Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 3 crisprs WYL,cas3,cas10d,csc2gr7,csc1gr5,cas6,cas4,cas1,cas2,csx1,csm6,csm3gr7,csx19,cas10,csx18,csx3,cmr5gr11,cmr4gr7,cmr3gr5 0 108 8 0
NC_020290 Synechocystis sp. PCC 6803 plasmid pCC5.2_M, complete sequence 1 crisprs NA 0 1 0 0
NC_020298 Synechocystis sp. PCC 6803 plasmid pCB2.4_M, complete sequence 0 crisprs NA 0 0 0 0
NC_020286 Synechocystis sp. PCC 6803, complete sequence 0 crisprs RT,cas4,csa3,c2c9_V-U4,DEDDh,PD-DExK,cas3 0 0 4 0
NC_020296 Synechocystis sp. PCC 6803 plasmid pSYSM_M, complete sequence 0 crisprs csa3,WYL 0 0 0 0
NC_020288 Synechocystis sp. PCC 6803 plasmid pSYSG_M, complete sequence 0 crisprs NA 0 0 0 0
NC_020289 Synechocystis sp. PCC 6803 plasmid pCA2.4_M, complete sequence 0 crisprs NA 0 0 0 0
NC_020297 Synechocystis sp. PCC 6803 plasmid pSYSX_M, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NC_020287
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020287_1 16310-17502 TypeI-D NA
16 spacers
cas2,cas1,cas4,cas6,csc1gr5,csc2gr7,cas10d,cas3,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020287_2 66100-70220 TypeIII NA
54 spacers
cas2,cas1,csx18,cas6,cas10,csm3gr7,WYL,csx3,cmr5gr11,cmr4gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020287_3 87547-90400 TypeIII NA
38 spacers
cas2,cas1,csx18,cas10,cmr3gr5,cmr4gr7,cmr5gr11,csm3gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_020287_1 1.1|16347|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16347-16381 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 16347-16381 0 1.0
NC_020287_1 1.1|16347|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16347-16381 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 16347-16381 0 1.0
NC_020287_1 1.1|16347|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16347-16381 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 16347-16381 0 1.0
NC_020287_1 1.2|16419|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16419-16455 37 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 16419-16455 0 1.0
NC_020287_1 1.2|16419|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16419-16455 37 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 16419-16455 0 1.0
NC_020287_1 1.2|16419|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16419-16455 37 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 16419-16455 0 1.0
NC_020287_1 1.3|16493|33|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16493-16525 33 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 16493-16525 0 1.0
NC_020287_1 1.3|16493|33|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16493-16525 33 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 16493-16525 0 1.0
NC_020287_1 1.3|16493|33|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16493-16525 33 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 16493-16525 0 1.0
NC_020287_1 1.4|16563|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16563-16599 37 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 16563-16599 0 1.0
NC_020287_1 1.4|16563|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16563-16599 37 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 16563-16599 0 1.0
NC_020287_1 1.4|16563|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16563-16599 37 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 16563-16599 0 1.0
NC_020287_1 1.5|16637|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16637-16673 37 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 16637-16673 0 1.0
NC_020287_1 1.5|16637|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16637-16673 37 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 16637-16673 0 1.0
NC_020287_1 1.5|16637|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16637-16673 37 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 16637-16673 0 1.0
NC_020287_1 1.6|16711|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16711-16749 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 16711-16749 0 1.0
NC_020287_1 1.6|16711|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16711-16749 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 16711-16749 0 1.0
NC_020287_1 1.6|16711|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16711-16749 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 16711-16749 0 1.0
NC_020287_1 1.7|16787|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16787-16821 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 16787-16821 0 1.0
NC_020287_1 1.7|16787|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16787-16821 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 16787-16821 0 1.0
NC_020287_1 1.7|16787|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16787-16821 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 16787-16821 0 1.0
NC_020287_1 1.8|16859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16859-16894 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 16859-16894 0 1.0
NC_020287_1 1.8|16859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16859-16894 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 16859-16894 0 1.0
NC_020287_1 1.8|16859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16859-16894 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 16859-16894 0 1.0
NC_020287_1 1.9|16932|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16932-16966 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 16932-16966 0 1.0
NC_020287_1 1.9|16932|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16932-16966 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 16932-16966 0 1.0
NC_020287_1 1.9|16932|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 16932-16966 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 16932-16966 0 1.0
NC_020287_1 1.10|17004|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17004-17038 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 17004-17038 0 1.0
NC_020287_1 1.10|17004|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17004-17038 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 17076-17110 0 1.0
NC_020287_1 1.10|17004|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17004-17038 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 17004-17038 0 1.0
NC_020287_1 1.10|17004|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17004-17038 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 17076-17110 0 1.0
NC_020287_1 1.10|17004|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17004-17038 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 17004-17038 0 1.0
NC_020287_1 1.10|17004|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17004-17038 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 17076-17110 0 1.0
NC_020287_1 1.11|17076|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17076-17110 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 17004-17038 0 1.0
NC_020287_1 1.11|17076|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17076-17110 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 17076-17110 0 1.0
NC_020287_1 1.11|17076|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17076-17110 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 17004-17038 0 1.0
NC_020287_1 1.11|17076|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17076-17110 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 17076-17110 0 1.0
NC_020287_1 1.11|17076|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17076-17110 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 17004-17038 0 1.0
NC_020287_1 1.11|17076|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17076-17110 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 17076-17110 0 1.0
NC_020287_1 1.12|17148|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17148-17183 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 17148-17183 0 1.0
NC_020287_1 1.12|17148|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17148-17183 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 17148-17183 0 1.0
NC_020287_1 1.12|17148|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17148-17183 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 17148-17183 0 1.0
NC_020287_1 1.13|17221|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17221-17256 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 17221-17256 0 1.0
NC_020287_1 1.13|17221|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17221-17256 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 17221-17256 0 1.0
NC_020287_1 1.13|17221|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17221-17256 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 17221-17256 0 1.0
NC_020287_1 1.14|17294|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17294-17328 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 17294-17328 0 1.0
NC_020287_1 1.14|17294|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17294-17328 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 17294-17328 0 1.0
NC_020287_1 1.14|17294|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17294-17328 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 17294-17328 0 1.0
NC_020287_1 1.15|17366|32|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17366-17397 32 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 17366-17397 0 1.0
NC_020287_1 1.15|17366|32|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17366-17397 32 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 19765-19796 0 1.0
NC_020287_1 1.15|17366|32|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17366-17397 32 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 19765-19796 0 1.0
NC_020287_1 1.16|17435|31|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17435-17465 31 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 17435-17465 0 1.0
NC_020287_1 1.16|17435|31|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17435-17465 31 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 19834-19864 0 1.0
NC_020287_1 1.16|17435|31|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17435-17465 31 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 19834-19864 0 1.0
NC_020287_2 2.1|66137|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66137-66172 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 66137-66172 0 1.0
NC_020287_2 2.1|66137|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66137-66172 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 68536-68571 0 1.0
NC_020287_2 2.1|66137|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66137-66172 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 68536-68571 0 1.0
NC_020287_2 2.2|66210|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66210-66249 40 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 66210-66249 0 1.0
NC_020287_2 2.2|66210|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66210-66249 40 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 68609-68648 0 1.0
NC_020287_2 2.2|66210|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66210-66249 40 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 68609-68648 0 1.0
NC_020287_2 2.3|66287|42|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66287-66328 42 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 66287-66328 0 1.0
NC_020287_2 2.3|66287|42|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66287-66328 42 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 68686-68727 0 1.0
NC_020287_2 2.3|66287|42|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66287-66328 42 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 68686-68727 0 1.0
NC_020287_2 2.4|66366|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66366-66401 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 66366-66401 0 1.0
NC_020287_2 2.4|66366|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66366-66401 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 68765-68800 0 1.0
NC_020287_2 2.4|66366|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66366-66401 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 68765-68800 0 1.0
NC_020287_2 2.5|66439|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66439-66474 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 66439-66474 0 1.0
NC_020287_2 2.5|66439|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66439-66474 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 68838-68873 0 1.0
NC_020287_2 2.5|66439|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66439-66474 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 68838-68873 0 1.0
NC_020287_2 2.6|66512|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66512-66550 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 66512-66550 0 1.0
NC_020287_2 2.6|66512|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66512-66550 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 66664-66702 0 1.0
NC_020287_2 2.6|66512|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66512-66550 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 68911-68949 0 1.0
NC_020287_2 2.6|66512|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66512-66550 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 69063-69101 0 1.0
NC_020287_2 2.6|66512|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66512-66550 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 68911-68949 0 1.0
NC_020287_2 2.6|66512|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66512-66550 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 69063-69101 0 1.0
NC_020287_2 2.7|66588|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66588-66626 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 66588-66626 0 1.0
NC_020287_2 2.7|66588|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66588-66626 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 66740-66778 0 1.0
NC_020287_2 2.7|66588|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66588-66626 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 68987-69025 0 1.0
NC_020287_2 2.7|66588|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66588-66626 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 69139-69177 0 1.0
NC_020287_2 2.7|66588|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66588-66626 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 68987-69025 0 1.0
NC_020287_2 2.7|66588|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66588-66626 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 69139-69177 0 1.0
NC_020287_2 2.8|66664|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66664-66702 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 66512-66550 0 1.0
NC_020287_2 2.8|66664|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66664-66702 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 66664-66702 0 1.0
NC_020287_2 2.8|66664|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66664-66702 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 68911-68949 0 1.0
NC_020287_2 2.8|66664|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66664-66702 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 69063-69101 0 1.0
NC_020287_2 2.8|66664|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66664-66702 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 68911-68949 0 1.0
NC_020287_2 2.8|66664|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66664-66702 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 69063-69101 0 1.0
NC_020287_2 2.9|66740|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66740-66778 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 66588-66626 0 1.0
NC_020287_2 2.9|66740|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66740-66778 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 66740-66778 0 1.0
NC_020287_2 2.9|66740|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66740-66778 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 68987-69025 0 1.0
NC_020287_2 2.9|66740|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66740-66778 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 69139-69177 0 1.0
NC_020287_2 2.9|66740|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66740-66778 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 68987-69025 0 1.0
NC_020287_2 2.9|66740|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66740-66778 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 69139-69177 0 1.0
NC_020287_2 2.10|66816|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66816-66850 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 66816-66850 0 1.0
NC_020287_2 2.10|66816|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66816-66850 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 69215-69249 0 1.0
NC_020287_2 2.10|66816|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66816-66850 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 69215-69249 0 1.0
NC_020287_2 2.11|66888|44|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66888-66931 44 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 66888-66931 0 1.0
NC_020287_2 2.11|66888|44|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66888-66931 44 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 69287-69330 0 1.0
NC_020287_2 2.11|66888|44|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66888-66931 44 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 69287-69330 0 1.0
NC_020287_2 2.12|66969|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66969-67007 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 66969-67007 0 1.0
NC_020287_2 2.12|66969|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66969-67007 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 69368-69406 0 1.0
NC_020287_2 2.12|66969|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 66969-67007 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 69368-69406 0 1.0
NC_020287_2 2.13|67045|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67045-67082 38 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 67045-67082 0 1.0
NC_020287_2 2.13|67045|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67045-67082 38 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 69444-69481 0 1.0
NC_020287_2 2.13|67045|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67045-67082 38 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 69444-69481 0 1.0
NC_020287_2 2.14|67120|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67120-67160 41 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 67120-67160 0 1.0
NC_020287_2 2.14|67120|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67120-67160 41 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 69519-69559 0 1.0
NC_020287_2 2.14|67120|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67120-67160 41 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 69519-69559 0 1.0
NC_020287_2 2.15|67198|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67198-67235 38 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 67198-67235 0 1.0
NC_020287_2 2.15|67198|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67198-67235 38 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 69597-69634 0 1.0
NC_020287_2 2.15|67198|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67198-67235 38 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 69597-69634 0 1.0
NC_020287_2 2.16|67273|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67273-67310 38 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 67273-67310 0 1.0
NC_020287_2 2.16|67273|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67273-67310 38 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 69672-69709 0 1.0
NC_020287_2 2.16|67273|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67273-67310 38 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 69672-69709 0 1.0
NC_020287_2 2.17|67348|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67348-67387 40 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 67348-67387 0 1.0
NC_020287_2 2.17|67348|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67348-67387 40 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 69747-69786 0 1.0
NC_020287_2 2.17|67348|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67348-67387 40 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 69747-69786 0 1.0
NC_020287_2 2.18|67425|42|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67425-67466 42 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 67425-67466 0 1.0
NC_020287_2 2.18|67425|42|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67425-67466 42 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 69824-69865 0 1.0
NC_020287_2 2.18|67425|42|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67425-67466 42 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 69824-69865 0 1.0
NC_020287_2 2.19|67504|43|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67504-67546 43 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 67504-67546 0 1.0
NC_020287_2 2.19|67504|43|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67504-67546 43 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 69903-69945 0 1.0
NC_020287_2 2.19|67504|43|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67504-67546 43 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 69903-69945 0 1.0
NC_020287_2 2.20|67584|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67584-67618 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 67584-67618 0 1.0
NC_020287_2 2.20|67584|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67584-67618 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 69983-70017 0 1.0
NC_020287_2 2.20|67584|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67584-67618 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 69983-70017 0 1.0
NC_020287_2 2.21|67656|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67656-67695 40 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 67656-67695 0 1.0
NC_020287_2 2.21|67656|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67656-67695 40 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 70055-70094 0 1.0
NC_020287_2 2.21|67656|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67656-67695 40 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 70055-70094 0 1.0
NC_020287_2 2.22|67733|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67733-67769 37 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 67733-67769 0 1.0
NC_020287_2 2.22|67733|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67733-67769 37 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 70132-70168 0 1.0
NC_020287_2 2.22|67733|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67733-67769 37 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 70132-70168 0 1.0
NC_020287_2 2.23|67807|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67807-67847 41 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 67807-67847 0 1.0
NC_020287_2 2.23|67807|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67807-67847 41 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 70206-70246 0 1.0
NC_020287_2 2.23|67807|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67807-67847 41 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 70206-70246 0 1.0
NC_020287_2 2.24|67885|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67885-67919 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 67885-67919 0 1.0
NC_020287_2 2.24|67885|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67885-67919 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 70284-70318 0 1.0
NC_020287_2 2.24|67885|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67885-67919 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 70284-70318 0 1.0
NC_020287_2 2.25|67957|45|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67957-68001 45 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 67957-68001 0 1.0
NC_020287_2 2.25|67957|45|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67957-68001 45 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 70356-70400 0 1.0
NC_020287_2 2.25|67957|45|NC_020287|PILER-CR,CRISPRCasFinder,CRT 67957-68001 45 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 70356-70400 0 1.0
NC_020287_2 2.26|68039|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68039-68076 38 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 68039-68076 0 1.0
NC_020287_2 2.26|68039|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68039-68076 38 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 70438-70475 0 1.0
NC_020287_2 2.26|68039|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68039-68076 38 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 70438-70475 0 1.0
NC_020287_2 2.27|68114|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68114-68152 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 68114-68152 0 1.0
NC_020287_2 2.27|68114|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68114-68152 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 70513-70551 0 1.0
NC_020287_2 2.27|68114|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68114-68152 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 70513-70551 0 1.0
NC_020287_2 2.28|68190|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68190-68226 37 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 68190-68226 0 1.0
NC_020287_2 2.28|68190|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68190-68226 37 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 70589-70625 0 1.0
NC_020287_2 2.28|68190|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68190-68226 37 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 70589-70625 0 1.0
NC_020287_2 2.29|68264|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68264-68303 40 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 68264-68303 0 1.0
NC_020287_2 2.29|68264|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68264-68303 40 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 70663-70702 0 1.0
NC_020287_2 2.29|68264|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68264-68303 40 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 70663-70702 0 1.0
NC_020287_2 2.30|68341|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68341-68380 40 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 68341-68380 0 1.0
NC_020287_2 2.30|68341|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68341-68380 40 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 70740-70779 0 1.0
NC_020287_2 2.30|68341|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68341-68380 40 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 70740-70779 0 1.0
NC_020287_2 2.31|68418|34|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68418-68451 34 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 68418-68451 0 1.0
NC_020287_2 2.31|68418|34|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68418-68451 34 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 70817-70850 0 1.0
NC_020287_2 2.31|68418|34|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68418-68451 34 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 70817-70850 0 1.0
NC_020287_2 2.32|68489|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68489-68527 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 68489-68527 0 1.0
NC_020287_2 2.32|68489|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68489-68527 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 70888-70926 0 1.0
NC_020287_2 2.32|68489|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68489-68527 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 70888-70926 0 1.0
NC_020287_2 2.33|68565|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68565-68600 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 68565-68600 0 1.0
NC_020287_2 2.33|68565|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68565-68600 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 70964-70999 0 1.0
NC_020287_2 2.33|68565|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68565-68600 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 70964-70999 0 1.0
NC_020287_2 2.34|68638|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68638-68672 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 68638-68672 0 1.0
NC_020287_2 2.34|68638|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68638-68672 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 71037-71071 0 1.0
NC_020287_2 2.34|68638|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68638-68672 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 71037-71071 0 1.0
NC_020287_2 2.35|68710|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68710-68745 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 68710-68745 0 1.0
NC_020287_2 2.35|68710|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68710-68745 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 71109-71144 0 1.0
NC_020287_2 2.35|68710|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68710-68745 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 71109-71144 0 1.0
NC_020287_2 2.36|68783|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68783-68821 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 68783-68821 0 1.0
NC_020287_2 2.36|68783|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68783-68821 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 71182-71220 0 1.0
NC_020287_2 2.36|68783|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68783-68821 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 71182-71220 0 1.0
NC_020287_2 2.37|68859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68859-68894 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 68859-68894 0 1.0
NC_020287_2 2.37|68859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68859-68894 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 69009-69044 0 1.0
NC_020287_2 2.37|68859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68859-68894 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 71258-71293 0 1.0
NC_020287_2 2.37|68859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68859-68894 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 71408-71443 0 1.0
NC_020287_2 2.37|68859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68859-68894 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 71258-71293 0 1.0
NC_020287_2 2.37|68859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68859-68894 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 71408-71443 0 1.0
NC_020287_2 2.38|68932|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68932-68971 40 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 68932-68971 0 1.0
NC_020287_2 2.38|68932|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68932-68971 40 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 71331-71370 0 1.0
NC_020287_2 2.38|68932|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68932-68971 40 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 71481-71520 0 1.0
NC_020287_2 2.38|68932|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68932-68971 40 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 71331-71370 0 1.0
NC_020287_2 2.38|68932|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68932-68971 40 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 71481-71520 0 1.0
NC_020287_2 2.39|69009|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69009-69044 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 68859-68894 0 1.0
NC_020287_2 2.39|69009|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69009-69044 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 69009-69044 0 1.0
NC_020287_2 2.39|69009|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69009-69044 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 71258-71293 0 1.0
NC_020287_2 2.39|69009|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69009-69044 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 71408-71443 0 1.0
NC_020287_2 2.39|69009|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69009-69044 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 71258-71293 0 1.0
NC_020287_2 2.39|69009|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69009-69044 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 71408-71443 0 1.0
NC_020287_2 2.40|69082|30|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69082-69111 30 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 69082-69111 0 1.0
NC_020287_2 2.41|69149|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69149-69184 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 69149-69184 0 1.0
NC_020287_2 2.41|69149|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69149-69184 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 71707-71742 0 1.0
NC_020287_2 2.41|69149|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69149-69184 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 71707-71742 0 1.0
NC_020287_2 2.42|69222|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69222-69258 37 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 69222-69258 0 1.0
NC_020287_2 2.42|69222|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69222-69258 37 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 71780-71816 0 1.0
NC_020287_2 2.42|69222|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69222-69258 37 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 71780-71816 0 1.0
NC_020287_2 2.43|69296|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69296-69335 40 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 69296-69335 0 1.0
NC_020287_2 2.43|69296|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69296-69335 40 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 71854-71893 0 1.0
NC_020287_2 2.44|69373|43|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69373-69415 43 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 69373-69415 0 1.0
NC_020287_2 2.44|69373|43|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69373-69415 43 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 71854-71896 0 1.0
NC_020287_2 2.44|69373|43|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69373-69415 43 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 71931-71973 0 1.0
NC_020287_2 2.45|69453|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69453-69489 37 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 69453-69489 0 1.0
NC_020287_2 2.45|69453|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69453-69489 37 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 71934-71970 0 1.0
NC_020287_2 2.45|69453|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69453-69489 37 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 72011-72047 0 1.0
NC_020287_2 2.46|69527|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69527-69567 41 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 69527-69567 0 1.0
NC_020287_2 2.46|69527|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69527-69567 41 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 72008-72048 0 1.0
NC_020287_2 2.46|69527|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69527-69567 41 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 72085-72125 0 1.0
NC_020287_2 2.47|69605|35|NC_020287|CRISPRCasFinder,CRT 69605-69639 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 69605-69639 0 1.0
NC_020287_2 2.47|69605|35|NC_020287|CRISPRCasFinder,CRT 69605-69639 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 72086-72120 0 1.0
NC_020287_2 2.47|69605|35|NC_020287|CRISPRCasFinder,CRT 69605-69639 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 72163-72197 0 1.0
NC_020287_2 2.48|69677|45|NC_020287|CRISPRCasFinder,CRT,PILER-CR 69677-69721 45 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 69677-69721 0 1.0
NC_020287_2 2.48|69677|45|NC_020287|CRISPRCasFinder,CRT,PILER-CR 69677-69721 45 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 72158-72202 0 1.0
NC_020287_2 2.48|69677|45|NC_020287|CRISPRCasFinder,CRT,PILER-CR 69677-69721 45 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 72235-72279 0 1.0
NC_020287_2 2.49|69759|41|NC_020287|CRISPRCasFinder,CRT,PILER-CR 69759-69799 41 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 69759-69799 0 1.0
NC_020287_2 2.49|69759|41|NC_020287|CRISPRCasFinder,CRT,PILER-CR 69759-69799 41 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 72240-72280 0 1.0
NC_020287_2 2.49|69759|41|NC_020287|CRISPRCasFinder,CRT,PILER-CR 69759-69799 41 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 72317-72357 0 1.0
NC_020287_2 2.50|69837|40|NC_020287|CRISPRCasFinder,CRT,PILER-CR 69837-69876 40 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 69837-69876 0 1.0
NC_020287_2 2.50|69837|40|NC_020287|CRISPRCasFinder,CRT,PILER-CR 69837-69876 40 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 72318-72357 0 1.0
NC_020287_2 2.50|69837|40|NC_020287|CRISPRCasFinder,CRT,PILER-CR 69837-69876 40 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 72395-72434 0 1.0
NC_020287_2 2.51|69914|45|NC_020287|CRISPRCasFinder,CRT,PILER-CR 69914-69958 45 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 69914-69958 0 1.0
NC_020287_2 2.51|69914|45|NC_020287|CRISPRCasFinder,CRT,PILER-CR 69914-69958 45 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 72395-72439 0 1.0
NC_020287_2 2.51|69914|45|NC_020287|CRISPRCasFinder,CRT,PILER-CR 69914-69958 45 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 72472-72516 0 1.0
NC_020287_2 2.52|69996|34|NC_020287|CRISPRCasFinder,CRT,PILER-CR 69996-70029 34 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 69996-70029 0 1.0
NC_020287_2 2.52|69996|34|NC_020287|CRISPRCasFinder,CRT,PILER-CR 69996-70029 34 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 72477-72510 0 1.0
NC_020287_2 2.52|69996|34|NC_020287|CRISPRCasFinder,CRT,PILER-CR 69996-70029 34 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 72554-72587 0 1.0
NC_020287_2 2.53|70067|46|NC_020287|CRISPRCasFinder,CRT,PILER-CR 70067-70112 46 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 70067-70112 0 1.0
NC_020287_2 2.53|70067|46|NC_020287|CRISPRCasFinder,CRT,PILER-CR 70067-70112 46 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 72548-72593 0 1.0
NC_020287_2 2.53|70067|46|NC_020287|CRISPRCasFinder,CRT,PILER-CR 70067-70112 46 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 72625-72670 0 1.0
NC_020287_2 2.54|70150|34|NC_020287|CRISPRCasFinder,CRT,PILER-CR 70150-70183 34 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 70150-70183 0 1.0
NC_020287_2 2.54|70150|34|NC_020287|CRISPRCasFinder,CRT,PILER-CR 70150-70183 34 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 72631-72664 0 1.0
NC_020287_2 2.54|70150|34|NC_020287|CRISPRCasFinder,CRT,PILER-CR 70150-70183 34 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 72708-72741 0 1.0
NC_020287_3 3.1|87583|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87583-87618 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 87583-87618 0 1.0
NC_020287_3 3.1|87583|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87583-87618 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 90064-90099 0 1.0
NC_020287_3 3.1|87583|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87583-87618 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 90141-90176 0 1.0
NC_020287_3 3.2|87655|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87655-87690 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 87655-87690 0 1.0
NC_020287_3 3.2|87655|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87655-87690 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 90136-90171 0 1.0
NC_020287_3 3.2|87655|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87655-87690 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 90213-90248 0 1.0
NC_020287_3 3.3|87727|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87727-87761 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 87727-87761 0 1.0
NC_020287_3 3.3|87727|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87727-87761 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 90208-90242 0 1.0
NC_020287_3 3.3|87727|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87727-87761 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 90285-90319 0 1.0
NC_020287_3 3.4|87798|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87798-87833 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 87798-87833 0 1.0
NC_020287_3 3.4|87798|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87798-87833 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 90279-90314 0 1.0
NC_020287_3 3.4|87798|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87798-87833 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 90356-90391 0 1.0
NC_020287_3 3.5|87870|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87870-87908 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 87870-87908 0 1.0
NC_020287_3 3.5|87870|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87870-87908 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 90351-90389 0 1.0
NC_020287_3 3.5|87870|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87870-87908 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 90428-90466 0 1.0
NC_020287_3 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87945-87980 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 87945-87980 0 1.0
NC_020287_3 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87945-87980 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 90426-90461 0 1.0
NC_020287_3 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87945-87980 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 90503-90538 0 1.0
NC_020287_3 3.7|88017|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88017-88051 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 88017-88051 0 1.0
NC_020287_3 3.7|88017|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88017-88051 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 90498-90532 0 1.0
NC_020287_3 3.7|88017|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88017-88051 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 90575-90609 0 1.0
NC_020287_3 3.8|88088|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88088-88124 37 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 88088-88124 0 1.0
NC_020287_3 3.8|88088|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88088-88124 37 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 90569-90605 0 1.0
NC_020287_3 3.8|88088|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88088-88124 37 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 90646-90682 0 1.0
NC_020287_3 3.9|88161|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88161-88197 37 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 88161-88197 0 1.0
NC_020287_3 3.9|88161|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88161-88197 37 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 90642-90678 0 1.0
NC_020287_3 3.9|88161|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88161-88197 37 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 90719-90755 0 1.0
NC_020287_3 3.10|88234|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88234-88269 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 88234-88269 0 1.0
NC_020287_3 3.10|88234|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88234-88269 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 90715-90750 0 1.0
NC_020287_3 3.10|88234|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88234-88269 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 90792-90827 0 1.0
NC_020287_3 3.11|88306|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88306-88342 37 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 88306-88342 0 1.0
NC_020287_3 3.11|88306|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88306-88342 37 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 90787-90823 0 1.0
NC_020287_3 3.11|88306|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88306-88342 37 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 90864-90900 0 1.0
NC_020287_3 3.12|88379|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88379-88413 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 88379-88413 0 1.0
NC_020287_3 3.12|88379|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88379-88413 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 90860-90894 0 1.0
NC_020287_3 3.12|88379|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88379-88413 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 90937-90971 0 1.0
NC_020287_3 3.13|88450|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88450-88485 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 88450-88485 0 1.0
NC_020287_3 3.13|88450|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88450-88485 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 90931-90966 0 1.0
NC_020287_3 3.13|88450|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88450-88485 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 91008-91043 0 1.0
NC_020287_3 3.14|88522|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88522-88557 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 88522-88557 0 1.0
NC_020287_3 3.14|88522|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88522-88557 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 91003-91038 0 1.0
NC_020287_3 3.14|88522|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88522-88557 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 91080-91115 0 1.0
NC_020287_3 3.15|88594|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88594-88634 41 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 88594-88634 0 1.0
NC_020287_3 3.15|88594|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88594-88634 41 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 91075-91115 0 1.0
NC_020287_3 3.15|88594|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88594-88634 41 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 91152-91192 0 1.0
NC_020287_3 3.16|88671|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88671-88705 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 88671-88705 0 1.0
NC_020287_3 3.16|88671|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88671-88705 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 91152-91186 0 1.0
NC_020287_3 3.16|88671|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88671-88705 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 91229-91263 0 1.0
NC_020287_3 3.17|88742|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88742-88780 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 88742-88780 0 1.0
NC_020287_3 3.17|88742|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88742-88780 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 91223-91261 0 1.0
NC_020287_3 3.17|88742|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88742-88780 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 91300-91338 0 1.0
NC_020287_3 3.18|88817|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88817-88853 37 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 88817-88853 0 1.0
NC_020287_3 3.18|88817|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88817-88853 37 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 91298-91334 0 1.0
NC_020287_3 3.18|88817|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88817-88853 37 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 91375-91411 0 1.0
NC_020287_3 3.19|88890|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88890-88927 38 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 88890-88927 0 1.0
NC_020287_3 3.19|88890|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88890-88927 38 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 91371-91408 0 1.0
NC_020287_3 3.19|88890|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88890-88927 38 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 91448-91485 0 1.0
NC_020287_3 3.20|88964|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88964-89003 40 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 88964-89003 0 1.0
NC_020287_3 3.20|88964|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88964-89003 40 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 91445-91484 0 1.0
NC_020287_3 3.20|88964|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88964-89003 40 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 91522-91561 0 1.0
NC_020287_3 3.21|89040|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89040-89078 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 89040-89078 0 1.0
NC_020287_3 3.21|89040|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89040-89078 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 91521-91559 0 1.0
NC_020287_3 3.21|89040|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89040-89078 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 91598-91636 0 1.0
NC_020287_3 3.22|89115|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89115-89149 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 89115-89149 0 1.0
NC_020287_3 3.22|89115|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89115-89149 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 91596-91630 0 1.0
NC_020287_3 3.22|89115|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89115-89149 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 91673-91707 0 1.0
NC_020287_3 3.23|89186|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89186-89222 37 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 89186-89222 0 1.0
NC_020287_3 3.23|89186|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89186-89222 37 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 91667-91703 0 1.0
NC_020287_3 3.23|89186|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89186-89222 37 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 91744-91780 0 1.0
NC_020287_3 3.24|89259|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89259-89298 40 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 89259-89298 0 1.0
NC_020287_3 3.24|89259|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89259-89298 40 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 91740-91779 0 1.0
NC_020287_3 3.24|89259|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89259-89298 40 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 91817-91856 0 1.0
NC_020287_3 3.25|89335|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89335-89373 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 89335-89373 0 1.0
NC_020287_3 3.25|89335|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89335-89373 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 91816-91854 0 1.0
NC_020287_3 3.25|89335|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89335-89373 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 91893-91931 0 1.0
NC_020287_3 3.26|89410|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89410-89448 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 89410-89448 0 1.0
NC_020287_3 3.26|89410|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89410-89448 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 91891-91929 0 1.0
NC_020287_3 3.26|89410|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89410-89448 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 91968-92006 0 1.0
NC_020287_3 3.27|89485|46|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89485-89530 46 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 89485-89530 0 1.0
NC_020287_3 3.27|89485|46|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89485-89530 46 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 91966-92011 0 1.0
NC_020287_3 3.27|89485|46|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89485-89530 46 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 92043-92088 0 1.0
NC_020287_3 3.28|89567|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89567-89605 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 89567-89605 0 1.0
NC_020287_3 3.28|89567|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89567-89605 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 92048-92086 0 1.0
NC_020287_3 3.28|89567|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89567-89605 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 92125-92163 0 1.0
NC_020287_3 3.29|89642|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89642-89677 36 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 89642-89677 0 1.0
NC_020287_3 3.29|89642|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89642-89677 36 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 92123-92158 0 1.0
NC_020287_3 3.29|89642|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89642-89677 36 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 92200-92235 0 1.0
NC_020287_3 3.30|89714|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89714-89752 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 89714-89752 0 1.0
NC_020287_3 3.30|89714|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89714-89752 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 92195-92233 0 1.0
NC_020287_3 3.30|89714|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT 89714-89752 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 92272-92310 0 1.0
NC_020287_3 3.31|89789|42|NC_020287|CRISPRCasFinder,CRT 89789-89830 42 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 89789-89830 0 1.0
NC_020287_3 3.31|89789|42|NC_020287|CRISPRCasFinder,CRT 89789-89830 42 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 92270-92311 0 1.0
NC_020287_3 3.31|89789|42|NC_020287|CRISPRCasFinder,CRT 89789-89830 42 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 92347-92388 0 1.0
NC_020287_3 3.32|89867|41|NC_020287|CRISPRCasFinder,CRT 89867-89907 41 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 89867-89907 0 1.0
NC_020287_3 3.32|89867|41|NC_020287|CRISPRCasFinder,CRT 89867-89907 41 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 92348-92388 0 1.0
NC_020287_3 3.32|89867|41|NC_020287|CRISPRCasFinder,CRT 89867-89907 41 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 92425-92465 0 1.0
NC_020287_3 3.33|89944|35|NC_020287|CRISPRCasFinder,CRT 89944-89978 35 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 89944-89978 0 1.0
NC_020287_3 3.33|89944|35|NC_020287|CRISPRCasFinder,CRT 89944-89978 35 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 92425-92459 0 1.0
NC_020287_3 3.33|89944|35|NC_020287|CRISPRCasFinder,CRT 89944-89978 35 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 92502-92536 0 1.0
NC_020287_3 3.34|90015|47|NC_020287|CRISPRCasFinder,CRT,PILER-CR 90015-90061 47 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 90015-90061 0 1.0
NC_020287_3 3.34|90015|47|NC_020287|CRISPRCasFinder,CRT,PILER-CR 90015-90061 47 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 92496-92542 0 1.0
NC_020287_3 3.34|90015|47|NC_020287|CRISPRCasFinder,CRT,PILER-CR 90015-90061 47 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 92573-92619 0 1.0
NC_020287_3 3.35|90098|37|NC_020287|CRISPRCasFinder,CRT,PILER-CR 90098-90134 37 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 90098-90134 0 1.0
NC_020287_3 3.35|90098|37|NC_020287|CRISPRCasFinder,CRT,PILER-CR 90098-90134 37 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 92579-92615 0 1.0
NC_020287_3 3.35|90098|37|NC_020287|CRISPRCasFinder,CRT,PILER-CR 90098-90134 37 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 92656-92692 0 1.0
NC_020287_3 3.36|90171|39|NC_020287|CRISPRCasFinder,CRT,PILER-CR 90171-90209 39 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 90171-90209 0 1.0
NC_020287_3 3.36|90171|39|NC_020287|CRISPRCasFinder,CRT,PILER-CR 90171-90209 39 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 92652-92690 0 1.0
NC_020287_3 3.36|90171|39|NC_020287|CRISPRCasFinder,CRT,PILER-CR 90171-90209 39 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 92729-92767 0 1.0
NC_020287_3 3.37|90246|43|NC_020287|CRISPRCasFinder,CRT,PILER-CR 90246-90288 43 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 90246-90288 0 1.0
NC_020287_3 3.37|90246|43|NC_020287|CRISPRCasFinder,CRT,PILER-CR 90246-90288 43 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 92727-92769 0 1.0
NC_020287_3 3.37|90246|43|NC_020287|CRISPRCasFinder,CRT,PILER-CR 90246-90288 43 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 92804-92846 0 1.0
NC_020287_3 3.38|90325|40|NC_020287|CRISPRCasFinder,CRT,PILER-CR 90325-90364 40 NC_020287 Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence 90325-90364 0 1.0
NC_020287_3 3.38|90325|40|NC_020287|CRISPRCasFinder,CRT,PILER-CR 90325-90364 40 NZ_CP028097 Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence 92806-92845 0 1.0
NC_020287_3 3.38|90325|40|NC_020287|CRISPRCasFinder,CRT,PILER-CR 90325-90364 40 NC_005230 Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence 92883-92922 0 1.0
NC_020287_2 2.40|69082|30|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69082-69111 30 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 639472-639501 6 0.8
NC_020287_1 1.15|17366|32|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17366-17397 32 NZ_CP039845 Acetobacter pasteurianus strain CICC 22518 plasmid pAP22518-1, complete sequence 198113-198144 8 0.75
NC_020287_3 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87945-87980 36 MH560358 Escherichia virus KFS-EC, complete genome 153108-153143 8 0.778
NC_020287_3 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87945-87980 36 MT764208 Escherichia phage JEP8, complete genome 125314-125349 8 0.778
NC_020287_3 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87945-87980 36 MF327006 Shigella phage Sf20, complete genome 146092-146127 8 0.778
NC_020287_3 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87945-87980 36 NC_025425 Enterobacteria phage GEC-3S complete genome 45693-45728 8 0.778
NC_020287_3 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87945-87980 36 MN709127 Escherichia virus Ec_Makalu_002, complete genome 45037-45072 8 0.778
NC_020287_3 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87945-87980 36 MK962753 Shigella phage JK32, complete genome 47004-47039 8 0.778
NC_020287_3 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87945-87980 36 MN850574 Escherichia phage kaaroe, complete genome 61636-61671 8 0.778
NC_020287_3 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87945-87980 36 MN894885 Escherichia virus Ec_Makalu_001, complete genome 45046-45081 8 0.778
NC_020287_3 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT 87945-87980 36 MN882349 Escherichia virus Ec_Makalu_003, complete genome 45247-45282 8 0.778
NC_020287_1 1.15|17366|32|NC_020287|PILER-CR,CRISPRCasFinder,CRT 17366-17397 32 NZ_CP054603 Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed4, complete sequence 157325-157356 9 0.719
NC_020287_2 2.28|68190|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68190-68226 37 NC_030904 Bacillus phage vB_BhaS-171, complete genome 33336-33372 9 0.757
NC_020287_2 2.40|69082|30|NC_020287|PILER-CR,CRISPRCasFinder,CRT 69082-69111 30 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 15776-15805 9 0.7
NC_020287_2 2.28|68190|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 68190-68226 37 NZ_CP018385 Burkholderia pseudomallei strain 2008724860 plasmid p1, complete sequence 169699-169735 10 0.73
NC_020287_3 3.11|88306|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT 88306-88342 37 NZ_CP024791 Nostoc flagelliforme CCNUN1 plasmid pNFSY06, complete sequence 48178-48214 10 0.73

1. spacer 1.1|16347|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

gattgttgtgcccctggcggtcgctttcaatgcct	CRISPR spacer
gattgttgtgcccctggcggtcgctttcaatgcct	Protospacer
***********************************

2. spacer 1.1|16347|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gattgttgtgcccctggcggtcgctttcaatgcct	CRISPR spacer
gattgttgtgcccctggcggtcgctttcaatgcct	Protospacer
***********************************

3. spacer 1.1|16347|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gattgttgtgcccctggcggtcgctttcaatgcct	CRISPR spacer
gattgttgtgcccctggcggtcgctttcaatgcct	Protospacer
***********************************

4. spacer 1.2|16419|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

taatcctaattaggtttgagttagtatctagtgccat	CRISPR spacer
taatcctaattaggtttgagttagtatctagtgccat	Protospacer
*************************************

5. spacer 1.2|16419|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

taatcctaattaggtttgagttagtatctagtgccat	CRISPR spacer
taatcctaattaggtttgagttagtatctagtgccat	Protospacer
*************************************

6. spacer 1.2|16419|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

taatcctaattaggtttgagttagtatctagtgccat	CRISPR spacer
taatcctaattaggtttgagttagtatctagtgccat	Protospacer
*************************************

7. spacer 1.3|16493|33|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

acagattttgcttcagctagtaccaaaggctag	CRISPR spacer
acagattttgcttcagctagtaccaaaggctag	Protospacer
*********************************

8. spacer 1.3|16493|33|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

acagattttgcttcagctagtaccaaaggctag	CRISPR spacer
acagattttgcttcagctagtaccaaaggctag	Protospacer
*********************************

9. spacer 1.3|16493|33|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

acagattttgcttcagctagtaccaaaggctag	CRISPR spacer
acagattttgcttcagctagtaccaaaggctag	Protospacer
*********************************

10. spacer 1.4|16563|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtaactaccttctaagtctgtagcgatgaatgtgg	CRISPR spacer
tcgtaactaccttctaagtctgtagcgatgaatgtgg	Protospacer
*************************************

11. spacer 1.4|16563|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtaactaccttctaagtctgtagcgatgaatgtgg	CRISPR spacer
tcgtaactaccttctaagtctgtagcgatgaatgtgg	Protospacer
*************************************

12. spacer 1.4|16563|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtaactaccttctaagtctgtagcgatgaatgtgg	CRISPR spacer
tcgtaactaccttctaagtctgtagcgatgaatgtgg	Protospacer
*************************************

13. spacer 1.5|16637|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

caaaatatagggaagaattttagaaagaacctcagaa	CRISPR spacer
caaaatatagggaagaattttagaaagaacctcagaa	Protospacer
*************************************

14. spacer 1.5|16637|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

caaaatatagggaagaattttagaaagaacctcagaa	CRISPR spacer
caaaatatagggaagaattttagaaagaacctcagaa	Protospacer
*************************************

15. spacer 1.5|16637|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

caaaatatagggaagaattttagaaagaacctcagaa	CRISPR spacer
caaaatatagggaagaattttagaaagaacctcagaa	Protospacer
*************************************

16. spacer 1.6|16711|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

aactaaggcatcccatagcattccgctacgatctatcag	CRISPR spacer
aactaaggcatcccatagcattccgctacgatctatcag	Protospacer
***************************************

17. spacer 1.6|16711|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aactaaggcatcccatagcattccgctacgatctatcag	CRISPR spacer
aactaaggcatcccatagcattccgctacgatctatcag	Protospacer
***************************************

18. spacer 1.6|16711|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aactaaggcatcccatagcattccgctacgatctatcag	CRISPR spacer
aactaaggcatcccatagcattccgctacgatctatcag	Protospacer
***************************************

19. spacer 1.7|16787|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

taataattgctgattaatcgtggtggtggtggtgg	CRISPR spacer
taataattgctgattaatcgtggtggtggtggtgg	Protospacer
***********************************

20. spacer 1.7|16787|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

taataattgctgattaatcgtggtggtggtggtgg	CRISPR spacer
taataattgctgattaatcgtggtggtggtggtgg	Protospacer
***********************************

21. spacer 1.7|16787|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

taataattgctgattaatcgtggtggtggtggtgg	CRISPR spacer
taataattgctgattaatcgtggtggtggtggtgg	Protospacer
***********************************

22. spacer 1.8|16859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

gatatatggctaaatattgctcaaaagattttaata	CRISPR spacer
gatatatggctaaatattgctcaaaagattttaata	Protospacer
************************************

23. spacer 1.8|16859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gatatatggctaaatattgctcaaaagattttaata	CRISPR spacer
gatatatggctaaatattgctcaaaagattttaata	Protospacer
************************************

24. spacer 1.8|16859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gatatatggctaaatattgctcaaaagattttaata	CRISPR spacer
gatatatggctaaatattgctcaaaagattttaata	Protospacer
************************************

25. spacer 1.9|16932|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

attagattggtcgtgttttgattaacggtgctagc	CRISPR spacer
attagattggtcgtgttttgattaacggtgctagc	Protospacer
***********************************

26. spacer 1.9|16932|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

attagattggtcgtgttttgattaacggtgctagc	CRISPR spacer
attagattggtcgtgttttgattaacggtgctagc	Protospacer
***********************************

27. spacer 1.9|16932|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

attagattggtcgtgttttgattaacggtgctagc	CRISPR spacer
attagattggtcgtgttttgattaacggtgctagc	Protospacer
***********************************

28. spacer 1.10|17004|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ttgccatcccaggcaacatagcaagcatggaggtg	CRISPR spacer
ttgccatcccaggcaacatagcaagcatggaggtg	Protospacer
***********************************

29. spacer 1.10|17004|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ttgccatcccaggcaacatagcaagcatggaggtg	CRISPR spacer
ttgccatcccaggcaacatagcaagcatggaggtg	Protospacer
***********************************

30. spacer 1.10|17004|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttgccatcccaggcaacatagcaagcatggaggtg	CRISPR spacer
ttgccatcccaggcaacatagcaagcatggaggtg	Protospacer
***********************************

31. spacer 1.10|17004|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttgccatcccaggcaacatagcaagcatggaggtg	CRISPR spacer
ttgccatcccaggcaacatagcaagcatggaggtg	Protospacer
***********************************

32. spacer 1.10|17004|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttgccatcccaggcaacatagcaagcatggaggtg	CRISPR spacer
ttgccatcccaggcaacatagcaagcatggaggtg	Protospacer
***********************************

33. spacer 1.10|17004|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttgccatcccaggcaacatagcaagcatggaggtg	CRISPR spacer
ttgccatcccaggcaacatagcaagcatggaggtg	Protospacer
***********************************

34. spacer 1.11|17076|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ttgccatcccaggcaacatagcaagcatggaggtg	CRISPR spacer
ttgccatcccaggcaacatagcaagcatggaggtg	Protospacer
***********************************

35. spacer 1.11|17076|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ttgccatcccaggcaacatagcaagcatggaggtg	CRISPR spacer
ttgccatcccaggcaacatagcaagcatggaggtg	Protospacer
***********************************

36. spacer 1.11|17076|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttgccatcccaggcaacatagcaagcatggaggtg	CRISPR spacer
ttgccatcccaggcaacatagcaagcatggaggtg	Protospacer
***********************************

37. spacer 1.11|17076|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttgccatcccaggcaacatagcaagcatggaggtg	CRISPR spacer
ttgccatcccaggcaacatagcaagcatggaggtg	Protospacer
***********************************

38. spacer 1.11|17076|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttgccatcccaggcaacatagcaagcatggaggtg	CRISPR spacer
ttgccatcccaggcaacatagcaagcatggaggtg	Protospacer
***********************************

39. spacer 1.11|17076|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttgccatcccaggcaacatagcaagcatggaggtg	CRISPR spacer
ttgccatcccaggcaacatagcaagcatggaggtg	Protospacer
***********************************

40. spacer 1.12|17148|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ttgcggacagactcgattaagtcaataacagcttgg	CRISPR spacer
ttgcggacagactcgattaagtcaataacagcttgg	Protospacer
************************************

41. spacer 1.12|17148|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttgcggacagactcgattaagtcaataacagcttgg	CRISPR spacer
ttgcggacagactcgattaagtcaataacagcttgg	Protospacer
************************************

42. spacer 1.12|17148|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttgcggacagactcgattaagtcaataacagcttgg	CRISPR spacer
ttgcggacagactcgattaagtcaataacagcttgg	Protospacer
************************************

43. spacer 1.13|17221|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

cttgccctaattttcctggtggaaaagccgctggct	CRISPR spacer
cttgccctaattttcctggtggaaaagccgctggct	Protospacer
************************************

44. spacer 1.13|17221|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cttgccctaattttcctggtggaaaagccgctggct	CRISPR spacer
cttgccctaattttcctggtggaaaagccgctggct	Protospacer
************************************

45. spacer 1.13|17221|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cttgccctaattttcctggtggaaaagccgctggct	CRISPR spacer
cttgccctaattttcctggtggaaaagccgctggct	Protospacer
************************************

46. spacer 1.14|17294|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

atagcaagttgctagagaaagcgcaacaaaacaag	CRISPR spacer
atagcaagttgctagagaaagcgcaacaaaacaag	Protospacer
***********************************

47. spacer 1.14|17294|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

atagcaagttgctagagaaagcgcaacaaaacaag	CRISPR spacer
atagcaagttgctagagaaagcgcaacaaaacaag	Protospacer
***********************************

48. spacer 1.14|17294|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

atagcaagttgctagagaaagcgcaacaaaacaag	CRISPR spacer
atagcaagttgctagagaaagcgcaacaaaacaag	Protospacer
***********************************

49. spacer 1.15|17366|32|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tagtccctcccacactgccaatatttcttcat	CRISPR spacer
tagtccctcccacactgccaatatttcttcat	Protospacer
********************************

50. spacer 1.15|17366|32|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tagtccctcccacactgccaatatttcttcat	CRISPR spacer
tagtccctcccacactgccaatatttcttcat	Protospacer
********************************

51. spacer 1.15|17366|32|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tagtccctcccacactgccaatatttcttcat	CRISPR spacer
tagtccctcccacactgccaatatttcttcat	Protospacer
********************************

52. spacer 1.16|17435|31|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tccgtctgtatgacttatactcgcaaggatt	CRISPR spacer
tccgtctgtatgacttatactcgcaaggatt	Protospacer
*******************************

53. spacer 1.16|17435|31|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tccgtctgtatgacttatactcgcaaggatt	CRISPR spacer
tccgtctgtatgacttatactcgcaaggatt	Protospacer
*******************************

54. spacer 1.16|17435|31|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tccgtctgtatgacttatactcgcaaggatt	CRISPR spacer
tccgtctgtatgacttatactcgcaaggatt	Protospacer
*******************************

55. spacer 2.1|66137|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tgtagtagaaccaatcggggtcgtcaataactcccg	CRISPR spacer
tgtagtagaaccaatcggggtcgtcaataactcccg	Protospacer
************************************

56. spacer 2.1|66137|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtagtagaaccaatcggggtcgtcaataactcccg	CRISPR spacer
tgtagtagaaccaatcggggtcgtcaataactcccg	Protospacer
************************************

57. spacer 2.1|66137|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtagtagaaccaatcggggtcgtcaataactcccg	CRISPR spacer
tgtagtagaaccaatcggggtcgtcaataactcccg	Protospacer
************************************

58. spacer 2.2|66210|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

cggggcttggggggttggagtccccgcccccgtggtggga	CRISPR spacer
cggggcttggggggttggagtccccgcccccgtggtggga	Protospacer
****************************************

59. spacer 2.2|66210|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cggggcttggggggttggagtccccgcccccgtggtggga	CRISPR spacer
cggggcttggggggttggagtccccgcccccgtggtggga	Protospacer
****************************************

60. spacer 2.2|66210|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cggggcttggggggttggagtccccgcccccgtggtggga	CRISPR spacer
cggggcttggggggttggagtccccgcccccgtggtggga	Protospacer
****************************************

61. spacer 2.3|66287|42|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgagttgcataatgcctcctaatggctgttggactcataa	CRISPR spacer
tgtgagttgcataatgcctcctaatggctgttggactcataa	Protospacer
******************************************

62. spacer 2.3|66287|42|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgagttgcataatgcctcctaatggctgttggactcataa	CRISPR spacer
tgtgagttgcataatgcctcctaatggctgttggactcataa	Protospacer
******************************************

63. spacer 2.3|66287|42|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgagttgcataatgcctcctaatggctgttggactcataa	CRISPR spacer
tgtgagttgcataatgcctcctaatggctgttggactcataa	Protospacer
******************************************

64. spacer 2.4|66366|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

cttggtatttgtagttctcgatgagtgttttaggca	CRISPR spacer
cttggtatttgtagttctcgatgagtgttttaggca	Protospacer
************************************

65. spacer 2.4|66366|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cttggtatttgtagttctcgatgagtgttttaggca	CRISPR spacer
cttggtatttgtagttctcgatgagtgttttaggca	Protospacer
************************************

66. spacer 2.4|66366|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cttggtatttgtagttctcgatgagtgttttaggca	CRISPR spacer
cttggtatttgtagttctcgatgagtgttttaggca	Protospacer
************************************

67. spacer 2.5|66439|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tgataacgggatgccagccctaaaggtgatgagcgg	CRISPR spacer
tgataacgggatgccagccctaaaggtgatgagcgg	Protospacer
************************************

68. spacer 2.5|66439|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgataacgggatgccagccctaaaggtgatgagcgg	CRISPR spacer
tgataacgggatgccagccctaaaggtgatgagcgg	Protospacer
************************************

69. spacer 2.5|66439|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgataacgggatgccagccctaaaggtgatgagcgg	CRISPR spacer
tgataacgggatgccagccctaaaggtgatgagcgg	Protospacer
************************************

70. spacer 2.6|66512|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

cgttatccggcaaagaaaccacactactaagctcgacaa	CRISPR spacer
cgttatccggcaaagaaaccacactactaagctcgacaa	Protospacer
***************************************

71. spacer 2.6|66512|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

cgttatccggcaaagaaaccacactactaagctcgacaa	CRISPR spacer
cgttatccggcaaagaaaccacactactaagctcgacaa	Protospacer
***************************************

72. spacer 2.6|66512|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cgttatccggcaaagaaaccacactactaagctcgacaa	CRISPR spacer
cgttatccggcaaagaaaccacactactaagctcgacaa	Protospacer
***************************************

73. spacer 2.6|66512|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cgttatccggcaaagaaaccacactactaagctcgacaa	CRISPR spacer
cgttatccggcaaagaaaccacactactaagctcgacaa	Protospacer
***************************************

74. spacer 2.6|66512|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cgttatccggcaaagaaaccacactactaagctcgacaa	CRISPR spacer
cgttatccggcaaagaaaccacactactaagctcgacaa	Protospacer
***************************************

75. spacer 2.6|66512|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cgttatccggcaaagaaaccacactactaagctcgacaa	CRISPR spacer
cgttatccggcaaagaaaccacactactaagctcgacaa	Protospacer
***************************************

76. spacer 2.7|66588|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tgggccgggcgcgagttgtcctcctgtccgaggccccac	CRISPR spacer
tgggccgggcgcgagttgtcctcctgtccgaggccccac	Protospacer
***************************************

77. spacer 2.7|66588|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tgggccgggcgcgagttgtcctcctgtccgaggccccac	CRISPR spacer
tgggccgggcgcgagttgtcctcctgtccgaggccccac	Protospacer
***************************************

78. spacer 2.7|66588|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgggccgggcgcgagttgtcctcctgtccgaggccccac	CRISPR spacer
tgggccgggcgcgagttgtcctcctgtccgaggccccac	Protospacer
***************************************

79. spacer 2.7|66588|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgggccgggcgcgagttgtcctcctgtccgaggccccac	CRISPR spacer
tgggccgggcgcgagttgtcctcctgtccgaggccccac	Protospacer
***************************************

80. spacer 2.7|66588|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgggccgggcgcgagttgtcctcctgtccgaggccccac	CRISPR spacer
tgggccgggcgcgagttgtcctcctgtccgaggccccac	Protospacer
***************************************

81. spacer 2.7|66588|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgggccgggcgcgagttgtcctcctgtccgaggccccac	CRISPR spacer
tgggccgggcgcgagttgtcctcctgtccgaggccccac	Protospacer
***************************************

82. spacer 2.8|66664|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

cgttatccggcaaagaaaccacactactaagctcgacaa	CRISPR spacer
cgttatccggcaaagaaaccacactactaagctcgacaa	Protospacer
***************************************

83. spacer 2.8|66664|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

cgttatccggcaaagaaaccacactactaagctcgacaa	CRISPR spacer
cgttatccggcaaagaaaccacactactaagctcgacaa	Protospacer
***************************************

84. spacer 2.8|66664|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cgttatccggcaaagaaaccacactactaagctcgacaa	CRISPR spacer
cgttatccggcaaagaaaccacactactaagctcgacaa	Protospacer
***************************************

85. spacer 2.8|66664|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cgttatccggcaaagaaaccacactactaagctcgacaa	CRISPR spacer
cgttatccggcaaagaaaccacactactaagctcgacaa	Protospacer
***************************************

86. spacer 2.8|66664|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cgttatccggcaaagaaaccacactactaagctcgacaa	CRISPR spacer
cgttatccggcaaagaaaccacactactaagctcgacaa	Protospacer
***************************************

87. spacer 2.8|66664|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cgttatccggcaaagaaaccacactactaagctcgacaa	CRISPR spacer
cgttatccggcaaagaaaccacactactaagctcgacaa	Protospacer
***************************************

88. spacer 2.9|66740|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tgggccgggcgcgagttgtcctcctgtccgaggccccac	CRISPR spacer
tgggccgggcgcgagttgtcctcctgtccgaggccccac	Protospacer
***************************************

89. spacer 2.9|66740|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tgggccgggcgcgagttgtcctcctgtccgaggccccac	CRISPR spacer
tgggccgggcgcgagttgtcctcctgtccgaggccccac	Protospacer
***************************************

90. spacer 2.9|66740|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgggccgggcgcgagttgtcctcctgtccgaggccccac	CRISPR spacer
tgggccgggcgcgagttgtcctcctgtccgaggccccac	Protospacer
***************************************

91. spacer 2.9|66740|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgggccgggcgcgagttgtcctcctgtccgaggccccac	CRISPR spacer
tgggccgggcgcgagttgtcctcctgtccgaggccccac	Protospacer
***************************************

92. spacer 2.9|66740|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgggccgggcgcgagttgtcctcctgtccgaggccccac	CRISPR spacer
tgggccgggcgcgagttgtcctcctgtccgaggccccac	Protospacer
***************************************

93. spacer 2.9|66740|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgggccgggcgcgagttgtcctcctgtccgaggccccac	CRISPR spacer
tgggccgggcgcgagttgtcctcctgtccgaggccccac	Protospacer
***************************************

94. spacer 2.10|66816|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ctattaaggctattttcgccacttctgtttgaaag	CRISPR spacer
ctattaaggctattttcgccacttctgtttgaaag	Protospacer
***********************************

95. spacer 2.10|66816|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctattaaggctattttcgccacttctgtttgaaag	CRISPR spacer
ctattaaggctattttcgccacttctgtttgaaag	Protospacer
***********************************

96. spacer 2.10|66816|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctattaaggctattttcgccacttctgtttgaaag	CRISPR spacer
ctattaaggctattttcgccacttctgtttgaaag	Protospacer
***********************************

97. spacer 2.11|66888|44|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

gtcacacctcttcacgaatcctcacatcatgaataagctgcaca	CRISPR spacer
gtcacacctcttcacgaatcctcacatcatgaataagctgcaca	Protospacer
********************************************

98. spacer 2.11|66888|44|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gtcacacctcttcacgaatcctcacatcatgaataagctgcaca	CRISPR spacer
gtcacacctcttcacgaatcctcacatcatgaataagctgcaca	Protospacer
********************************************

99. spacer 2.11|66888|44|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gtcacacctcttcacgaatcctcacatcatgaataagctgcaca	CRISPR spacer
gtcacacctcttcacgaatcctcacatcatgaataagctgcaca	Protospacer
********************************************

100. spacer 2.12|66969|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

cgcgggtcgagatgtcgctggacacgctggtgccggaca	CRISPR spacer
cgcgggtcgagatgtcgctggacacgctggtgccggaca	Protospacer
***************************************

101. spacer 2.12|66969|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cgcgggtcgagatgtcgctggacacgctggtgccggaca	CRISPR spacer
cgcgggtcgagatgtcgctggacacgctggtgccggaca	Protospacer
***************************************

102. spacer 2.12|66969|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cgcgggtcgagatgtcgctggacacgctggtgccggaca	CRISPR spacer
cgcgggtcgagatgtcgctggacacgctggtgccggaca	Protospacer
***************************************

103. spacer 2.13|67045|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ctgggcggactggagttgccacctgccgatggcctgca	CRISPR spacer
ctgggcggactggagttgccacctgccgatggcctgca	Protospacer
**************************************

104. spacer 2.13|67045|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctgggcggactggagttgccacctgccgatggcctgca	CRISPR spacer
ctgggcggactggagttgccacctgccgatggcctgca	Protospacer
**************************************

105. spacer 2.13|67045|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctgggcggactggagttgccacctgccgatggcctgca	CRISPR spacer
ctgggcggactggagttgccacctgccgatggcctgca	Protospacer
**************************************

106. spacer 2.14|67120|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

gagccaaagtcaactagcacaggcacggcaagccatcctga	CRISPR spacer
gagccaaagtcaactagcacaggcacggcaagccatcctga	Protospacer
*****************************************

107. spacer 2.14|67120|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gagccaaagtcaactagcacaggcacggcaagccatcctga	CRISPR spacer
gagccaaagtcaactagcacaggcacggcaagccatcctga	Protospacer
*****************************************

108. spacer 2.14|67120|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gagccaaagtcaactagcacaggcacggcaagccatcctga	CRISPR spacer
gagccaaagtcaactagcacaggcacggcaagccatcctga	Protospacer
*****************************************

109. spacer 2.15|67198|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgcatctgcgcataggaagaggttaattcctcaac	CRISPR spacer
tcgtgcatctgcgcataggaagaggttaattcctcaac	Protospacer
**************************************

110. spacer 2.15|67198|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgcatctgcgcataggaagaggttaattcctcaac	CRISPR spacer
tcgtgcatctgcgcataggaagaggttaattcctcaac	Protospacer
**************************************

111. spacer 2.15|67198|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgcatctgcgcataggaagaggttaattcctcaac	CRISPR spacer
tcgtgcatctgcgcataggaagaggttaattcctcaac	Protospacer
**************************************

112. spacer 2.16|67273|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

aacgggcagcccgagtggtgggcatcgaggtggtgctc	CRISPR spacer
aacgggcagcccgagtggtgggcatcgaggtggtgctc	Protospacer
**************************************

113. spacer 2.16|67273|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aacgggcagcccgagtggtgggcatcgaggtggtgctc	CRISPR spacer
aacgggcagcccgagtggtgggcatcgaggtggtgctc	Protospacer
**************************************

114. spacer 2.16|67273|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aacgggcagcccgagtggtgggcatcgaggtggtgctc	CRISPR spacer
aacgggcagcccgagtggtgggcatcgaggtggtgctc	Protospacer
**************************************

115. spacer 2.17|67348|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ccccgccacattttcggattagaggatttgaatcggccgt	CRISPR spacer
ccccgccacattttcggattagaggatttgaatcggccgt	Protospacer
****************************************

116. spacer 2.17|67348|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ccccgccacattttcggattagaggatttgaatcggccgt	CRISPR spacer
ccccgccacattttcggattagaggatttgaatcggccgt	Protospacer
****************************************

117. spacer 2.17|67348|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ccccgccacattttcggattagaggatttgaatcggccgt	CRISPR spacer
ccccgccacattttcggattagaggatttgaatcggccgt	Protospacer
****************************************

118. spacer 2.18|67425|42|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

agtttctcaaacttttcggcgatcgccgtccaggtgagttga	CRISPR spacer
agtttctcaaacttttcggcgatcgccgtccaggtgagttga	Protospacer
******************************************

119. spacer 2.18|67425|42|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

agtttctcaaacttttcggcgatcgccgtccaggtgagttga	CRISPR spacer
agtttctcaaacttttcggcgatcgccgtccaggtgagttga	Protospacer
******************************************

120. spacer 2.18|67425|42|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

agtttctcaaacttttcggcgatcgccgtccaggtgagttga	CRISPR spacer
agtttctcaaacttttcggcgatcgccgtccaggtgagttga	Protospacer
******************************************

121. spacer 2.19|67504|43|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tagcgaaaagttatagttacctttgaccggagctaccaactca	CRISPR spacer
tagcgaaaagttatagttacctttgaccggagctaccaactca	Protospacer
*******************************************

122. spacer 2.19|67504|43|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tagcgaaaagttatagttacctttgaccggagctaccaactca	CRISPR spacer
tagcgaaaagttatagttacctttgaccggagctaccaactca	Protospacer
*******************************************

123. spacer 2.19|67504|43|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tagcgaaaagttatagttacctttgaccggagctaccaactca	CRISPR spacer
tagcgaaaagttatagttacctttgaccggagctaccaactca	Protospacer
*******************************************

124. spacer 2.20|67584|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ccccgctgccacgagggcagctgtagacgcacccc	CRISPR spacer
ccccgctgccacgagggcagctgtagacgcacccc	Protospacer
***********************************

125. spacer 2.20|67584|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ccccgctgccacgagggcagctgtagacgcacccc	CRISPR spacer
ccccgctgccacgagggcagctgtagacgcacccc	Protospacer
***********************************

126. spacer 2.20|67584|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ccccgctgccacgagggcagctgtagacgcacccc	CRISPR spacer
ccccgctgccacgagggcagctgtagacgcacccc	Protospacer
***********************************

127. spacer 2.21|67656|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ttaaatatacccatccctaataaaggatagagatcttgca	CRISPR spacer
ttaaatatacccatccctaataaaggatagagatcttgca	Protospacer
****************************************

128. spacer 2.21|67656|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttaaatatacccatccctaataaaggatagagatcttgca	CRISPR spacer
ttaaatatacccatccctaataaaggatagagatcttgca	Protospacer
****************************************

129. spacer 2.21|67656|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttaaatatacccatccctaataaaggatagagatcttgca	CRISPR spacer
ttaaatatacccatccctaataaaggatagagatcttgca	Protospacer
****************************************

130. spacer 2.22|67733|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

gctctattctaataacccaagcttttttcaattctaa	CRISPR spacer
gctctattctaataacccaagcttttttcaattctaa	Protospacer
*************************************

131. spacer 2.22|67733|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gctctattctaataacccaagcttttttcaattctaa	CRISPR spacer
gctctattctaataacccaagcttttttcaattctaa	Protospacer
*************************************

132. spacer 2.22|67733|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gctctattctaataacccaagcttttttcaattctaa	CRISPR spacer
gctctattctaataacccaagcttttttcaattctaa	Protospacer
*************************************

133. spacer 2.23|67807|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ccgcttggtaggattgaccaccaaagctagaaacaggcaca	CRISPR spacer
ccgcttggtaggattgaccaccaaagctagaaacaggcaca	Protospacer
*****************************************

134. spacer 2.23|67807|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ccgcttggtaggattgaccaccaaagctagaaacaggcaca	CRISPR spacer
ccgcttggtaggattgaccaccaaagctagaaacaggcaca	Protospacer
*****************************************

135. spacer 2.23|67807|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ccgcttggtaggattgaccaccaaagctagaaacaggcaca	CRISPR spacer
ccgcttggtaggattgaccaccaaagctagaaacaggcaca	Protospacer
*****************************************

136. spacer 2.24|67885|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

agggcggttaatcactagcggcgatctagatattg	CRISPR spacer
agggcggttaatcactagcggcgatctagatattg	Protospacer
***********************************

137. spacer 2.24|67885|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

agggcggttaatcactagcggcgatctagatattg	CRISPR spacer
agggcggttaatcactagcggcgatctagatattg	Protospacer
***********************************

138. spacer 2.24|67885|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

agggcggttaatcactagcggcgatctagatattg	CRISPR spacer
agggcggttaatcactagcggcgatctagatattg	Protospacer
***********************************

139. spacer 2.25|67957|45|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tagacttctatttcccctcttgccgagggatgatactgcaattga	CRISPR spacer
tagacttctatttcccctcttgccgagggatgatactgcaattga	Protospacer
*********************************************

140. spacer 2.25|67957|45|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tagacttctatttcccctcttgccgagggatgatactgcaattga	CRISPR spacer
tagacttctatttcccctcttgccgagggatgatactgcaattga	Protospacer
*********************************************

141. spacer 2.25|67957|45|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tagacttctatttcccctcttgccgagggatgatactgcaattga	CRISPR spacer
tagacttctatttcccctcttgccgagggatgatactgcaattga	Protospacer
*********************************************

142. spacer 2.26|68039|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tgcgctctcttatcaaacgccgcaacgccatcaaggct	CRISPR spacer
tgcgctctcttatcaaacgccgcaacgccatcaaggct	Protospacer
**************************************

143. spacer 2.26|68039|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgcgctctcttatcaaacgccgcaacgccatcaaggct	CRISPR spacer
tgcgctctcttatcaaacgccgcaacgccatcaaggct	Protospacer
**************************************

144. spacer 2.26|68039|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgcgctctcttatcaaacgccgcaacgccatcaaggct	CRISPR spacer
tgcgctctcttatcaaacgccgcaacgccatcaaggct	Protospacer
**************************************

145. spacer 2.27|68114|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

acgagcggaatcttctatggatcggatcacatccttaat	CRISPR spacer
acgagcggaatcttctatggatcggatcacatccttaat	Protospacer
***************************************

146. spacer 2.27|68114|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

acgagcggaatcttctatggatcggatcacatccttaat	CRISPR spacer
acgagcggaatcttctatggatcggatcacatccttaat	Protospacer
***************************************

147. spacer 2.27|68114|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

acgagcggaatcttctatggatcggatcacatccttaat	CRISPR spacer
acgagcggaatcttctatggatcggatcacatccttaat	Protospacer
***************************************

148. spacer 2.28|68190|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ctggtgtcggggttgtagtattcgtctcggtacaaca	CRISPR spacer
ctggtgtcggggttgtagtattcgtctcggtacaaca	Protospacer
*************************************

149. spacer 2.28|68190|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctggtgtcggggttgtagtattcgtctcggtacaaca	CRISPR spacer
ctggtgtcggggttgtagtattcgtctcggtacaaca	Protospacer
*************************************

150. spacer 2.28|68190|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctggtgtcggggttgtagtattcgtctcggtacaaca	CRISPR spacer
ctggtgtcggggttgtagtattcgtctcggtacaaca	Protospacer
*************************************

151. spacer 2.29|68264|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

actatagggagcgttaccctagctagacattgcctaatct	CRISPR spacer
actatagggagcgttaccctagctagacattgcctaatct	Protospacer
****************************************

152. spacer 2.29|68264|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

actatagggagcgttaccctagctagacattgcctaatct	CRISPR spacer
actatagggagcgttaccctagctagacattgcctaatct	Protospacer
****************************************

153. spacer 2.29|68264|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

actatagggagcgttaccctagctagacattgcctaatct	CRISPR spacer
actatagggagcgttaccctagctagacattgcctaatct	Protospacer
****************************************

154. spacer 2.30|68341|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

aagaagcagaataatgcgattgagtggacaaaaataagaa	CRISPR spacer
aagaagcagaataatgcgattgagtggacaaaaataagaa	Protospacer
****************************************

155. spacer 2.30|68341|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aagaagcagaataatgcgattgagtggacaaaaataagaa	CRISPR spacer
aagaagcagaataatgcgattgagtggacaaaaataagaa	Protospacer
****************************************

156. spacer 2.30|68341|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aagaagcagaataatgcgattgagtggacaaaaataagaa	CRISPR spacer
aagaagcagaataatgcgattgagtggacaaaaataagaa	Protospacer
****************************************

157. spacer 2.31|68418|34|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ggttacgtatcggcgtaaccgccactccttagag	CRISPR spacer
ggttacgtatcggcgtaaccgccactccttagag	Protospacer
**********************************

158. spacer 2.31|68418|34|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ggttacgtatcggcgtaaccgccactccttagag	CRISPR spacer
ggttacgtatcggcgtaaccgccactccttagag	Protospacer
**********************************

159. spacer 2.31|68418|34|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ggttacgtatcggcgtaaccgccactccttagag	CRISPR spacer
ggttacgtatcggcgtaaccgccactccttagag	Protospacer
**********************************

160. spacer 2.32|68489|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

cgcctcctgcgccctggaggggtgatcctacacctcgcg	CRISPR spacer
cgcctcctgcgccctggaggggtgatcctacacctcgcg	Protospacer
***************************************

161. spacer 2.32|68489|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cgcctcctgcgccctggaggggtgatcctacacctcgcg	CRISPR spacer
cgcctcctgcgccctggaggggtgatcctacacctcgcg	Protospacer
***************************************

162. spacer 2.32|68489|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cgcctcctgcgccctggaggggtgatcctacacctcgcg	CRISPR spacer
cgcctcctgcgccctggaggggtgatcctacacctcgcg	Protospacer
***************************************

163. spacer 2.33|68565|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

gattctggtatacgtttatcccaccactccttagct	CRISPR spacer
gattctggtatacgtttatcccaccactccttagct	Protospacer
************************************

164. spacer 2.33|68565|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gattctggtatacgtttatcccaccactccttagct	CRISPR spacer
gattctggtatacgtttatcccaccactccttagct	Protospacer
************************************

165. spacer 2.33|68565|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gattctggtatacgtttatcccaccactccttagct	CRISPR spacer
gattctggtatacgtttatcccaccactccttagct	Protospacer
************************************

166. spacer 2.34|68638|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ctcgtaagctaggcaacggccttgctcgatgcaca	CRISPR spacer
ctcgtaagctaggcaacggccttgctcgatgcaca	Protospacer
***********************************

167. spacer 2.34|68638|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctcgtaagctaggcaacggccttgctcgatgcaca	CRISPR spacer
ctcgtaagctaggcaacggccttgctcgatgcaca	Protospacer
***********************************

168. spacer 2.34|68638|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctcgtaagctaggcaacggccttgctcgatgcaca	CRISPR spacer
ctcgtaagctaggcaacggccttgctcgatgcaca	Protospacer
***********************************

169. spacer 2.35|68710|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ggtgcagctgcgcctaaggagatggctgtacaagct	CRISPR spacer
ggtgcagctgcgcctaaggagatggctgtacaagct	Protospacer
************************************

170. spacer 2.35|68710|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ggtgcagctgcgcctaaggagatggctgtacaagct	CRISPR spacer
ggtgcagctgcgcctaaggagatggctgtacaagct	Protospacer
************************************

171. spacer 2.35|68710|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ggtgcagctgcgcctaaggagatggctgtacaagct	CRISPR spacer
ggtgcagctgcgcctaaggagatggctgtacaagct	Protospacer
************************************

172. spacer 2.36|68783|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

cacctagagggtacctcccggttagaccggggctcttat	CRISPR spacer
cacctagagggtacctcccggttagaccggggctcttat	Protospacer
***************************************

173. spacer 2.36|68783|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cacctagagggtacctcccggttagaccggggctcttat	CRISPR spacer
cacctagagggtacctcccggttagaccggggctcttat	Protospacer
***************************************

174. spacer 2.36|68783|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cacctagagggtacctcccggttagaccggggctcttat	CRISPR spacer
cacctagagggtacctcccggttagaccggggctcttat	Protospacer
***************************************

175. spacer 2.37|68859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

aacatggccacaacaaccttcccggagcaagggatg	CRISPR spacer
aacatggccacaacaaccttcccggagcaagggatg	Protospacer
************************************

176. spacer 2.37|68859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

aacatggccacaacaaccttcccggagcaagggatg	CRISPR spacer
aacatggccacaacaaccttcccggagcaagggatg	Protospacer
************************************

177. spacer 2.37|68859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aacatggccacaacaaccttcccggagcaagggatg	CRISPR spacer
aacatggccacaacaaccttcccggagcaagggatg	Protospacer
************************************

178. spacer 2.37|68859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aacatggccacaacaaccttcccggagcaagggatg	CRISPR spacer
aacatggccacaacaaccttcccggagcaagggatg	Protospacer
************************************

179. spacer 2.37|68859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aacatggccacaacaaccttcccggagcaagggatg	CRISPR spacer
aacatggccacaacaaccttcccggagcaagggatg	Protospacer
************************************

180. spacer 2.37|68859|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aacatggccacaacaaccttcccggagcaagggatg	CRISPR spacer
aacatggccacaacaaccttcccggagcaagggatg	Protospacer
************************************

181. spacer 2.38|68932|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgatatttggcgtgccagccaagtgaattttggcgctg	CRISPR spacer
ggcgatatttggcgtgccagccaagtgaattttggcgctg	Protospacer
****************************************

182. spacer 2.38|68932|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgatatttggcgtgccagccaagtgaattttggcgctg	CRISPR spacer
ggcgatatttggcgtgccagccaagtgaattttggcgctg	Protospacer
****************************************

183. spacer 2.38|68932|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgatatttggcgtgccagccaagtgaattttggcgctg	CRISPR spacer
ggcgatatttggcgtgccagccaagtgaattttggcgctg	Protospacer
****************************************

184. spacer 2.38|68932|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgatatttggcgtgccagccaagtgaattttggcgctg	CRISPR spacer
ggcgatatttggcgtgccagccaagtgaattttggcgctg	Protospacer
****************************************

185. spacer 2.38|68932|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgatatttggcgtgccagccaagtgaattttggcgctg	CRISPR spacer
ggcgatatttggcgtgccagccaagtgaattttggcgctg	Protospacer
****************************************

186. spacer 2.39|69009|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

aacatggccacaacaaccttcccggagcaagggatg	CRISPR spacer
aacatggccacaacaaccttcccggagcaagggatg	Protospacer
************************************

187. spacer 2.39|69009|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

aacatggccacaacaaccttcccggagcaagggatg	CRISPR spacer
aacatggccacaacaaccttcccggagcaagggatg	Protospacer
************************************

188. spacer 2.39|69009|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aacatggccacaacaaccttcccggagcaagggatg	CRISPR spacer
aacatggccacaacaaccttcccggagcaagggatg	Protospacer
************************************

189. spacer 2.39|69009|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aacatggccacaacaaccttcccggagcaagggatg	CRISPR spacer
aacatggccacaacaaccttcccggagcaagggatg	Protospacer
************************************

190. spacer 2.39|69009|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aacatggccacaacaaccttcccggagcaagggatg	CRISPR spacer
aacatggccacaacaaccttcccggagcaagggatg	Protospacer
************************************

191. spacer 2.39|69009|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aacatggccacaacaaccttcccggagcaagggatg	CRISPR spacer
aacatggccacaacaaccttcccggagcaagggatg	Protospacer
************************************

192. spacer 2.40|69082|30|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgatatttggcgtgccgctcagccttaa	CRISPR spacer
ggcgatatttggcgtgccgctcagccttaa	Protospacer
******************************

193. spacer 2.41|69149|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tcctcctcgcctctgagaaagagtatgaaacactgt	CRISPR spacer
tcctcctcgcctctgagaaagagtatgaaacactgt	Protospacer
************************************

194. spacer 2.41|69149|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tcctcctcgcctctgagaaagagtatgaaacactgt	CRISPR spacer
tcctcctcgcctctgagaaagagtatgaaacactgt	Protospacer
************************************

195. spacer 2.41|69149|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tcctcctcgcctctgagaaagagtatgaaacactgt	CRISPR spacer
tcctcctcgcctctgagaaagagtatgaaacactgt	Protospacer
************************************

196. spacer 2.42|69222|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

atgaacagattgccatcttctaggcggatagcctggg	CRISPR spacer
atgaacagattgccatcttctaggcggatagcctggg	Protospacer
*************************************

197. spacer 2.42|69222|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

atgaacagattgccatcttctaggcggatagcctggg	CRISPR spacer
atgaacagattgccatcttctaggcggatagcctggg	Protospacer
*************************************

198. spacer 2.42|69222|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

atgaacagattgccatcttctaggcggatagcctggg	CRISPR spacer
atgaacagattgccatcttctaggcggatagcctggg	Protospacer
*************************************

199. spacer 2.43|69296|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

cgcccattgtttgtgcttccggaagaagtctttcaacttc	CRISPR spacer
cgcccattgtttgtgcttccggaagaagtctttcaacttc	Protospacer
****************************************

200. spacer 2.43|69296|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cgcccattgtttgtgcttccggaagaagtctttcaacttc	CRISPR spacer
cgcccattgtttgtgcttccggaagaagtctttcaacttc	Protospacer
****************************************

201. spacer 2.44|69373|43|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

gttatcacgagttatcttgcgcaaatcttgtagtgcatctttt	CRISPR spacer
gttatcacgagttatcttgcgcaaatcttgtagtgcatctttt	Protospacer
*******************************************

202. spacer 2.44|69373|43|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gttatcacgagttatcttgcgcaaatcttgtagtgcatctttt	CRISPR spacer
gttatcacgagttatcttgcgcaaatcttgtagtgcatctttt	Protospacer
*******************************************

203. spacer 2.44|69373|43|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gttatcacgagttatcttgcgcaaatcttgtagtgcatctttt	CRISPR spacer
gttatcacgagttatcttgcgcaaatcttgtagtgcatctttt	Protospacer
*******************************************

204. spacer 2.45|69453|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tttagcggaggagacctcttctatttctcctataacc	CRISPR spacer
tttagcggaggagacctcttctatttctcctataacc	Protospacer
*************************************

205. spacer 2.45|69453|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tttagcggaggagacctcttctatttctcctataacc	CRISPR spacer
tttagcggaggagacctcttctatttctcctataacc	Protospacer
*************************************

206. spacer 2.45|69453|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tttagcggaggagacctcttctatttctcctataacc	CRISPR spacer
tttagcggaggagacctcttctatttctcctataacc	Protospacer
*************************************

207. spacer 2.46|69527|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

gggagaaccctaaaaagttctcctgtctaatcgccacctgt	CRISPR spacer
gggagaaccctaaaaagttctcctgtctaatcgccacctgt	Protospacer
*****************************************

208. spacer 2.46|69527|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gggagaaccctaaaaagttctcctgtctaatcgccacctgt	CRISPR spacer
gggagaaccctaaaaagttctcctgtctaatcgccacctgt	Protospacer
*****************************************

209. spacer 2.46|69527|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gggagaaccctaaaaagttctcctgtctaatcgccacctgt	CRISPR spacer
gggagaaccctaaaaagttctcctgtctaatcgccacctgt	Protospacer
*****************************************

210. spacer 2.47|69605|35|NC_020287|CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

cgctccagagtgcgccgccgccgaattgcggtcca	CRISPR spacer
cgctccagagtgcgccgccgccgaattgcggtcca	Protospacer
***********************************

211. spacer 2.47|69605|35|NC_020287|CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cgctccagagtgcgccgccgccgaattgcggtcca	CRISPR spacer
cgctccagagtgcgccgccgccgaattgcggtcca	Protospacer
***********************************

212. spacer 2.47|69605|35|NC_020287|CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cgctccagagtgcgccgccgccgaattgcggtcca	CRISPR spacer
cgctccagagtgcgccgccgccgaattgcggtcca	Protospacer
***********************************

213. spacer 2.48|69677|45|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

gagactctatctttggagtttctaagacattggcggtttctaggg	CRISPR spacer
gagactctatctttggagtttctaagacattggcggtttctaggg	Protospacer
*********************************************

214. spacer 2.48|69677|45|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gagactctatctttggagtttctaagacattggcggtttctaggg	CRISPR spacer
gagactctatctttggagtttctaagacattggcggtttctaggg	Protospacer
*********************************************

215. spacer 2.48|69677|45|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gagactctatctttggagtttctaagacattggcggtttctaggg	CRISPR spacer
gagactctatctttggagtttctaagacattggcggtttctaggg	Protospacer
*********************************************

216. spacer 2.49|69759|41|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

attgcttggcgtaggttgacttacccgagcctgggagacca	CRISPR spacer
attgcttggcgtaggttgacttacccgagcctgggagacca	Protospacer
*****************************************

217. spacer 2.49|69759|41|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

attgcttggcgtaggttgacttacccgagcctgggagacca	CRISPR spacer
attgcttggcgtaggttgacttacccgagcctgggagacca	Protospacer
*****************************************

218. spacer 2.49|69759|41|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

attgcttggcgtaggttgacttacccgagcctgggagacca	CRISPR spacer
attgcttggcgtaggttgacttacccgagcctgggagacca	Protospacer
*****************************************

219. spacer 2.50|69837|40|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tccaagggctcttcgtcttcaaaggccttagttacctctg	CRISPR spacer
tccaagggctcttcgtcttcaaaggccttagttacctctg	Protospacer
****************************************

220. spacer 2.50|69837|40|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tccaagggctcttcgtcttcaaaggccttagttacctctg	CRISPR spacer
tccaagggctcttcgtcttcaaaggccttagttacctctg	Protospacer
****************************************

221. spacer 2.50|69837|40|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tccaagggctcttcgtcttcaaaggccttagttacctctg	CRISPR spacer
tccaagggctcttcgtcttcaaaggccttagttacctctg	Protospacer
****************************************

222. spacer 2.51|69914|45|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ataataaagcaccctcaacggactatgccatgaacaacaggaccc	CRISPR spacer
ataataaagcaccctcaacggactatgccatgaacaacaggaccc	Protospacer
*********************************************

223. spacer 2.51|69914|45|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ataataaagcaccctcaacggactatgccatgaacaacaggaccc	CRISPR spacer
ataataaagcaccctcaacggactatgccatgaacaacaggaccc	Protospacer
*********************************************

224. spacer 2.51|69914|45|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ataataaagcaccctcaacggactatgccatgaacaacaggaccc	CRISPR spacer
ataataaagcaccctcaacggactatgccatgaacaacaggaccc	Protospacer
*********************************************

225. spacer 2.52|69996|34|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

gttgccagttttgccgtttttgctgttctgagat	CRISPR spacer
gttgccagttttgccgtttttgctgttctgagat	Protospacer
**********************************

226. spacer 2.52|69996|34|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gttgccagttttgccgtttttgctgttctgagat	CRISPR spacer
gttgccagttttgccgtttttgctgttctgagat	Protospacer
**********************************

227. spacer 2.52|69996|34|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gttgccagttttgccgtttttgctgttctgagat	CRISPR spacer
gttgccagttttgccgtttttgctgttctgagat	Protospacer
**********************************

228. spacer 2.53|70067|46|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

cccataataattaggctcgctaccataaggggaaacttcttccaag	CRISPR spacer
cccataataattaggctcgctaccataaggggaaacttcttccaag	Protospacer
**********************************************

229. spacer 2.53|70067|46|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cccataataattaggctcgctaccataaggggaaacttcttccaag	CRISPR spacer
cccataataattaggctcgctaccataaggggaaacttcttccaag	Protospacer
**********************************************

230. spacer 2.53|70067|46|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cccataataattaggctcgctaccataaggggaaacttcttccaag	CRISPR spacer
cccataataattaggctcgctaccataaggggaaacttcttccaag	Protospacer
**********************************************

231. spacer 2.54|70150|34|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcctgaggtggtcaatagtgaccccatggctc	CRISPR spacer
gcgcctgaggtggtcaatagtgaccccatggctc	Protospacer
**********************************

232. spacer 2.54|70150|34|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcctgaggtggtcaatagtgaccccatggctc	CRISPR spacer
gcgcctgaggtggtcaatagtgaccccatggctc	Protospacer
**********************************

233. spacer 2.54|70150|34|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcctgaggtggtcaatagtgaccccatggctc	CRISPR spacer
gcgcctgaggtggtcaatagtgaccccatggctc	Protospacer
**********************************

234. spacer 3.1|87583|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ctttaggtgggcgttgacctttagattaggaatggt	CRISPR spacer
ctttaggtgggcgttgacctttagattaggaatggt	Protospacer
************************************

235. spacer 3.1|87583|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctttaggtgggcgttgacctttagattaggaatggt	CRISPR spacer
ctttaggtgggcgttgacctttagattaggaatggt	Protospacer
************************************

236. spacer 3.1|87583|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctttaggtgggcgttgacctttagattaggaatggt	CRISPR spacer
ctttaggtgggcgttgacctttagattaggaatggt	Protospacer
************************************

237. spacer 3.2|87655|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

agcgccacagctgacagagttcctgaaggaagctaa	CRISPR spacer
agcgccacagctgacagagttcctgaaggaagctaa	Protospacer
************************************

238. spacer 3.2|87655|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

agcgccacagctgacagagttcctgaaggaagctaa	CRISPR spacer
agcgccacagctgacagagttcctgaaggaagctaa	Protospacer
************************************

239. spacer 3.2|87655|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

agcgccacagctgacagagttcctgaaggaagctaa	CRISPR spacer
agcgccacagctgacagagttcctgaaggaagctaa	Protospacer
************************************

240. spacer 3.3|87727|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ctgagtgatttttatcaattgtcgagcttagtagt	CRISPR spacer
ctgagtgatttttatcaattgtcgagcttagtagt	Protospacer
***********************************

241. spacer 3.3|87727|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctgagtgatttttatcaattgtcgagcttagtagt	CRISPR spacer
ctgagtgatttttatcaattgtcgagcttagtagt	Protospacer
***********************************

242. spacer 3.3|87727|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctgagtgatttttatcaattgtcgagcttagtagt	CRISPR spacer
ctgagtgatttttatcaattgtcgagcttagtagt	Protospacer
***********************************

243. spacer 3.4|87798|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

acaggagtgttagcgcactgcctgtcattactatta	CRISPR spacer
acaggagtgttagcgcactgcctgtcattactatta	Protospacer
************************************

244. spacer 3.4|87798|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

acaggagtgttagcgcactgcctgtcattactatta	CRISPR spacer
acaggagtgttagcgcactgcctgtcattactatta	Protospacer
************************************

245. spacer 3.4|87798|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

acaggagtgttagcgcactgcctgtcattactatta	CRISPR spacer
acaggagtgttagcgcactgcctgtcattactatta	Protospacer
************************************

246. spacer 3.5|87870|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ttagattgcgggggctagtgacgccatagtttaacgaca	CRISPR spacer
ttagattgcgggggctagtgacgccatagtttaacgaca	Protospacer
***************************************

247. spacer 3.5|87870|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttagattgcgggggctagtgacgccatagtttaacgaca	CRISPR spacer
ttagattgcgggggctagtgacgccatagtttaacgaca	Protospacer
***************************************

248. spacer 3.5|87870|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttagattgcgggggctagtgacgccatagtttaacgaca	CRISPR spacer
ttagattgcgggggctagtgacgccatagtttaacgaca	Protospacer
***************************************

249. spacer 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

aaagatattaggctatccttcggggtagtctttctt	CRISPR spacer
aaagatattaggctatccttcggggtagtctttctt	Protospacer
************************************

250. spacer 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aaagatattaggctatccttcggggtagtctttctt	CRISPR spacer
aaagatattaggctatccttcggggtagtctttctt	Protospacer
************************************

251. spacer 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aaagatattaggctatccttcggggtagtctttctt	CRISPR spacer
aaagatattaggctatccttcggggtagtctttctt	Protospacer
************************************

252. spacer 3.7|88017|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

aagtgttgttgcctagtgttataccagaatatccc	CRISPR spacer
aagtgttgttgcctagtgttataccagaatatccc	Protospacer
***********************************

253. spacer 3.7|88017|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aagtgttgttgcctagtgttataccagaatatccc	CRISPR spacer
aagtgttgttgcctagtgttataccagaatatccc	Protospacer
***********************************

254. spacer 3.7|88017|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aagtgttgttgcctagtgttataccagaatatccc	CRISPR spacer
aagtgttgttgcctagtgttataccagaatatccc	Protospacer
***********************************

255. spacer 3.8|88088|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ctcattagtgctatcttcttgttgatggattagaaca	CRISPR spacer
ctcattagtgctatcttcttgttgatggattagaaca	Protospacer
*************************************

256. spacer 3.8|88088|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctcattagtgctatcttcttgttgatggattagaaca	CRISPR spacer
ctcattagtgctatcttcttgttgatggattagaaca	Protospacer
*************************************

257. spacer 3.8|88088|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctcattagtgctatcttcttgttgatggattagaaca	CRISPR spacer
ctcattagtgctatcttcttgttgatggattagaaca	Protospacer
*************************************

258. spacer 3.9|88161|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tctactctggtgaagaccaagtggatttcgtggtgat	CRISPR spacer
tctactctggtgaagaccaagtggatttcgtggtgat	Protospacer
*************************************

259. spacer 3.9|88161|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tctactctggtgaagaccaagtggatttcgtggtgat	CRISPR spacer
tctactctggtgaagaccaagtggatttcgtggtgat	Protospacer
*************************************

260. spacer 3.9|88161|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tctactctggtgaagaccaagtggatttcgtggtgat	CRISPR spacer
tctactctggtgaagaccaagtggatttcgtggtgat	Protospacer
*************************************

261. spacer 3.10|88234|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

gttagtgcttggttgtggttatgctgcaactaagcc	CRISPR spacer
gttagtgcttggttgtggttatgctgcaactaagcc	Protospacer
************************************

262. spacer 3.10|88234|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gttagtgcttggttgtggttatgctgcaactaagcc	CRISPR spacer
gttagtgcttggttgtggttatgctgcaactaagcc	Protospacer
************************************

263. spacer 3.10|88234|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gttagtgcttggttgtggttatgctgcaactaagcc	CRISPR spacer
gttagtgcttggttgtggttatgctgcaactaagcc	Protospacer
************************************

264. spacer 3.11|88306|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

atcgatatactttttagcatcagctaaatgataaaaa	CRISPR spacer
atcgatatactttttagcatcagctaaatgataaaaa	Protospacer
*************************************

265. spacer 3.11|88306|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

atcgatatactttttagcatcagctaaatgataaaaa	CRISPR spacer
atcgatatactttttagcatcagctaaatgataaaaa	Protospacer
*************************************

266. spacer 3.11|88306|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

atcgatatactttttagcatcagctaaatgataaaaa	CRISPR spacer
atcgatatactttttagcatcagctaaatgataaaaa	Protospacer
*************************************

267. spacer 3.12|88379|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ttagaaagttttggttagtttccattcctcttttt	CRISPR spacer
ttagaaagttttggttagtttccattcctcttttt	Protospacer
***********************************

268. spacer 3.12|88379|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttagaaagttttggttagtttccattcctcttttt	CRISPR spacer
ttagaaagttttggttagtttccattcctcttttt	Protospacer
***********************************

269. spacer 3.12|88379|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttagaaagttttggttagtttccattcctcttttt	CRISPR spacer
ttagaaagttttggttagtttccattcctcttttt	Protospacer
***********************************

270. spacer 3.13|88450|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tttctccattgttagttagtcatttccttgacaatt	CRISPR spacer
tttctccattgttagttagtcatttccttgacaatt	Protospacer
************************************

271. spacer 3.13|88450|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tttctccattgttagttagtcatttccttgacaatt	CRISPR spacer
tttctccattgttagttagtcatttccttgacaatt	Protospacer
************************************

272. spacer 3.13|88450|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tttctccattgttagttagtcatttccttgacaatt	CRISPR spacer
tttctccattgttagttagtcatttccttgacaatt	Protospacer
************************************

273. spacer 3.14|88522|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tgggattcatgaacatgttgatggtgaattatacct	CRISPR spacer
tgggattcatgaacatgttgatggtgaattatacct	Protospacer
************************************

274. spacer 3.14|88522|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgggattcatgaacatgttgatggtgaattatacct	CRISPR spacer
tgggattcatgaacatgttgatggtgaattatacct	Protospacer
************************************

275. spacer 3.14|88522|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgggattcatgaacatgttgatggtgaattatacct	CRISPR spacer
tgggattcatgaacatgttgatggtgaattatacct	Protospacer
************************************

276. spacer 3.15|88594|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tgattaaattaatatgcgtgatagattaactcattttggtt	CRISPR spacer
tgattaaattaatatgcgtgatagattaactcattttggtt	Protospacer
*****************************************

277. spacer 3.15|88594|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgattaaattaatatgcgtgatagattaactcattttggtt	CRISPR spacer
tgattaaattaatatgcgtgatagattaactcattttggtt	Protospacer
*****************************************

278. spacer 3.15|88594|41|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgattaaattaatatgcgtgatagattaactcattttggtt	CRISPR spacer
tgattaaattaatatgcgtgatagattaactcattttggtt	Protospacer
*****************************************

279. spacer 3.16|88671|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ttttttggcataactcagtaagtcttttttgttta	CRISPR spacer
ttttttggcataactcagtaagtcttttttgttta	Protospacer
***********************************

280. spacer 3.16|88671|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttttttggcataactcagtaagtcttttttgttta	CRISPR spacer
ttttttggcataactcagtaagtcttttttgttta	Protospacer
***********************************

281. spacer 3.16|88671|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ttttttggcataactcagtaagtcttttttgttta	CRISPR spacer
ttttttggcataactcagtaagtcttttttgttta	Protospacer
***********************************

282. spacer 3.17|88742|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

aatactaatcttaaagatcttggtttaattacatatcgt	CRISPR spacer
aatactaatcttaaagatcttggtttaattacatatcgt	Protospacer
***************************************

283. spacer 3.17|88742|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aatactaatcttaaagatcttggtttaattacatatcgt	CRISPR spacer
aatactaatcttaaagatcttggtttaattacatatcgt	Protospacer
***************************************

284. spacer 3.17|88742|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aatactaatcttaaagatcttggtttaattacatatcgt	CRISPR spacer
aatactaatcttaaagatcttggtttaattacatatcgt	Protospacer
***************************************

285. spacer 3.18|88817|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

aacaattgcaaggtttataagtaaatgaacaacaacg	CRISPR spacer
aacaattgcaaggtttataagtaaatgaacaacaacg	Protospacer
*************************************

286. spacer 3.18|88817|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aacaattgcaaggtttataagtaaatgaacaacaacg	CRISPR spacer
aacaattgcaaggtttataagtaaatgaacaacaacg	Protospacer
*************************************

287. spacer 3.18|88817|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aacaattgcaaggtttataagtaaatgaacaacaacg	CRISPR spacer
aacaattgcaaggtttataagtaaatgaacaacaacg	Protospacer
*************************************

288. spacer 3.19|88890|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

aaatccaacaacttctccacatttactccactagtctc	CRISPR spacer
aaatccaacaacttctccacatttactccactagtctc	Protospacer
**************************************

289. spacer 3.19|88890|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aaatccaacaacttctccacatttactccactagtctc	CRISPR spacer
aaatccaacaacttctccacatttactccactagtctc	Protospacer
**************************************

290. spacer 3.19|88890|38|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aaatccaacaacttctccacatttactccactagtctc	CRISPR spacer
aaatccaacaacttctccacatttactccactagtctc	Protospacer
**************************************

291. spacer 3.20|88964|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgtgcagcctctagtccgctttttagattgcg	CRISPR spacer
ctcctacttgtgcagcctctagtccgctttttagattgcg	Protospacer
****************************************

292. spacer 3.20|88964|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgtgcagcctctagtccgctttttagattgcg	CRISPR spacer
ctcctacttgtgcagcctctagtccgctttttagattgcg	Protospacer
****************************************

293. spacer 3.20|88964|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctcctacttgtgcagcctctagtccgctttttagattgcg	CRISPR spacer
ctcctacttgtgcagcctctagtccgctttttagattgcg	Protospacer
****************************************

294. spacer 3.21|89040|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

gcttcgcttctttcgctttctcaacataaaactcatgat	CRISPR spacer
gcttcgcttctttcgctttctcaacataaaactcatgat	Protospacer
***************************************

295. spacer 3.21|89040|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gcttcgcttctttcgctttctcaacataaaactcatgat	CRISPR spacer
gcttcgcttctttcgctttctcaacataaaactcatgat	Protospacer
***************************************

296. spacer 3.21|89040|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

gcttcgcttctttcgctttctcaacataaaactcatgat	CRISPR spacer
gcttcgcttctttcgctttctcaacataaaactcatgat	Protospacer
***************************************

297. spacer 3.22|89115|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

ctaaagtatggtaactctgggtaattttttaacag	CRISPR spacer
ctaaagtatggtaactctgggtaattttttaacag	Protospacer
***********************************

298. spacer 3.22|89115|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctaaagtatggtaactctgggtaattttttaacag	CRISPR spacer
ctaaagtatggtaactctgggtaattttttaacag	Protospacer
***********************************

299. spacer 3.22|89115|35|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

ctaaagtatggtaactctgggtaattttttaacag	CRISPR spacer
ctaaagtatggtaactctgggtaattttttaacag	Protospacer
***********************************

300. spacer 3.23|89186|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

cttatctttttctagcgtaacaaaagaataatcagga	CRISPR spacer
cttatctttttctagcgtaacaaaagaataatcagga	Protospacer
*************************************

301. spacer 3.23|89186|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cttatctttttctagcgtaacaaaagaataatcagga	CRISPR spacer
cttatctttttctagcgtaacaaaagaataatcagga	Protospacer
*************************************

302. spacer 3.23|89186|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cttatctttttctagcgtaacaaaagaataatcagga	CRISPR spacer
cttatctttttctagcgtaacaaaagaataatcagga	Protospacer
*************************************

303. spacer 3.24|89259|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tttcaaccaaaagcttattggcttctacggactcacgagc	CRISPR spacer
tttcaaccaaaagcttattggcttctacggactcacgagc	Protospacer
****************************************

304. spacer 3.24|89259|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tttcaaccaaaagcttattggcttctacggactcacgagc	CRISPR spacer
tttcaaccaaaagcttattggcttctacggactcacgagc	Protospacer
****************************************

305. spacer 3.24|89259|40|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tttcaaccaaaagcttattggcttctacggactcacgagc	CRISPR spacer
tttcaaccaaaagcttattggcttctacggactcacgagc	Protospacer
****************************************

306. spacer 3.25|89335|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tctgaactacttttttttcaacgacttcaccatgggaag	CRISPR spacer
tctgaactacttttttttcaacgacttcaccatgggaag	Protospacer
***************************************

307. spacer 3.25|89335|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tctgaactacttttttttcaacgacttcaccatgggaag	CRISPR spacer
tctgaactacttttttttcaacgacttcaccatgggaag	Protospacer
***************************************

308. spacer 3.25|89335|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tctgaactacttttttttcaacgacttcaccatgggaag	CRISPR spacer
tctgaactacttttttttcaacgacttcaccatgggaag	Protospacer
***************************************

309. spacer 3.26|89410|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

agttttagatgcaccaattacatcttcttccataaagga	CRISPR spacer
agttttagatgcaccaattacatcttcttccataaagga	Protospacer
***************************************

310. spacer 3.26|89410|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

agttttagatgcaccaattacatcttcttccataaagga	CRISPR spacer
agttttagatgcaccaattacatcttcttccataaagga	Protospacer
***************************************

311. spacer 3.26|89410|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

agttttagatgcaccaattacatcttcttccataaagga	CRISPR spacer
agttttagatgcaccaattacatcttcttccataaagga	Protospacer
***************************************

312. spacer 3.27|89485|46|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

attcaagacctccggtggtcagaagactgtagcaacaaagcttgag	CRISPR spacer
attcaagacctccggtggtcagaagactgtagcaacaaagcttgag	Protospacer
**********************************************

313. spacer 3.27|89485|46|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

attcaagacctccggtggtcagaagactgtagcaacaaagcttgag	CRISPR spacer
attcaagacctccggtggtcagaagactgtagcaacaaagcttgag	Protospacer
**********************************************

314. spacer 3.27|89485|46|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

attcaagacctccggtggtcagaagactgtagcaacaaagcttgag	CRISPR spacer
attcaagacctccggtggtcagaagactgtagcaacaaagcttgag	Protospacer
**********************************************

315. spacer 3.28|89567|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tagatcaggcatccaaactcttgggcgatgtcgcgtaac	CRISPR spacer
tagatcaggcatccaaactcttgggcgatgtcgcgtaac	Protospacer
***************************************

316. spacer 3.28|89567|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tagatcaggcatccaaactcttgggcgatgtcgcgtaac	CRISPR spacer
tagatcaggcatccaaactcttgggcgatgtcgcgtaac	Protospacer
***************************************

317. spacer 3.28|89567|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tagatcaggcatccaaactcttgggcgatgtcgcgtaac	CRISPR spacer
tagatcaggcatccaaactcttgggcgatgtcgcgtaac	Protospacer
***************************************

318. spacer 3.29|89642|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

cgatgtagctcatagcgacctcgataattaattgat	CRISPR spacer
cgatgtagctcatagcgacctcgataattaattgat	Protospacer
************************************

319. spacer 3.29|89642|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cgatgtagctcatagcgacctcgataattaattgat	CRISPR spacer
cgatgtagctcatagcgacctcgataattaattgat	Protospacer
************************************

320. spacer 3.29|89642|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

cgatgtagctcatagcgacctcgataattaattgat	CRISPR spacer
cgatgtagctcatagcgacctcgataattaattgat	Protospacer
************************************

321. spacer 3.30|89714|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

accaagctagtcactatccgatcaaccgtcgttgcaggt	CRISPR spacer
accaagctagtcactatccgatcaaccgtcgttgcaggt	Protospacer
***************************************

322. spacer 3.30|89714|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

accaagctagtcactatccgatcaaccgtcgttgcaggt	CRISPR spacer
accaagctagtcactatccgatcaaccgtcgttgcaggt	Protospacer
***************************************

323. spacer 3.30|89714|39|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

accaagctagtcactatccgatcaaccgtcgttgcaggt	CRISPR spacer
accaagctagtcactatccgatcaaccgtcgttgcaggt	Protospacer
***************************************

324. spacer 3.31|89789|42|NC_020287|CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tatcaagagttgtctagtcagttccaagaaaaaccctgggag	CRISPR spacer
tatcaagagttgtctagtcagttccaagaaaaaccctgggag	Protospacer
******************************************

325. spacer 3.31|89789|42|NC_020287|CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tatcaagagttgtctagtcagttccaagaaaaaccctgggag	CRISPR spacer
tatcaagagttgtctagtcagttccaagaaaaaccctgggag	Protospacer
******************************************

326. spacer 3.31|89789|42|NC_020287|CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tatcaagagttgtctagtcagttccaagaaaaaccctgggag	CRISPR spacer
tatcaagagttgtctagtcagttccaagaaaaaccctgggag	Protospacer
******************************************

327. spacer 3.32|89867|41|NC_020287|CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tgacctgattcctcgagaattgagactcctaaagaaattgc	CRISPR spacer
tgacctgattcctcgagaattgagactcctaaagaaattgc	Protospacer
*****************************************

328. spacer 3.32|89867|41|NC_020287|CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgacctgattcctcgagaattgagactcctaaagaaattgc	CRISPR spacer
tgacctgattcctcgagaattgagactcctaaagaaattgc	Protospacer
*****************************************

329. spacer 3.32|89867|41|NC_020287|CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgacctgattcctcgagaattgagactcctaaagaaattgc	CRISPR spacer
tgacctgattcctcgagaattgagactcctaaagaaattgc	Protospacer
*****************************************

330. spacer 3.33|89944|35|NC_020287|CRISPRCasFinder,CRT matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

agttccagtcgtgctccaagggctcttcgtcttca	CRISPR spacer
agttccagtcgtgctccaagggctcttcgtcttca	Protospacer
***********************************

331. spacer 3.33|89944|35|NC_020287|CRISPRCasFinder,CRT matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

agttccagtcgtgctccaagggctcttcgtcttca	CRISPR spacer
agttccagtcgtgctccaagggctcttcgtcttca	Protospacer
***********************************

332. spacer 3.33|89944|35|NC_020287|CRISPRCasFinder,CRT matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

agttccagtcgtgctccaagggctcttcgtcttca	CRISPR spacer
agttccagtcgtgctccaagggctcttcgtcttca	Protospacer
***********************************

333. spacer 3.34|90015|47|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

aactttggaaaattgccttcataccattcttttgttaaaccgttgtt	CRISPR spacer
aactttggaaaattgccttcataccattcttttgttaaaccgttgtt	Protospacer
***********************************************

334. spacer 3.34|90015|47|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aactttggaaaattgccttcataccattcttttgttaaaccgttgtt	CRISPR spacer
aactttggaaaattgccttcataccattcttttgttaaaccgttgtt	Protospacer
***********************************************

335. spacer 3.34|90015|47|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

aactttggaaaattgccttcataccattcttttgttaaaccgttgtt	CRISPR spacer
aactttggaaaattgccttcataccattcttttgttaaaccgttgtt	Protospacer
***********************************************

336. spacer 3.35|90098|37|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacaaaacagccagcagcaattaataaatcagtt	CRISPR spacer
agcaacaaaacagccagcagcaattaataaatcagtt	Protospacer
*************************************

337. spacer 3.35|90098|37|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacaaaacagccagcagcaattaataaatcagtt	CRISPR spacer
agcaacaaaacagccagcagcaattaataaatcagtt	Protospacer
*************************************

338. spacer 3.35|90098|37|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacaaaacagccagcagcaattaataaatcagtt	CRISPR spacer
agcaacaaaacagccagcagcaattaataaatcagtt	Protospacer
*************************************

339. spacer 3.36|90171|39|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

actccgtggcgtcgtaccggtacgcctgggcttcgtcca	CRISPR spacer
actccgtggcgtcgtaccggtacgcctgggcttcgtcca	Protospacer
***************************************

340. spacer 3.36|90171|39|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

actccgtggcgtcgtaccggtacgcctgggcttcgtcca	CRISPR spacer
actccgtggcgtcgtaccggtacgcctgggcttcgtcca	Protospacer
***************************************

341. spacer 3.36|90171|39|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

actccgtggcgtcgtaccggtacgcctgggcttcgtcca	CRISPR spacer
actccgtggcgtcgtaccggtacgcctgggcttcgtcca	Protospacer
***************************************

342. spacer 3.37|90246|43|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

tgaaataacccccatagcggtggccatgggggcgttttactaa	CRISPR spacer
tgaaataacccccatagcggtggccatgggggcgttttactaa	Protospacer
*******************************************

343. spacer 3.37|90246|43|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgaaataacccccatagcggtggccatgggggcgttttactaa	CRISPR spacer
tgaaataacccccatagcggtggccatgggggcgttttactaa	Protospacer
*******************************************

344. spacer 3.37|90246|43|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgaaataacccccatagcggtggccatgggggcgttttactaa	CRISPR spacer
tgaaataacccccatagcggtggccatgggggcgttttactaa	Protospacer
*******************************************

345. spacer 3.38|90325|40|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 0, identity: 1.0

atatctgttagctcaatttgagcaagttcatcatttttta	CRISPR spacer
atatctgttagctcaatttgagcaagttcatcatttttta	Protospacer
****************************************

346. spacer 3.38|90325|40|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

atatctgttagctcaatttgagcaagttcatcatttttta	CRISPR spacer
atatctgttagctcaatttgagcaagttcatcatttttta	Protospacer
****************************************

347. spacer 3.38|90325|40|NC_020287|CRISPRCasFinder,CRT,PILER-CR matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 0, identity: 1.0

atatctgttagctcaatttgagcaagttcatcatttttta	CRISPR spacer
atatctgttagctcaatttgagcaagttcatcatttttta	Protospacer
****************************************

348. spacer 2.40|69082|30|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ggcgatatttggcgtgccgctcagccttaa	CRISPR spacer
cgtgacctttggcgtgcggctcagccgtaa	Protospacer
 *.**. ********** ******** ***

349. spacer 1.15|17366|32|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039845 (Acetobacter pasteurianus strain CICC 22518 plasmid pAP22518-1, complete sequence) position: , mismatch: 8, identity: 0.75

tagtccctcccacactgccaatatttcttcat	CRISPR spacer
tttaacctcccacactcccaatatgtctttaa	Protospacer
*    *********** ******* ****.* 

350. spacer 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to MH560358 (Escherichia virus KFS-EC, complete genome) position: , mismatch: 8, identity: 0.778

aaagatattaggctatccttcggggtagtctttctt	CRISPR spacer
taattttatgggctatccttcggggtagcctttttt	Protospacer
 **  *  *.******************.****.**

351. spacer 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to MT764208 (Escherichia phage JEP8, complete genome) position: , mismatch: 8, identity: 0.778

aaagatattaggctatccttcggggtagtctttctt	CRISPR spacer
taattttatgggctatccttcggggtagcctttttt	Protospacer
 **  *  *.******************.****.**

352. spacer 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to MF327006 (Shigella phage Sf20, complete genome) position: , mismatch: 8, identity: 0.778

aaagatattaggctatccttcggggtagtctttctt	CRISPR spacer
taattttatgggctatccttcggggtagcctttttt	Protospacer
 **  *  *.******************.****.**

353. spacer 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_025425 (Enterobacteria phage GEC-3S complete genome) position: , mismatch: 8, identity: 0.778

aaagatattaggctatccttcggggtagtctttctt	CRISPR spacer
taattttatgggctatccttcggggtagcctttttt	Protospacer
 **  *  *.******************.****.**

354. spacer 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to MN709127 (Escherichia virus Ec_Makalu_002, complete genome) position: , mismatch: 8, identity: 0.778

aaagatattaggctatccttcggggtagtctttctt	CRISPR spacer
taattttatgggctatccttcggggtagcctttttt	Protospacer
 **  *  *.******************.****.**

355. spacer 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to MK962753 (Shigella phage JK32, complete genome) position: , mismatch: 8, identity: 0.778

aaagatattaggctatccttcggggtagtctttctt	CRISPR spacer
taattttatgggctatccttcggggtagcctttttt	Protospacer
 **  *  *.******************.****.**

356. spacer 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to MN850574 (Escherichia phage kaaroe, complete genome) position: , mismatch: 8, identity: 0.778

aaagatattaggctatccttcggggtagtctttctt	CRISPR spacer
taattttatgggctatccttcggggtagcctttttt	Protospacer
 **  *  *.******************.****.**

357. spacer 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to MN894885 (Escherichia virus Ec_Makalu_001, complete genome) position: , mismatch: 8, identity: 0.778

aaagatattaggctatccttcggggtagtctttctt	CRISPR spacer
taattttatgggctatccttcggggtagcctttttt	Protospacer
 **  *  *.******************.****.**

358. spacer 3.6|87945|36|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to MN882349 (Escherichia virus Ec_Makalu_003, complete genome) position: , mismatch: 8, identity: 0.778

aaagatattaggctatccttcggggtagtctttctt	CRISPR spacer
taattttatgggctatccttcggggtagcctttttt	Protospacer
 **  *  *.******************.****.**

359. spacer 1.15|17366|32|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054603 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

tagtccctcccacactgccaatatttcttcat	CRISPR spacer
agaacgcaaccacactgcgaatttttcttcat	Protospacer
 .. * *  ********* *** *********

360. spacer 2.28|68190|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NC_030904 (Bacillus phage vB_BhaS-171, complete genome) position: , mismatch: 9, identity: 0.757

ctggtgtcggggttgtagtattcgtctcggtacaaca	CRISPR spacer
tttgtggtttcgttgtagtattcgtctcggtaaagca	Protospacer
.* *** .   ********************* *.**

361. spacer 2.40|69082|30|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 9, identity: 0.7

ggcgatatttggcgtgccgctcagccttaa	CRISPR spacer
cgcgatatttggcgagccgctcctgcgccg	Protospacer
 ************* *******   * . .

362. spacer 2.28|68190|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018385 (Burkholderia pseudomallei strain 2008724860 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.73

ctggtgtcggggttgtagtattcgtctcggtacaaca	CRISPR spacer
ggagaatccgggttgtagtattcgtcgcggtaaatga	Protospacer
  .* .** ***************** ***** *  *

363. spacer 3.11|88306|37|NC_020287|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024791 (Nostoc flagelliforme CCNUN1 plasmid pNFSY06, complete sequence) position: , mismatch: 10, identity: 0.73

atcgatatactttttagcatcagctaaatgataaaaa	CRISPR spacer
acgcttaggagttttagcatcagctaaatgcttaaaa	Protospacer
*.   ** .  ******************* * ****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 2965 4 Acinetobacter_phage(100.0%) transposase,integrase attL 292:305|attR 12759:12772
DBSCAN-SWA_2 23952 : 26231 2 Cyanophage(100.0%) NA NA
DBSCAN-SWA_3 30247 : 36313 8 Brucella_phage(50.0%) NA NA
DBSCAN-SWA_4 39445 : 40093 1 Klebsiella_phage(100.0%) NA NA
DBSCAN-SWA_5 45129 : 45843 1 Microcystis_virus(100.0%) NA NA
DBSCAN-SWA_6 70319 : 70901 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_7 91114 : 92786 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_8 97687 : 98074 1 Virus_Rctr197k(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_020297
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 31353 : 42311 12 uncultured_Mediterranean_phage(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_020290
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020290_1 455-556 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_020290_1 1.1|478|56|NC_020290|CRISPRCasFinder 478-533 56 NC_020290 Synechocystis sp. PCC 6803 plasmid pCC5.2_M, complete sequence 478-533 0 1.0

1. spacer 1.1|478|56|NC_020290|CRISPRCasFinder matches to NC_020290 (Synechocystis sp. PCC 6803 plasmid pCC5.2_M, complete sequence) position: , mismatch: 0, identity: 1.0

ggtctgttgctgacacgcacgatgacgtatgacccttttagcacggtagggagcgt	CRISPR spacer
ggtctgttgctgacacgcacgatgacgtatgacccttttagcacggtagggagcgt	Protospacer
********************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_020286
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1969049 : 2031360 60 Bacillus_virus(14.29%) transposase,protease,tRNA NA
DBSCAN-SWA_2 2203040 : 2248763 45 Mycobacterium_phage(28.57%) transposase,protease NA
DBSCAN-SWA_3 3035642 : 3095552 56 Roseobacter_phage(16.67%) transposase,protease NA
DBSCAN-SWA_4 3223608 : 3232455 11 Paramecium_bursaria_Chlorella_virus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage