC_020815_1 1.13|27588|34|NC_020815|CRISPRCasFinder 27588-27621 34 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1614842-1614875 6 0.824
NC_020815_1 1.10|27423|31|NC_020815|CRISPRCasFinder 27423-27453 31 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 513842-513872 7 0.774
NC_020815_1 1.11|27477|31|NC_020815|CRISPRCasFinder 27477-27507 31 NZ_CP015279 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence 150331-150361 7 0.774
NC_020815_1 1.11|27477|31|NC_020815|CRISPRCasFinder 27477-27507 31 NZ_CP015280 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence 81610-81640 7 0.774
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 NZ_CP018472 Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence 23734-23764 7 0.774
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 NZ_CP023287 Xanthomonas citri pv. citri strain 03-1638-1-1 plasmid pP2, complete sequence 95777-95807 7 0.774
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 64029-64059 7 0.774
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 NZ_CP041964 Xanthomonas citri pv. glycines strain 1157 plasmid unnamed1 44460-44490 7 0.774
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 NZ_CP018464 Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.1, complete sequence 149304-149334 7 0.774
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 NZ_CP022265 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plC, complete sequence 30912-30942 7 0.774
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 NZ_CP024030 Xanthomonas citri pv. citri strain Xcc49 plasmid pXAC64, complete sequence 52195-52225 7 0.774
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 NZ_CP020888 Xanthomonas citri pv. citri strain TX160149 plasmid unnamed3, complete sequence 47361-47391 7 0.774
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 NZ_CP013664 Xanthomonas citri pv. citri strain jx-6 plasmid pXAC64, complete sequence 53209-53239 7 0.774
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 NZ_CP024033 Xanthomonas citri pv. citri strain Xcc29-1 plasmid pXAC64, complete sequence 52202-52232 7 0.774
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 NC_020797 Xanthomonas axonopodis Xac29-1 plasmid pXAC64, complete sequence 52181-52211 7 0.774
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 NZ_CP018734 Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.3, complete sequence 2004-2034 7 0.774
NC_020815_1 1.13|27588|34|NC_020815|CRISPRCasFinder 27588-27621 34 MH271303 Microbacterium phage MementoMori, complete genome 20739-20772 8 0.765
NC_020815_1 1.13|27588|34|NC_020815|CRISPRCasFinder 27588-27621 34 MN813682 Microbacterium phage Matzah, complete genome 21015-21048 8 0.765
NC_020815_1 1.13|27588|34|NC_020815|CRISPRCasFinder 27588-27621 34 MK937591 Microbacterium phage Cinna, complete genome 21039-21072 8 0.765
NC_020815_1 1.14|27645|31|NC_020815|CRISPRCasFinder 27645-27675 31 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 380719-380749 8 0.742
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 NZ_CP041964 Xanthomonas citri pv. glycines strain 1157 plasmid unnamed1 638-668 8 0.742
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 989277-989307 8 0.742
NC_020815_7 7.3|5155515|30|NC_020815|PILER-CR 5155515-5155544 30 NZ_CP026546 Cupriavidus metallidurans strain Ni-2 plasmid unnamed2 103201-103230 8 0.733
NC_020815_8 8.10|5158262|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT 5158262-5158295 34 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 2311351-2311384 8 0.765
NC_020815_8 8.12|5158392|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT 5158392-5158425 34 NC_011758 Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence 22164-22197 8 0.765
NC_020815_8 8.17|5158720|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT 5158720-5158753 34 MH271303 Microbacterium phage MementoMori, complete genome 25878-25911 8 0.765
NC_020815_8 8.17|5158720|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT 5158720-5158753 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 74475-74508 8 0.765
NC_020815_8 8.17|5158720|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT 5158720-5158753 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 73546-73579 8 0.765
NC_020815_1 1.10|27423|31|NC_020815|CRISPRCasFinder 27423-27453 31 NZ_CP013739 Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence 114529-114559 9 0.71
NC_020815_8 8.17|5158720|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT 5158720-5158753 34 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 907251-907284 9 0.735
NC_020815_8 8.17|5158720|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT 5158720-5158753 34 KT221034 Streptomyces phage SF3, complete genome 35711-35744 9 0.735
NC_020815_8 8.17|5158720|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT 5158720-5158753 34 MK937591 Microbacterium phage Cinna, complete genome 26190-26223 9 0.735
NC_020815_1 1.2|27417|35|NC_020815|CRT 27417-27451 35 NZ_AP017604 Sphingopyxis sp. EG6 plasmid pSREG01, complete sequence 1759-1793 10 0.714
NC_020815_1 1.5|27582|38|NC_020815|CRT 27582-27619 38 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1614844-1614881 10 0.737
NC_020815_1 1.6|27639|35|NC_020815|CRT 27639-27673 35 NZ_CP049358 Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence 138975-139009 10 0.714
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 MG592582 Vibrio phage 1.211.B._10N.222.52.F11, partial genome 14372-14402 10 0.677
NC_020815_7 7.2|5155449|31|NC_020815|PILER-CR 5155449-5155479 31 MG592581 Vibrio phage 1.211.A._10N.222.52.F11, partial genome 14372-14402 10 0.677
NC_020815_7 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT 5155449-5155482 34 NZ_CP018472 Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence 23731-23764 10 0.706
NC_020815_7 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT 5155449-5155482 34 NZ_CP041964 Xanthomonas citri pv. glycines strain 1157 plasmid unnamed1 44460-44493 10 0.706
NC_020815_7 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT 5155449-5155482 34 NZ_CP023287 Xanthomonas citri pv. citri strain 03-1638-1-1 plasmid pP2, complete sequence 95774-95807 10 0.706
NC_020815_7 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT 5155449-5155482 34 NZ_CP018464 Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.1, complete sequence 149304-149337 10 0.706
NC_020815_7 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT 5155449-5155482 34 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 64026-64059 10 0.706
NC_020815_7 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT 5155449-5155482 34 NZ_CP022265 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plC, complete sequence 30912-30945 10 0.706
NC_020815_7 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT 5155449-5155482 34 NZ_CP024030 Xanthomonas citri pv. citri strain Xcc49 plasmid pXAC64, complete sequence 52195-52228 10 0.706
NC_020815_7 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT 5155449-5155482 34 NZ_CP020888 Xanthomonas citri pv. citri strain TX160149 plasmid unnamed3, complete sequence 47361-47394 10 0.706
NC_020815_7 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT 5155449-5155482 34 NZ_CP013664 Xanthomonas citri pv. citri strain jx-6 plasmid pXAC64, complete sequence 53209-53242 10 0.706
NC_020815_7 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT 5155449-5155482 34 NZ_CP024033 Xanthomonas citri pv. citri strain Xcc29-1 plasmid pXAC64, complete sequence 52202-52235 10 0.706
NC_020815_7 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT 5155449-5155482 34 NC_020797 Xanthomonas axonopodis Xac29-1 plasmid pXAC64, complete sequence 52181-52214 10 0.706
NC_020815_7 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT 5155449-5155482 34 NZ_CP018734 Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.3, complete sequence 2004-2037 10 0.706
NC_020815_8 8.11|5158327|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT 5158327-5158360 34 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1512440-1512473 10 0.706
NC_020815_8 8.11|5158327|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT 5158327-5158360 34 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 660477-660510 10 0.706
NC_020815_8 8.17|5158720|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT 5158720-5158753 34 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 1028825-1028858 10 0.706
NC_020815_1 1.13|27588|34|NC_020815|CRISPRCasFinder 27588-27621 34 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 72444-72477 11 0.676
NC_020815_7 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT 5155449-5155482 34 NZ_CP041964 Xanthomonas citri pv. glycines strain 1157 plasmid unnamed1 638-671 11 0.676
NC_020815_1 1.13|27588|34|NC_020815|CRISPRCasFinder 27588-27621 34 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 22147-22180 12 0.647
NC_020815_1 1.13|27588|34|NC_020815|CRISPRCasFinder 27588-27621 34 NZ_CP023152 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence 116465-116498 12 0.647
NC_020815_8 8.3|5157799|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT 5157799-5157832 34 NZ_KJ599675 Micrococcus sp. A7 plasmid pLMA7, complete sequence 16347-16380 12 0.647

1. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to MK512531 (Xanthomonas phage Cf2, complete genome) position: , mismatch: 0, identity: 1.0

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
ctgttcaagctccgccgcctgatccgcttgc	Protospacer
*******************************

2. spacer 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT matches to MK512531 (Xanthomonas phage Cf2, complete genome) position: , mismatch: 0, identity: 1.0

ctgttcaagctccgccgcctgatccgcttgccga	CRISPR spacer
ctgttcaagctccgccgcctgatccgcttgccga	Protospacer
**********************************

3. spacer 1.10|27423|31|NC_020815|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

gagatcggtgccggtgcgcaaaccaagaacg	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgatg	Protospacer
****.*********.********* * .*.*

4. spacer 1.10|27423|31|NC_020815|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.806

gagatcggtgccggtgcgcaaaccaagaacg	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgatg	Protospacer
****.*********.********* * .*.*

5. spacer 1.10|27423|31|NC_020815|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

gagatcggtgccggtgcgcaaaccaagaacg	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgatg	Protospacer
****.*********.********* * .*.*

6. spacer 1.10|27423|31|NC_020815|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

gagatcggtgccggtgcgcaaaccaagaacg	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgatg	Protospacer
****.*********.********* * .*.*

7. spacer 1.10|27423|31|NC_020815|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.806

gagatcggtgccggtgcgcaaaccaagaacg	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgatg	Protospacer
****.*********.********* * .*.*

8. spacer 1.10|27423|31|NC_020815|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

gagatcggtgccggtgcgcaaaccaagaacg	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgatg	Protospacer
****.*********.********* * .*.*

9. spacer 1.10|27423|31|NC_020815|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

gagatcggtgccggtgcgcaaaccaagaacg	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgatg	Protospacer
****.*********.********* * .*.*

10. spacer 1.10|27423|31|NC_020815|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

gagatcggtgccggtgcgcaaaccaagaacg	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgatg	Protospacer
****.*********.********* * .*.*

11. spacer 1.10|27423|31|NC_020815|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

gagatcggtgccggtgcgcaaaccaagaacg	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgatg	Protospacer
****.*********.********* * .*.*

12. spacer 1.10|27423|31|NC_020815|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

gagatcggtgccggtgcgcaaaccaagaacg	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgatg	Protospacer
****.*********.********* * .*.*

13. spacer 1.10|27423|31|NC_020815|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

gagatcggtgccggtgcgcaaaccaagaacg	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgatg	Protospacer
****.*********.********* * .*.*

14. spacer 1.10|27423|31|NC_020815|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

gagatcggtgccggtgcgcaaaccaagaacg	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgatg	Protospacer
****.*********.********* * .*.*

15. spacer 1.10|27423|31|NC_020815|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

gagatcggtgccggtgcgcaaaccaagaacg	CRISPR spacer
gagaccggtgccggcgcgcaaacctacgatg	Protospacer
****.*********.********* * .*.*

16. spacer 1.11|27477|31|NC_020815|CRISPRCasFinder matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 6, identity: 0.806

cgcatcggcgacaacgcgcgtaccg-gtggcg	CRISPR spacer
cgcagcggcgacaacgcgcgcaccatcttgc-	Protospacer
**** ***************.***.  * ** 

17. spacer 1.13|27588|34|NC_020815|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ctcgccgagcgcggcagccagatcagtggcggcg-	CRISPR spacer
ttcgtcgagcgcggcagccagatca-tggggctgg	Protospacer
.***.******************** *** * .* 

18. spacer 1.10|27423|31|NC_020815|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 7, identity: 0.774

gagatcggtgccggtgcgcaaaccaagaacg	CRISPR spacer
gcattgggtgccggtgcgcaagccaacaaca	Protospacer
* . * ***************.**** ***.

19. spacer 1.11|27477|31|NC_020815|CRISPRCasFinder matches to NZ_CP015279 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.774

cgcatcggcgacaacgcgcgtaccggtggcg	CRISPR spacer
atcaccggcgacaacgcgcgcaccgccgccg	Protospacer
  **.***************.**** .* **

20. spacer 1.11|27477|31|NC_020815|CRISPRCasFinder matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 7, identity: 0.774

cgcatcggcgacaacgcgcgtaccggtggcg	CRISPR spacer
atcaccggcgacaacgcgcgcaccgccgccg	Protospacer
  **.***************.**** .* **

21. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to NZ_CP018472 (Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence) position: , mismatch: 7, identity: 0.774

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
gtggggtagatccgccgcctgatccgctcgc	Protospacer
 **    ** ******************.**

22. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to NZ_CP023287 (Xanthomonas citri pv. citri strain 03-1638-1-1 plasmid pP2, complete sequence) position: , mismatch: 7, identity: 0.774

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
gtggggtagatccgccgcctgatccgctcgc	Protospacer
 **    ** ******************.**

23. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 7, identity: 0.774

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
gtgggataggtccgccgcctgatccgctcgc	Protospacer
 **    ** ******************.**

24. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to NZ_CP041964 (Xanthomonas citri pv. glycines strain 1157 plasmid unnamed1) position: , mismatch: 7, identity: 0.774

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
gtggggtagatccgccgcctgatccgctcgc	Protospacer
 **    ** ******************.**

25. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to NZ_CP018464 (Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.1, complete sequence) position: , mismatch: 7, identity: 0.774

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
gtgggataggtccgccgcctgatccgctcgc	Protospacer
 **    ** ******************.**

26. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to NZ_CP022265 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plC, complete sequence) position: , mismatch: 7, identity: 0.774

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
gtgggataggtccgccgcctgatccgctcgc	Protospacer
 **    ** ******************.**

27. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to NZ_CP024030 (Xanthomonas citri pv. citri strain Xcc49 plasmid pXAC64, complete sequence) position: , mismatch: 7, identity: 0.774

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
gtggggtagatccgccgcctgatccgctcgc	Protospacer
 **    ** ******************.**

28. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to NZ_CP020888 (Xanthomonas citri pv. citri strain TX160149 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
gtggggtagatccgccgcctgatccgctcgc	Protospacer
 **    ** ******************.**

29. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to NZ_CP013664 (Xanthomonas citri pv. citri strain jx-6 plasmid pXAC64, complete sequence) position: , mismatch: 7, identity: 0.774

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
gtggggtagatccgccgcctgatccgctcgc	Protospacer
 **    ** ******************.**

30. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to NZ_CP024033 (Xanthomonas citri pv. citri strain Xcc29-1 plasmid pXAC64, complete sequence) position: , mismatch: 7, identity: 0.774

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
gtggggtagatccgccgcctgatccgctcgc	Protospacer
 **    ** ******************.**

31. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to NC_020797 (Xanthomonas axonopodis Xac29-1 plasmid pXAC64, complete sequence) position: , mismatch: 7, identity: 0.774

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
gtggggtagatccgccgcctgatccgctcgc	Protospacer
 **    ** ******************.**

32. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to NZ_CP018734 (Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.3, complete sequence) position: , mismatch: 7, identity: 0.774

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
gtgggataggtccgccgcctgatccgctcgc	Protospacer
 **    ** ******************.**

33. spacer 1.13|27588|34|NC_020815|CRISPRCasFinder matches to MH271303 (Microbacterium phage MementoMori, complete genome) position: , mismatch: 8, identity: 0.765

ctcgccgagcgcggcagccagat-cagtggcggcg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctgc-	Protospacer
**************** ** *** *  *  * ** 

34. spacer 1.13|27588|34|NC_020815|CRISPRCasFinder matches to MN813682 (Microbacterium phage Matzah, complete genome) position: , mismatch: 8, identity: 0.765

ctcgccgagcgcggcagccagat-cagtggcggcg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctgc-	Protospacer
**************** ** *** *  *  * ** 

35. spacer 1.13|27588|34|NC_020815|CRISPRCasFinder matches to MK937591 (Microbacterium phage Cinna, complete genome) position: , mismatch: 8, identity: 0.765

ctcgccgagcgcggcagccagat-cagtggcggcg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctgc-	Protospacer
**************** ** *** *  *  * ** 

36. spacer 1.14|27645|31|NC_020815|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 8, identity: 0.742

gggctggtgggaaccgagctcggcaagggca	CRISPR spacer
ctgctggtgggaatcgagttcggcaccgcaa	Protospacer
  ***********.****.******  *  *

37. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to NZ_CP041964 (Xanthomonas citri pv. glycines strain 1157 plasmid unnamed1) position: , mismatch: 8, identity: 0.742

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
tgggggtagatccgccgcctgatccgctcgc	Protospacer
. *    ** ******************.**

38. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
tcgagcaatctccgccgcctgatcggctgga	Protospacer
..*  *** *************** *** * 

39. spacer 7.3|5155515|30|NC_020815|PILER-CR matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 8, identity: 0.733

ctcgggtttcgggatgtgcttcagatctgc	CRISPR spacer
gatgaacttcgtgatgtgctccagatctgc	Protospacer
  .*...**** ********.*********

40. spacer 8.10|5158262|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 8, identity: 0.765

tcattgaacccaaggaccacttcgcagggcgact----	CRISPR spacer
tcattgaaccaacggaccacttc----ggcgctttcac	Protospacer
********** * **********    **** .*    

41. spacer 8.12|5158392|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 8, identity: 0.765

tgtcgagcgcgcactgctgccgcgatggccggaa	CRISPR spacer
tgcggcctgtgcactgctgccgccatggccagaa	Protospacer
**. *  .*.************* ******.***

42. spacer 8.17|5158720|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT matches to MH271303 (Microbacterium phage MementoMori, complete genome) position: , mismatch: 8, identity: 0.765

ctgagttcgtcgccgtcccggtcgtctgacgcgt	CRISPR spacer
ccacgttcgtcgccgtcacggtcgtctgcccctg	Protospacer
*.. ************* ********** * *  

43. spacer 8.17|5158720|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.765

ctgagttcg---tcgccgtcccggtcgtctgacgcgt	CRISPR spacer
---aactcggcatcgccgtcccgatcgcctgacgcgc	Protospacer
   *..***   ***********.***.********.

44. spacer 8.17|5158720|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.765

ctgagttcg---tcgccgtcccggtcgtctgacgcgt	CRISPR spacer
---aactcggcatcgccgtcccgatcgcctgacgcgc	Protospacer
   *..***   ***********.***.********.

45. spacer 1.10|27423|31|NC_020815|CRISPRCasFinder matches to NZ_CP013739 (Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence) position: , mismatch: 9, identity: 0.71

gagatcggtgccggtgcgcaaaccaagaacg	CRISPR spacer
cagagcggtgccggtgcgcatacctctgggg	Protospacer
 *** *************** ***   .. *

46. spacer 8.17|5158720|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.735

ctgagttcgtcgccgtcccggtcgtctgacgcgt	CRISPR spacer
gggagttcggcgccgtctcggtcgtctccggcca	Protospacer
  ******* *******.*********   **  

47. spacer 8.17|5158720|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT matches to KT221034 (Streptomyces phage SF3, complete genome) position: , mismatch: 9, identity: 0.735

ctgagttcgtcgccgtcccggtcgtctgacgcgt	CRISPR spacer
tcgagctcgtcgccgtcctggtcgtcgtcctcga	Protospacer
..***.************.*******   * ** 

48. spacer 8.17|5158720|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT matches to MK937591 (Microbacterium phage Cinna, complete genome) position: , mismatch: 9, identity: 0.735

ctgagttcgtcgccgtcccggtcgtctgacgcgt	CRISPR spacer
ccacgttcgtcgccgtcaccgtcgtctgcccctg	Protospacer
*.. ************* * ******** * *  

49. spacer 1.2|27417|35|NC_020815|CRT matches to NZ_AP017604 (Sphingopyxis sp. EG6 plasmid pSREG01, complete sequence) position: , mismatch: 10, identity: 0.714

tccatcgagatcggtgccggtgcgcaaaccaagaa	CRISPR spacer
gccgtcgcgatcggtgccggtgcgcagcacctggg	Protospacer
 **.*** ******************.  *  *..

50. spacer 1.5|27582|38|NC_020815|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737

agcatcctcgccgagcgcggcagccagatcagtggcgg	CRISPR spacer
atgttcttcgtcgagcgcggcagccagatcatggggct	Protospacer
*   **.***.********************  **   

51. spacer 1.6|27639|35|NC_020815|CRT matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

agcatcgggctggtgggaaccgagctcggcaaggg	CRISPR spacer
agcatcgggcgggtgggcaccgagccgaccatcat	Protospacer
********** ****** *******. . **  . 

52. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to MG592582 (Vibrio phage 1.211.B._10N.222.52.F11, partial genome) position: , mismatch: 10, identity: 0.677

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
tgcatcaagcacagccgcctgatccgccccg	Protospacer
.   ****** * **************..  

53. spacer 7.2|5155449|31|NC_020815|PILER-CR matches to MG592581 (Vibrio phage 1.211.A._10N.222.52.F11, partial genome) position: , mismatch: 10, identity: 0.677

ctgttcaagctccgccgcctgatccgcttgc	CRISPR spacer
tgcatcaagcacagccgcctgatccgccccg	Protospacer
.   ****** * **************..  

54. spacer 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT matches to NZ_CP018472 (Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence) position: , mismatch: 10, identity: 0.706

ctgttcaagctccgccgcctgatccgcttgccga	CRISPR spacer
gtggggtagatccgccgcctgatccgctcgcgtt	Protospacer
 **    ** ******************.**   

55. spacer 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT matches to NZ_CP041964 (Xanthomonas citri pv. glycines strain 1157 plasmid unnamed1) position: , mismatch: 10, identity: 0.706

ctgttcaagctccgccgcctgatccgcttgccga	CRISPR spacer
gtggggtagatccgccgcctgatccgctcgcgtt	Protospacer
 **    ** ******************.**   

56. spacer 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT matches to NZ_CP023287 (Xanthomonas citri pv. citri strain 03-1638-1-1 plasmid pP2, complete sequence) position: , mismatch: 10, identity: 0.706

ctgttcaagctccgccgcctgatccgcttgccga	CRISPR spacer
gtggggtagatccgccgcctgatccgctcgcgtt	Protospacer
 **    ** ******************.**   

57. spacer 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT matches to NZ_CP018464 (Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.1, complete sequence) position: , mismatch: 10, identity: 0.706

ctgttcaagctccgccgcctgatccgcttgccga	CRISPR spacer
gtgggataggtccgccgcctgatccgctcgcgtt	Protospacer
 **    ** ******************.**   

58. spacer 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 10, identity: 0.706

ctgttcaagctccgccgcctgatccgcttgccga	CRISPR spacer
gtgggataggtccgccgcctgatccgctcgcgtt	Protospacer
 **    ** ******************.**   

59. spacer 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT matches to NZ_CP022265 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plC, complete sequence) position: , mismatch: 10, identity: 0.706

ctgttcaagctccgccgcctgatccgcttgccga	CRISPR spacer
gtgggataggtccgccgcctgatccgctcgcgtt	Protospacer
 **    ** ******************.**   

60. spacer 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT matches to NZ_CP024030 (Xanthomonas citri pv. citri strain Xcc49 plasmid pXAC64, complete sequence) position: , mismatch: 10, identity: 0.706

ctgttcaagctccgccgcctgatccgcttgccga	CRISPR spacer
gtggggtagatccgccgcctgatccgctcgcgtt	Protospacer
 **    ** ******************.**   

61. spacer 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT matches to NZ_CP020888 (Xanthomonas citri pv. citri strain TX160149 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.706

ctgttcaagctccgccgcctgatccgcttgccga	CRISPR spacer
gtggggtagatccgccgcctgatccgctcgcgtt	Protospacer
 **    ** ******************.**   

62. spacer 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT matches to NZ_CP013664 (Xanthomonas citri pv. citri strain jx-6 plasmid pXAC64, complete sequence) position: , mismatch: 10, identity: 0.706

ctgttcaagctccgccgcctgatccgcttgccga	CRISPR spacer
gtggggtagatccgccgcctgatccgctcgcgtt	Protospacer
 **    ** ******************.**   

63. spacer 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT matches to NZ_CP024033 (Xanthomonas citri pv. citri strain Xcc29-1 plasmid pXAC64, complete sequence) position: , mismatch: 10, identity: 0.706

ctgttcaagctccgccgcctgatccgcttgccga	CRISPR spacer
gtggggtagatccgccgcctgatccgctcgcgtt	Protospacer
 **    ** ******************.**   

64. spacer 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT matches to NC_020797 (Xanthomonas axonopodis Xac29-1 plasmid pXAC64, complete sequence) position: , mismatch: 10, identity: 0.706

ctgttcaagctccgccgcctgatccgcttgccga	CRISPR spacer
gtggggtagatccgccgcctgatccgctcgcgtt	Protospacer
 **    ** ******************.**   

65. spacer 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT matches to NZ_CP018734 (Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.3, complete sequence) position: , mismatch: 10, identity: 0.706

ctgttcaagctccgccgcctgatccgcttgccga	CRISPR spacer
gtgggataggtccgccgcctgatccgctcgcgtt	Protospacer
 **    ** ******************.**   

66. spacer 8.11|5158327|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 10, identity: 0.706

ttgaccacatgttctctctgtgggaggaaggcac	CRISPR spacer
cctaccacatgttctcgctgtgggcggactacga	Protospacer
.. ************* ******* ***  .*. 

67. spacer 8.11|5158327|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 10, identity: 0.706

ttgaccacatgttctctctgtgggaggaaggcac	CRISPR spacer
cctaccacatgttctcgctgtgggcggattacga	Protospacer
.. ************* ******* ***  .*. 

68. spacer 8.17|5158720|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 10, identity: 0.706

ctgagttcgtcgccgtcccggtcgtctgacgcgt	CRISPR spacer
gcgagttcggcgccgtctcggtcgtctccggtca	Protospacer
 .******* *******.*********   *.  

69. spacer 1.13|27588|34|NC_020815|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 11, identity: 0.676

ctcgccgagcgcggcagccagatcagtggcggcg	CRISPR spacer
ctcggcgagcgcggcggccagatcctcctccatc	Protospacer
**** **********.********  .  * .. 

70. spacer 7.5|5155449|34|NC_020815|CRISPRCasFinder,CRT matches to NZ_CP041964 (Xanthomonas citri pv. glycines strain 1157 plasmid unnamed1) position: , mismatch: 11, identity: 0.676

ctgttcaagctccgccgcctgatccgcttgccga	CRISPR spacer
tgggggtagatccgccgcctgatccgctcgcgtt	Protospacer
. *    ** ******************.**   

71. spacer 1.13|27588|34|NC_020815|CRISPRCasFinder matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 12, identity: 0.647

ctcgccgagcgcggcagccagatcagtggcggcg	CRISPR spacer
gccgccgagcgcagcagcccgatcagcccgtaga	Protospacer
 .**********.****** ******.    . .

72. spacer 1.13|27588|34|NC_020815|CRISPRCasFinder matches to NZ_CP023152 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence) position: , mismatch: 12, identity: 0.647

ctcgccgagcgcggcagccagatcagtggcggcg	CRISPR spacer
gccgccgagcgcagcagcccgatcagcccgtaga	Protospacer
 .**********.****** ******.    . .

73. spacer 8.3|5157799|34|NC_020815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KJ599675 (Micrococcus sp. A7 plasmid pLMA7, complete sequence) position: , mismatch: 12, identity: 0.647

ctctctcacgccgcgcgtgcgagatcctgcgtgc	CRISPR spacer
tcgagctacgccgcgcgaacgagatcctgcgcaa	Protospacer
..   ..********** .************.. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1204684 : 1271077 51 Escherichia_phage(40.0%) transposase,integrase,terminase attL 1196086:1196100|attR 1267922:1267936
DBSCAN-SWA_2 1275031 : 1322125 53 Stenotrophomonas_phage(61.11%) integrase,portal,terminase,tail,holin,head,plate,capsid,transposase,protease attL 1265547:1265573|attR 1285655:1285681
DBSCAN-SWA_3 1771569 : 1853556 58 Escherichia_phage(27.27%) transposase,integrase attL 1771510:1771569|attR 1809464:1810390
DBSCAN-SWA_4 3945612 : 3986394 30 Bacillus_phage(28.57%) holin,protease,transposase,integrase attL 3942089:3942148|attR 3958572:3958798
DBSCAN-SWA_5 4829874 : 4837912 7 Enterobacteria_phage(42.86%) NA NA
DBSCAN-SWA_6 5040871 : 5104425 69 Stenotrophomonas_phage(56.41%) integrase,portal,terminase,tail,head,holin,plate,capsid,transposase,tRNA attL 5051717:5051734|attR 5090317:5090334
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_020815.1|WP_005916019.1|1769935_1770214_-|hypothetical-protein 1769935_1770214_- 92 aa aa NA NA NA No NA
NC_020815.1|WP_011051337.1|1805004_1805370_-|hypothetical-protein 1805004_1805370_- 121 aa aa NA NA NA 1771569-1853556 yes
NC_020815.1|WP_015471930.1|1824966_1825890_-|hypothetical-protein 1824966_1825890_- 307 aa aa NA NA NA 1771569-1853556 yes
NC_020815.1|WP_015471950.1|1854927_1855188_+|hypothetical-protein 1854927_1855188_+ 86 aa aa NA NA NA No NA