Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_020261 Cronobacter sakazakii SP291 plasmid pSP291-2, complete sequence 0 crisprs NA 0 0 0 0
NC_020263 Cronobacter sakazakii SP291 plasmid pSP291-1, complete sequence 0 crisprs WYL,csa3 0 0 10 0
NC_020262 Cronobacter sakazakii SP291 plasmid pSP291-3, complete sequence 0 crisprs NA 0 0 0 0
NC_020260 Cronobacter sakazakii SP291, complete sequence 20 crisprs DEDDh,RT,WYL,cas3,DinG,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e 0 25 7 0

Results visualization

1. NC_020263
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 13269 14 Bacillus_phage(100.0%) protease NA
DBSCAN-SWA_2 20992 : 22300 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_3 29224 : 39841 12 Enterobacteria_phage(20.0%) NA NA
DBSCAN-SWA_4 46933 : 52394 6 uncultured_Caudovirales_phage(75.0%) NA NA
DBSCAN-SWA_5 61893 : 62652 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_6 67463 : 68441 1 Gordonia_phage(100.0%) integrase attL 58151:58165|attR 78448:78462
DBSCAN-SWA_7 76586 : 78245 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_8 82510 : 84457 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_9 87625 : 90340 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_10 114686 : 116862 2 Escherichia_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_020260
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_1 34546-34665 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_2 146428-146518 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_3 432674-432773 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_4 656847-656926 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_5 1706301-1706385 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_6 2180475-2180560 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_7 2405293-2405381 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_8 2527642-2527765 Orphan NA
1 spacers
DinG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_9 2538674-2538763 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_10 2714183-2714452 Orphan NA
5 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_11 2820344-2820799 TypeI-E I-E
7 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_12 2847198-2848506 Orphan I-E
21 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_13 2939712-2939792 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_14 3024396-3024490 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_15 3062874-3062995 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_16 3123042-3123125 Orphan I-F
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_17 3413942-3414042 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_18 3798108-3798182 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_19 4156372-4156492 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020260_20 4309882-4309957 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_020260_12 12.8|2847653|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2847653-2847684 32 NZ_CP023822 Escherichia coli strain 7/2 plasmid p7_2.2, complete sequence 19957-19988 0 1.0
NC_020260_12 12.16|2848141|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848141-2848172 32 JF314845 Cronobacter phage ES2, complete genome 12753-12784 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX711879 Pseudomonas aeruginosa strain P378 plasmid P378-IMP, complete sequence 45311-45342 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX928750 Klebsiella pneumoniae strain CRKP-1-KPC plasmid pCRKP-1-KPC, complete sequence 57300-57331 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF072962 Citrobacter freundii strain P10159 plasmid pP10159-2, complete sequence 42414-42445 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY271415 Klebsiella pneumoniae strain H151400611 plasmid IncN_typeC, complete sequence 17377-17408 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY271414 Klebsiella pneumoniae strain H151440672 plasmid IncN_typeB, complete sequence 9797-9828 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY128483 Klebsiella oxytoca strain 97_38 plasmid pKm38_N, complete sequence 59894-59925 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982614 Escherichia coli strain CRE1504 plasmid pIMP-HK1504, complete sequence 9559-9590 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982615 Escherichia coli strain CRE1505 plasmid pIMP-FS1505, complete sequence 9559-9590 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX711880 Klebsiella pneumoniae strain 1220 plasmid p1220-IMP, complete sequence 40734-40765 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982618 Escherichia coli strain CRE1517 plasmid pIMP-GZ1517, complete sequence 9559-9590 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU295131 Escherichia coli strain BK28009 plasmid pBK28009, complete sequence 98892-98923 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY128484 Klebsiella michiganensis strain 97_58 plasmid pKm38_N, complete sequence 61019-61050 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051707 Escherichia coli strain CRE1502 plasmid pIMP-SZ1502, complete sequence 9559-9590 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982613 Klebsiella pneumoniae strain CRE 1496 plasmid pIMP1496, complete sequence 9559-9590 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU886034 Klebsiella pneumoniae strain Kp1 plasmid pIMP-HZ1, complete sequence 9558-9589 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU862632 Klebsiella pneumoniae strain CRE1495 plasmid pIMP-KP1495, complete sequence 9554-9585 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051710 Citrobacter freundii strain CRE1503 plasmid pIMP-FJ1503, complete sequence 9559-9590 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT989598 Enterobacter cloacae strain CRE1506 plasmid pIMP-SH1506, complete sequence 9559-9590 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KM977631 Klebsiella pneumoniae strain CRE1495 plasmid pIMP-1495, complete sequence 9559-9590 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KM660724 Morganella morganii strain MRSN22709 plasmid pMR3-OXA181, complete sequence 47940-47971 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051708 Klebsiella pneumoniae strain CRE1501 plasmid pIMP-SZ1501, complete sequence 9558-9589 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051709 Escherichia coli strain CRE1058 plasmid pIMP-GZ1058, complete sequence 9559-9590 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982616 Escherichia coli strain CRE1509 plasmid pIMP-HK1509, complete sequence 9559-9590 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU295134 Escherichia coli strain BK32602 plasmid pBK32602, complete sequence 79113-79144 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KJ440076 Escherichia coli strain CGMHLK75 plasmid pLK75, complete sequence 47620-47651 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_014231 Escherichia coli plasmid pKC394, complete sequence 49261-49292 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 LT221037 Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence 9559-9590 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 LT221038 Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence 29098-29129 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MK356560 Salmonella sp. strain Sa1423 plasmid pSa1423-50K, complete sequence 45333-45364 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP031259 Klebsiella quasipneumoniae strain L22 plasmid pL22-2, complete sequence 21617-21648 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP031259 Klebsiella quasipneumoniae strain L22 plasmid pL22-2, complete sequence 24513-24544 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP048785 Serratia liquefaciens strain S1 plasmid pSl1, complete sequence 19464-19495 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP045256 Proteus mirabilis strain L90-1 plasmid pL901, complete sequence 18184-18215 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_021660 Klebsiella pneumoniae FCF3SP plasmid pKPC_FCF/3SP, complete sequence 15038-15069 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028486 Escherichia coli strain E41-1 plasmid p3, complete sequence 29601-29632 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_007682 Escherichia coli plasmid pMUR050, complete sequence 51928-51959 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043186 Escherichia coli O16:H48 strain PG20180171 plasmid pPG20180171.1-IncN, complete sequence 38644-38675 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026053 Salmonella enterica strain FDAARGOS_70 plasmid unnamed1, complete sequence 45198-45229 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018646 Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 plasmid pSE79-2359, complete sequence 42228-42259 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP023420 Klebsiella pneumoniae strain 1050 plasmid pKp1050-4, complete sequence 56071-56102 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK878892 Escherichia coli strain J53 plasmid pMG333, complete sequence 100110-100141 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026277 Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence 22351-22382 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP033394 Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence 133338-133369 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LS998788 Escherichia coli isolate EC-TO75 plasmid 4, complete sequence 9719-9750 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KJ440075 Klebsiella pneumoniae strain CGMHLK78 plasmid pLK78, complete sequence 47183-47214 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026236 Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence 43089-43120 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 57379-57410 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009881 Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence 40920-40951 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026169 Leclercia sp. LSNIH1 plasmid pKPC-79f0, complete sequence 26404-26435 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052433 Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-2, complete sequence 43061-43092 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT838197 Escherichia coli isolate WI1 isolate plasmid pWI1-KPC3, complete sequence 9566-9597 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LS992177 Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence 22272-22303 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 LN610760 Citrobacter freundii plasmid pCF8698_KPC2, strain CF8698, complete sequence 14524-14555 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102341 Uncultured bacterium plasmid pRSB201, complete sequence 52541-52572 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102342 Uncultured bacterium plasmid pRSB203, complete sequence 38928-38959 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102343 Uncultured bacterium plasmid pRSB205, complete sequence 43958-43989 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102344 Uncultured bacterium plasmid pRSB206, complete sequence 48862-48893 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028173 Salmonella enterica strain CFSAN064033 plasmid pGMI17-001_1, complete sequence 34645-34676 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP021730 Escherichia coli strain Combat11I9 plasmid pCombat11I9-4, complete sequence 18609-18640 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP036363 Klebsiella pneumoniae strain WCHKP2080 plasmid p1_095080, complete sequence 45241-45272 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_025019 Klebsiella pneumoniae subsp. ozaenae plasmid pKo6, complete sequence 56680-56711 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP009867 Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence 44587-44618 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020527 Enterobacter cloacae strain 109 plasmid unnamed2, complete sequence 56351-56382 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP044159 Shigella flexneri strain AR-0423 plasmid pAR-0423-1, complete sequence 51956-51987 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP042643 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-5, complete sequence 37695-37726 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN891676 Klebsiella pneumoniae strain 24169 plasmid p24169-KPC, complete sequence 43150-43181 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052359 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-3, complete sequence 42122-42153 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052446 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-3, complete sequence 40410-40441 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP040895 Leclercia adecarboxylata strain Z96-1 plasmid pIMP-Z96-1, complete sequence 85771-85802 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP014524 Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence 40560-40591 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_025186 Klebsiella pneumoniae subsp. pneumoniae strain OW16C2 plasmid pOW16C2, complete sequence 53449-53480 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP040178 Klebsiella pneumoniae strain 2e plasmid unnamed3, complete sequence 26925-26956 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 5687-5718 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_024974 Escherichia coli plasmid pL2-43, complete sequence 4788-4819 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP044187 Salmonella enterica subsp. enterica strain AR-0402 plasmid pAR-0402 52830-52861 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026757 Klebsiella aerogenes strain AR_0062 plasmid tig00000053_pilon, complete sequence 28815-28846 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP035387 Enterobacter hormaechei strain S11_16 plasmid unnamed2, complete sequence 54493-54524 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP052872 Enterobacter cloacae strain 3849 plasmid p3846_IncN_VIM-1, complete sequence 47374-47405 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP012143 Shigella flexneri 4c strain 1205 plasmid 1205p3, complete sequence 5710-5741 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018963 Escherichia coli strain Ecol_517 plasmid pEC517_KPC, complete sequence 9566-9597 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019033 Escherichia coli plasmid pQNR2078, complete sequence 36353-36384 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_021622 Klebsiella pneumoniae plasmid pK45-67VIM complete sequence 52019-52050 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP033359 Salmonella enterica subsp. enterica strain EQAS2016S1 plasmid pEQAS2016S1-1, complete sequence 19072-19103 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028958 Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence 2612-2643 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP039821 Klebsiella pneumoniae strain C2414 plasmid pC2414-3-NDM, complete sequence 54177-54208 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP018758 Metakosakonia sp. MRY16-398 plasmid pMRY16-398_2, complete sequence 37143-37174 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_025183 Escherichia coli strain ECN580 plasmid pECN580, complete sequence 56066-56097 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_003292 Salmonella enterica subsp. enterica serovar Typhimurium plasmid R46, complete sequence 27796-27827 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018887 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence 4903-4934 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018887 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence 115569-115600 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP032203 Escherichia coli strain AR_0086 plasmid unnamed2, complete sequence 17944-17975 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP040859 Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence 31542-31573 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_024967 Escherichia coli strain YD626E plasmid pYD626E, complete sequence 63907-63938 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 50500-50531 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019098 Escherichia coli strain HHA45 plasmid pHHA45, complete sequence 32625-32656 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP046118 Enterobacter cloacae strain CBG15936 plasmid pNDM1-CBG, complete sequence 53794-53825 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP017086 Proteus mirabilis strain T18 plasmid pT18, complete sequence 16294-16325 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 KF534788 Escherichia coli plasmid pNDM-BTR, complete sequence 50530-50561 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009862 Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence 70773-70804 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_014208 Klebsiella oxytoca KOX105 plasmid pKOX105, complete sequence 29612-29643 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_023909 Escherichia coli strain EcNDM1 plasmid pEcNDM1, complete sequence 49359-49390 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_023910 Escherichia coli strain EcNDM0 plasmid pEcNDM0, complete sequence 44547-44578 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009864 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence 53245-53276 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009874 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence 40641-40672 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009874 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence 43537-43568 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985266 Escherichia coli strain 177 plasmid RCS53_p, complete sequence 38579-38610 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_025141 Escherichia coli plasmid pH1038-142, complete sequence 46862-46893 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009853 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pKPC-860, complete sequence 47144-47175 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP042533 Klebsiella aerogenes strain C9 plasmid pC9_003, complete sequence 41919-41950 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018977 Escherichia coli strain Ecol_656 plasmid pEC656_KPC, complete sequence 9566-9597 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP011589 Enterobacter asburiae strain CAV1043 plasmid pKPC_CAV1043, complete sequence 50269-50300 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026389 Leclercia sp. LSNIH3 plasmid pKPC-3714, complete sequence 27381-27412 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP008901 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pKPC-47e, complete sequence 40920-40951 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019124 Salmonella enterica subsp. enterica serovar Virchow plasmid pVQS1, complete sequence 5248-5279 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025965 Klebsiella pneumoniae strain WCHKP34 plasmid pNDM1_LL34, complete sequence 50861-50892 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020066 Klebsiella pneumoniae strain AR_0117 plasmid unitig_5, complete sequence 15955-15986 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP022157 Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence 48979-49010 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP015389 Klebsiella pneumoniae strain NY9 plasmid pNY9_4, complete sequence 44538-44569 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN178639 Kluyvera cryocrescens strain SCW13 plasmid pSCW13-1, complete sequence 54541-54572 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP038278 Raoultella ornithinolytica strain WLK218 plasmid pWLK-IncN, complete sequence 36428-36459 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP038278 Raoultella ornithinolytica strain WLK218 plasmid pWLK-IncN, complete sequence 37770-37801 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025233 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 plasmid pSNE1-1925, complete sequence 56639-56670 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP050160 Escherichia coli plasmid Carbapenemase(IMP-4)_IncN, complete sequence 51783-51814 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP050859 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-NDM, complete sequence 51073-51104 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025758 Citrobacter freundii complex sp. CFNIH12 strain CFNIH2 plasmid pKPC-349c, complete sequence 53244-53275 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP050159 Enterobacter cloacae plasmid Carbapenemase(IMP-26)_IncN, complete sequence 47911-47942 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019087 Escherichia coli O25b:H4-ST131 str. EC958 plasmid pKC396, complete sequence 40273-40304 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018945 Escherichia coli strain Ecol_224 plasmid pEC224_KPC, complete sequence 17628-17659 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP017083 Proteus mirabilis strain T21 plasmid pT211, complete sequence 19525-19556 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP019026 Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence 26469-26500 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP019026 Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence 27706-27737 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026211 Citrobacter sp. CFNIH10 plasmid pCIT-eb1a, complete sequence 277-308 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022367 Escherichia coli E317 plasmid pE317_IMP6 DNA, complete sequence 50797-50828 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP027050 Klebsiella pneumoniae strain 20_GR_12 plasmid IncN, complete sequence 22448-22479 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028579 Klebsiella pneumoniae strain WCHKP36 plasmid p1_020036, complete sequence 14516-14547 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MH339998 Uncultured bacterium plasmid pHTP1 clone AA-110, complete sequence 4811-4842 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025710 Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence 61503-61534 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026198 Enterobacteriaceae bacterium ENNIH3 plasmid pKPC-c606, complete sequence 102906-102937 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP030335 Escherichia coli strain AR_451 plasmid unnamed1, complete sequence 39335-39366 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP036368 Klebsiella pneumoniae strain WCHKP115068 plasmid p1_115068, complete sequence 50929-50960 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP052879 Escherichia coli strain C21 plasmid pC21-2, complete sequence 18537-18568 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_009132 Escherichia coli plasmid pLEW517, complete sequence 57048-57079 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025984 Enterobacteriaceae bacterium A-F18 plasmid pAF18_2, complete sequence 9695-9726 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP031109 Escherichia coli strain AMSCJX02 plasmid pAMSC4, complete sequence 41172-41203 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP033830 Serratia sp. FDAARGOS_506 plasmid unnamed, complete sequence 42676-42707 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_011383 Klebsiella pneumoniae plasmid 9, complete sequence 41994-42025 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP042581 Enterobacter kobei strain C16 plasmid pC16_003, complete sequence 35813-35844 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020119 Escherichia coli strain AR_0104 plasmid unitig_7, complete sequence 30900-30931 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_022885 Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence 54717-54748 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 KC170280 Uncultured bacterium plasmid pDS2, complete sequence 9720-9751 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043224 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.2-IncN, complete sequence 38460-38491 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026496 Klebsiella pneumoniae strain 616 plasmid pKp616_1, complete sequence 49819-49850 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022354 Escherichia coli E033 plasmid pE033_IMP6 DNA, complete sequence 63885-63916 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022355 Escherichia coli E034 plasmid pE034_IMP6 DNA, complete sequence 100300-100331 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022356 Escherichia coli E119 plasmid pE119_5kIMP6 DNA, complete sequence 40290-40321 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022358 Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence 52575-52606 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022359 Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence 126182-126213 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_011617 Klebsiella pneumoniae plasmid pKP96, complete sequence 58981-59012 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043184 Escherichia coli O16:H48 strain PG20180172 plasmid pPG20180172.1-IncN, complete sequence 39178-39209 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043188 Escherichia coli O16:H48 strain PG20180170 plasmid pPG20180170.1-IncN, complete sequence 38649-38680 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022349 Klebsiella pneumoniae E105 plasmid pKPI-1 DNA, complete sequence 39732-39763 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_022374 Escherichia coli plasmid pHKU1, complete sequence 45504-45535 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP018362 Escherichia coli strain A56-1S plasmid pA56-1S, complete sequence 42754-42785 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019550 Klebsiella pneumoniae strain THC11 plasmid pTHC11-2, complete sequence 41085-41116 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP018363 Escherichia coli strain A56-1R plasmid pA56-1R, complete sequence 15296-15327 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052394 Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-2, complete sequence 47750-47781 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019403 Klebsiella pneumoniae strain E129 plasmid pE129_IMP6, complete sequence 40478-40509 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019402 Klebsiella pneumoniae strain E013 plasmid pE013_IMP6, complete sequence 40478-40509 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019404 Klebsiella pneumoniae strain E188 plasmid pE188_IMP6, complete sequence 41466-41497 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 38605-38636 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018649 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-1, complete sequence 28666-28697 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026590 Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence 48885-48916 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP023981 Klebsiella variicola strain X39 plasmid pX39-4, complete sequence 18125-18156 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LR745047 Klebsiella pneumoniae isolate Kpn2166 plasmid pCTX-M15_Kpn2166 68169-68200 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018643 Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence 121-152 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985259 Escherichia coli strain 592 plasmid RCS44_p, complete sequence 4633-4664 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985245 Escherichia coli strain 523 plasmid RCS42_p, complete sequence 4633-4664 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985242 Escherichia coli strain 604 plasmid RCS43_p, complete sequence 4632-4663 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985251 Escherichia coli strain 502 plasmid RCS45_p, complete sequence 4632-4663 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK878894 Escherichia coli strain J53 plasmid pMG334, complete sequence 1489-1520 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK416183 Escherichia coli strain Ec-2Lar plasmid unnamed, complete sequence 9568-9599 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK416152 Escherichia coli strain 6BS17eCTX plasmid pHNBS17e, complete sequence 49218-49249 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MN241904 Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM62, complete sequence 53267-53298 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019888 Klebsiella pneumoniae strain BK31551 plasmid pBK31551, complete sequence 74843-74874 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909339 Klebsiella pneumoniae strain 24632 plasmid p24632-IMP, complete sequence 42524-42555 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909337 Klebsiella pneumoniae strain 20389 plasmid p20389-IMP, complete sequence 42768-42799 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909334 Klebsiella pneumoniae strain 13-sp plasmid p13SP-IMP, complete sequence 44750-44781 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909336 Klebsiella pneumoniae strain 201311334 plasmid p11334-IMP, complete sequence 41839-41870 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909328 Klebsiella pneumoniae strain D920 plasmid pD920-IMP, complete sequence 49228-49259 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH917123 Klebsiella pneumoniae strain Kp735 plasmid pSZN_KPC, complete sequence 59633-59664 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK036890 Klebsiella pneumoniae strain D610 plasmid pD610-1IMP, complete sequence 28994-29025 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH128095 Klebsiella pneumoniae strain CZPF1510086 plasmid pTBCZNDM02, complete sequence 36582-36613 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK356561 Escherichia coli strain J53 plasmid pSa1423TC-59K, complete sequence 52990-53021 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK356561 Escherichia coli strain J53 plasmid pSa1423TC-59K, complete sequence 55011-55042 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK862125 Enterobacter hormaechei strain 1-RC-17-04408-5 plasmid P04408-5-KPC40, complete sequence 46207-46238 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN657245 Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence 40464-40495 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN657246 Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence 45456-45487 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MT199177 Escherichia coli strain 100 plasmid p100_NDM5_IncN, complete sequence 55047-55078 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG886286 Escherichia coli strain ECSIC9 plasmid pECSIC9, complete sequence 9500-9531 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF474175 Escherichia coli strain J53/pNIT-HK plasmid pNIT-HK, complete sequence 26887-26918 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF344559 Enterobacter hormaechei strain 128379 plasmid p128379-IMP, complete sequence 9559-9590 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH727565 Citrobacter freundii strain ECL-14-57 plasmid pIMP-ECL14-57, complete sequence 9559-9590 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG878866 Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence 121789-121820 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY271413 Klebsiella pneumoniae strain KL49 plasmid IncN_typeA, complete sequence 54015-54046 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF344557 Klebsiella pneumoniae strain 10677 plasmid p10677-IMP, complete sequence 10387-10418 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF953243 Klebsiella pneumoniae strain C5 plasmid pC5_41608, complete sequence 4788-4819 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG288677 Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence 62696-62727 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG904997 Escherichia coli strain 15OD0495 plasmid p15ODMR, complete sequence 41108-41139 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020059 Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence 84247-84278 1 0.969
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP017725 Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 strain SGSC 2518 isolate SARB61 plasmid pSARB26_02, complete sequence 23765-23796 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP026282 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence 225819-225850 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KX711879 Pseudomonas aeruginosa strain P378 plasmid P378-IMP, complete sequence 24264-24295 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KX928750 Klebsiella pneumoniae strain CRKP-1-KPC plasmid pCRKP-1-KPC, complete sequence 13274-13305 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KX881941 Klebsiella pneumoniae subsp. pneumoniae strain H154180724 plasmid pJF-WMKPCN1, complete sequence 32713-32744 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KX928751 Klebsiella pneumoniae strain CRKP-5-KPC plasmid pCRKP-5-KPC, complete sequence 20905-20936 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KY020154 Klebsiella pneumoniae strain Kpn-431cz plasmid pKpn-431cz, complete sequence 76053-76084 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MF072962 Citrobacter freundii strain P10159 plasmid pP10159-2, complete sequence 24264-24295 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KY887592 Citrobacter freundii strain Cf52 plasmid pCf52, complete sequence 29343-29374 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KY887593 Citrobacter freundii strain Cf53 plasmid pCf53, complete sequence 29343-29374 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KY887594 Klebsiella pneumoniae strain Kp55 plasmid pKp55, complete sequence 29343-29374 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KY271415 Klebsiella pneumoniae strain H151400611 plasmid IncN_typeC, complete sequence 39149-39180 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KY271414 Klebsiella pneumoniae strain H151440672 plasmid IncN_typeB, complete sequence 31568-31599 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KY128483 Klebsiella oxytoca strain 97_38 plasmid pKm38_N, complete sequence 21774-21805 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP014073 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence 87437-87468 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KT982614 Escherichia coli strain CRE1504 plasmid pIMP-HK1504, complete sequence 30801-30832 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KU355873 Escherichia coli strain FAM22871 plasmid pFAM22871_1, complete sequence 113190-113221 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KT982615 Escherichia coli strain CRE1505 plasmid pIMP-FS1505, complete sequence 30801-30832 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KX711880 Klebsiella pneumoniae strain 1220 plasmid p1220-IMP, complete sequence 19323-19354 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KT982618 Escherichia coli strain CRE1517 plasmid pIMP-GZ1517, complete sequence 27941-27972 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KU295131 Escherichia coli strain BK28009 plasmid pBK28009, complete sequence 13858-13889 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KY128484 Klebsiella michiganensis strain 97_58 plasmid pKm38_N, complete sequence 22071-22102 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KU051707 Escherichia coli strain CRE1502 plasmid pIMP-SZ1502, complete sequence 27714-27745 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KT982613 Klebsiella pneumoniae strain CRE 1496 plasmid pIMP1496, complete sequence 27342-27373 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KU886034 Klebsiella pneumoniae strain Kp1 plasmid pIMP-HZ1, complete sequence 27951-27982 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KU862632 Klebsiella pneumoniae strain CRE1495 plasmid pIMP-KP1495, complete sequence 27944-27975 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KU051710 Citrobacter freundii strain CRE1503 plasmid pIMP-FJ1503, complete sequence 27507-27538 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KT989598 Enterobacter cloacae strain CRE1506 plasmid pIMP-SH1506, complete sequence 31021-31052 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KM083064 Vibrio cholerae strain ICDC-1447 plasmid pVC1447, complete sequence 158026-158057 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KM977631 Klebsiella pneumoniae strain CRE1495 plasmid pIMP-1495, complete sequence 46526-46557 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KM660724 Morganella morganii strain MRSN22709 plasmid pMR3-OXA181, complete sequence 20303-20334 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KU051708 Klebsiella pneumoniae strain CRE1501 plasmid pIMP-SZ1501, complete sequence 27821-27852 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KM670336 Salmonella enterica subsp. enterica serovar Senftenberg strain SRC119 plasmid pSRC119-A/C, complete sequence 29343-29374 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KU051709 Escherichia coli strain CRE1058 plasmid pIMP-GZ1058, complete sequence 27952-27983 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KT982616 Escherichia coli strain CRE1509 plasmid pIMP-HK1509, complete sequence 30801-30832 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KU295134 Escherichia coli strain BK32602 plasmid pBK32602, complete sequence 21476-21507 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KJ440076 Escherichia coli strain CGMHLK75 plasmid pLK75, complete sequence 9523-9554 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_014368 Klebsiella pneumoniae plasmid pNL194, complete sequence 12555-12586 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_014231 Escherichia coli plasmid pKC394, complete sequence 27407-27438 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_020086 Escherichia coli plasmid pE66An, complete sequence 53263-53294 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 LT221037 Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence 38434-38465 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 LT221038 Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence 60816-60847 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 MK356560 Salmonella sp. strain Sa1423 plasmid pSa1423-50K, complete sequence 30901-30932 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP042628 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-1_MCR3, complete sequence 15925-15956 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP042634 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-7, complete sequence 16055-16086 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP031259 Klebsiella quasipneumoniae strain L22 plasmid pL22-2, complete sequence 37181-37212 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_021660 Klebsiella pneumoniae FCF3SP plasmid pKPC_FCF/3SP, complete sequence 37726-37757 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_021664 Klebsiella pneumoniae FCF1305 plasmid pKPC_FCF13/05, complete sequence 36202-36233 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP017387 Klebsiella pneumoniae strain KP36 plasmid 2, complete sequence 138651-138682 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP019647 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence 250282-250313 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP028486 Escherichia coli strain E41-1 plasmid p3, complete sequence 47994-48025 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_007682 Escherichia coli plasmid pMUR050, complete sequence 40048-40079 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 CP026801 Shigella sonnei strain ATCC 29930 plasmid unnamed 16432-16463 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP043186 Escherichia coli O16:H48 strain PG20180171 plasmid pPG20180171.1-IncN, complete sequence 24214-24245 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP026053 Salmonella enterica strain FDAARGOS_70 plasmid unnamed1, complete sequence 22228-22259 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP018646 Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 plasmid pSE79-2359, complete sequence 12461-12492 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP023420 Klebsiella pneumoniae strain 1050 plasmid pKp1050-4, complete sequence 22146-22177 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 LC055503 Klebsiella pneumoniae plasmid pHM881QN DNA, complete sequence, strain: Y881 28205-28236 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_009980 Salmonella enterica subsp. enterica serovar Dublin plasmid pMAK2, complete sequence 35870-35901 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP024192 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed1, complete sequence 28982-29013 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MK878892 Escherichia coli strain J53 plasmid pMG333, complete sequence 85350-85381 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP026277 Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence 41260-41291 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP033394 Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence 113884-113915 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_LS998787 Escherichia coli isolate EC-TO75 plasmid 3, complete sequence 6003-6034 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KJ440075 Klebsiella pneumoniae strain CGMHLK78 plasmid pLK78, complete sequence 32740-32771 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP042507 Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence 35054-35085 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_008612 Photobacterium damselae subsp. piscicida plasmid pP99-018, complete sequence 148590-148621 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP025470 Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence 81697-81728 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 11680-11711 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 80011-80042 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 137903-137934 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP009881 Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence 22011-22042 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 MT077883 Escherichia coli plasmid p23, complete sequence 39042-39073 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP026169 Leclercia sp. LSNIH1 plasmid pKPC-79f0, complete sequence 58312-58343 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 CP052433 Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-2, complete sequence 24818-24849 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_LT838197 Escherichia coli isolate WI1 isolate plasmid pWI1-KPC3, complete sequence 32186-32217 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_LS992177 Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence 36767-36798 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_EU880929 Klebsiella pneumoniae strain INS23K plasmid pLJ1, complete sequence 35303-35334 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_LT904892 Salmonella enterica subsp. enterica serovar Typhi strain 80-2002 plasmid 2 129325-129356 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 LN610760 Citrobacter freundii plasmid pCF8698_KPC2, strain CF8698, complete sequence 37157-37188 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 JN102341 Uncultured bacterium plasmid pRSB201, complete sequence 33207-33238 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 JN102342 Uncultured bacterium plasmid pRSB203, complete sequence 24486-24517 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 JN102343 Uncultured bacterium plasmid pRSB205, complete sequence 18513-18544 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 JN102344 Uncultured bacterium plasmid pRSB206, complete sequence 19001-19032 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP028173 Salmonella enterica strain CFSAN064033 plasmid pGMI17-001_1, complete sequence 11771-11802 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP021730 Escherichia coli strain Combat11I9 plasmid pCombat11I9-4, complete sequence 41147-41178 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP036363 Klebsiella pneumoniae strain WCHKP2080 plasmid p1_095080, complete sequence 25787-25818 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_025019 Klebsiella pneumoniae subsp. ozaenae plasmid pKo6, complete sequence 26218-26249 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 CP009867 Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence 25678-25709 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP042646 Escherichia coli strain NCYU-21-79 plasmid pNCYU-21-79-1, complete sequence 112932-112963 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP020527 Enterobacter cloacae strain 109 plasmid unnamed2, complete sequence 16857-16888 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP044159 Shigella flexneri strain AR-0423 plasmid pAR-0423-1, complete sequence 33166-33197 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_015599 Escherichia coli IncN plasmid N3, complete sequence 17128-17159 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_021238 Klebsiella pneumoniae strain Kpn-1433 plasmid pKP1433, complete sequence 13626-13657 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 CP042643 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-5, complete sequence 23252-23283 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 MN175387 Klebsiella pneumoniae strain KP-14-6 plasmid pKP-14-6-NDM-1, complete sequence 28205-28236 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 MN891676 Klebsiella pneumoniae strain 24169 plasmid p24169-KPC, complete sequence 11758-11789 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 MN891682 Klebsiella pneumoniae strain 116753 plasmid p116753-KPC, complete sequence 106798-106829 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 CP052359 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-3, complete sequence 27623-27654 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 CP052444 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence 26695-26726 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 CP052446 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-3, complete sequence 25900-25931 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP040895 Leclercia adecarboxylata strain Z96-1 plasmid pIMP-Z96-1, complete sequence 67379-67410 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP014524 Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence 22441-22472 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_025186 Klebsiella pneumoniae subsp. pneumoniae strain OW16C2 plasmid pOW16C2, complete sequence 22339-22370 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP040178 Klebsiella pneumoniae strain 2e plasmid unnamed3, complete sequence 58349-58380 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP030077 Enterobacter hormaechei strain 20710 plasmid p3-20710, complete sequence 28205-28236 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP019006 Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_2, complete sequence 35165-35196 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 209918-209949 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_024974 Escherichia coli plasmid pL2-43, complete sequence 19219-19250 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 CP010513 Enterobacter cloacae strain colR/S plasmid, complete sequence 17505-17536 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP044187 Salmonella enterica subsp. enterica strain AR-0402 plasmid pAR-0402 20447-20478 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 MK461930 Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence 264854-264885 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 MN310378 Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence 28205-28236 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 127229-127260 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP026757 Klebsiella aerogenes strain AR_0062 plasmid tig00000053_pilon, complete sequence 14316-14347 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP035387 Enterobacter hormaechei strain S11_16 plasmid unnamed2, complete sequence 13038-13069 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP052872 Enterobacter cloacae strain 3849 plasmid p3846_IncN_VIM-1, complete sequence 13706-13737 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP012143 Shigella flexneri 4c strain 1205 plasmid 1205p3, complete sequence 20114-20145 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP018963 Escherichia coli strain Ecol_517 plasmid pEC517_KPC, complete sequence 32254-32285 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_019033 Escherichia coli plasmid pQNR2078, complete sequence 16512-16543 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_021622 Klebsiella pneumoniae plasmid pK45-67VIM complete sequence 36338-36369 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP033359 Salmonella enterica subsp. enterica strain EQAS2016S1 plasmid pEQAS2016S1-1, complete sequence 41905-41936 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP018884 Klebsiella pneumoniae subsp. pneumoniae strain BR7 plasmid unnamed1, complete sequence 56081-56112 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP028958 Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence 36452-36483 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP039821 Klebsiella pneumoniae strain C2414 plasmid pC2414-3-NDM, complete sequence 21958-21989 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_AP018758 Metakosakonia sp. MRY16-398 plasmid pMRY16-398_2, complete sequence 22646-22677 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_025183 Escherichia coli strain ECN580 plasmid pECN580, complete sequence 25604-25635 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_003292 Salmonella enterica subsp. enterica serovar Typhimurium plasmid R46, complete sequence 13372-13403 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP026206 Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence 24290-24321 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP018887 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence 92881-92912 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP032203 Escherichia coli strain AR_0086 plasmid unnamed2, complete sequence 31438-31469 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP040859 Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence 118-149 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP040024 Klebsiella pneumoniae strain KPC160132 plasmid pIncC-L132, complete sequence 28196-28227 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_024967 Escherichia coli strain YD626E plasmid pYD626E, complete sequence 11698-11729 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP028996 Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence 448-479 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP040039 Klebsiella pneumoniae strain KPC160125 plasmid pIncC-L125 49178-49209 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP040034 Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence 28205-28236 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP022152 Citrobacter freundii strain 705SK3 plasmid p705SK3_1, complete sequence 139992-140023 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_019098 Escherichia coli strain HHA45 plasmid pHHA45, complete sequence 18206-18237 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP029598 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence 116587-116618 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP047350 Proteus cibarius strain ZN2 plasmid pZN2-tetX-171kb, complete sequence 28205-28236 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_019082 Escherichia coli plasmid pZS50, complete sequence 35096-35127 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP046118 Enterobacter cloacae strain CBG15936 plasmid pNDM1-CBG, complete sequence 22556-22587 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 CP043545 Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence 244157-244188 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 KF534788 Escherichia coli plasmid pNDM-BTR, complete sequence 21181-21212 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP009862 Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence 22011-22042 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_014208 Klebsiella oxytoca KOX105 plasmid pKOX105, complete sequence 15644-15675 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_023909 Escherichia coli strain EcNDM1 plasmid pEcNDM1, complete sequence 34860-34891 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_023910 Escherichia coli strain EcNDM0 plasmid pEcNDM0, complete sequence 30048-30079 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP009864 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence 22011-22042 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP009874 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence 27984-28015 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_LT985266 Escherichia coli strain 177 plasmid RCS53_p, complete sequence 7154-7185 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP047345 Proteus vulgaris strain ZN3 plasmid pZN3-tetX-171kb, complete sequence 28205-28236 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP047353 Proteus mirabilis strain ZA25 plasmid pZA25-tetX-168kb, complete sequence 28205-28236 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_025141 Escherichia coli plasmid pH1038-142, complete sequence 32430-32461 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP009853 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pKPC-860, complete sequence 22011-22042 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP042533 Klebsiella aerogenes strain C9 plasmid pC9_003, complete sequence 29275-29306 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP018977 Escherichia coli strain Ecol_656 plasmid pEC656_KPC, complete sequence 32254-32285 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP011589 Enterobacter asburiae strain CAV1043 plasmid pKPC_CAV1043, complete sequence 27880-27911 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP026389 Leclercia sp. LSNIH3 plasmid pKPC-3714, complete sequence 8472-8503 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP026390 Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence 28995-29026 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP013027 Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence 146233-146264 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP008901 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pKPC-47e, complete sequence 22011-22042 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP041248 Raoultella electrica strain DSM 102253 plasmid unnamed1, complete sequence 94175-94206 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_019124 Salmonella enterica subsp. enterica serovar Virchow plasmid pVQS1, complete sequence 19668-19699 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_032101 Enterobacter cloacae plasmid pG6809-2, complete sequence 21897-21928 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP025965 Klebsiella pneumoniae strain WCHKP34 plasmid pNDM1_LL34, complete sequence 22551-22582 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP020066 Klebsiella pneumoniae strain AR_0117 plasmid unitig_5, complete sequence 47379-47410 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP022155 Escherichia coli strain ABWA45 plasmid pABWA45_1, complete sequence 45274-45305 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP022157 Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence 6177-6208 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP029436 Klebsiella quasipneumoniae strain CAV2013 plasmid pKPC_CAV2013, complete sequence 368393-368424 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP029431 Klebsiella quasipneumoniae strain CAV2018 plasmid pKPC_CAV2018-435, complete sequence 41201-41232 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP015389 Klebsiella pneumoniae strain NY9 plasmid pNY9_4, complete sequence 31894-31925 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 MN178639 Kluyvera cryocrescens strain SCW13 plasmid pSCW13-1, complete sequence 30183-30214 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP038278 Raoultella ornithinolytica strain WLK218 plasmid pWLK-IncN, complete sequence 48998-49029 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP024557 Klebsiella pneumoniae strain INF164 plasmid unnamed1, complete sequence 28982-29013 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP025233 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 plasmid pSNE1-1925, complete sequence 19001-19032 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 CP050160 Escherichia coli plasmid Carbapenemase(IMP-4)_IncN, complete sequence 25591-25622 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP050859 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-NDM, complete sequence 22551-22582 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_014385 Escherichia coli plasmid pEC_L46, complete sequence 100935-100966 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP025758 Citrobacter freundii complex sp. CFNIH12 strain CFNIH2 plasmid pKPC-349c, complete sequence 22010-22041 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP024529 Klebsiella pneumoniae strain INF157 plasmid unnamed1, complete sequence 28982-29013 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 CP050159 Enterobacter cloacae plasmid Carbapenemase(IMP-26)_IncN, complete sequence 26356-26387 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP024522 Klebsiella pneumoniae strain INF158 plasmid unnamed1, complete sequence 28982-29013 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP012931 Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence 185376-185407 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_021845 Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050 plasmid unnamed, complete sequence 70861-70892 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_019087 Escherichia coli O25b:H4-ST131 str. EC958 plasmid pKC396, complete sequence 18433-18464 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP018945 Escherichia coli strain Ecol_224 plasmid pEC224_KPC, complete sequence 37627-37658 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP018959 Escherichia coli strain Ecol_422 plasmid pEC422_KPC, complete sequence 34296-34327 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP017084 Proteus mirabilis strain T21 plasmid pT212, complete sequence 159325-159356 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 186582-186613 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP040029 Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence 28205-28236 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP019026 Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence 44938-44969 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP023724 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed2, complete sequence 73190-73221 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 355037-355068 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP044075 Providencia stuartii strain FDAARGOS_645 plasmid unnamed1, complete sequence 169594-169625 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 MH061383 Pseudomonas aeruginosa plasmid pP6qnrS1, complete sequence 35822-35853 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP026213 Citrobacter sp. CFNIH10 plasmid pKPC-933d, complete sequence 165266-165297 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP026213 Citrobacter sp. CFNIH10 plasmid pKPC-933d, complete sequence 191352-191383 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP045016 Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-1, complete sequence 28205-28236 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP045022 Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-KPC14, complete sequence 20997-21028 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 AP022367 Escherichia coli E317 plasmid pE317_IMP6 DNA, complete sequence 65296-65327 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 AP022370 Klebsiella pneumoniae E328 plasmid pE328_IMP6 DNA, complete sequence 81968-81999 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP027050 Klebsiella pneumoniae strain 20_GR_12 plasmid IncN, complete sequence 45396-45427 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP021899 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_4_pilon, complete sequence 34716-34747 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP028582 Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence 33655-33686 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP025710 Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence 17320-17351 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP024550 Klebsiella pneumoniae strain INF163 plasmid unnamed1, complete sequence 28982-29013 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP026198 Enterobacteriaceae bacterium ENNIH3 plasmid pKPC-c606, complete sequence 78682-78713 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP030335 Escherichia coli strain AR_451 plasmid unnamed1, complete sequence 7911-7942 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP036368 Klebsiella pneumoniae strain WCHKP115068 plasmid p1_115068, complete sequence 31475-31506 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP014697 Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence 7766-7797 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_009132 Escherichia coli plasmid pLEW517, complete sequence 31511-31542 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_AP018672 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-1, complete sequence 29343-29374 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP031109 Escherichia coli strain AMSCJX02 plasmid pAMSC4, complete sequence 16849-16880 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP033830 Serratia sp. FDAARGOS_506 plasmid unnamed, complete sequence 11378-11409 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_011383 Klebsiella pneumoniae plasmid 9, complete sequence 54638-54669 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_011385 Klebsiella pneumoniae plasmid 12, complete sequence 51669-51700 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 KC170280 Uncultured bacterium plasmid pDS2, complete sequence 26911-26942 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP043224 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.2-IncN, complete sequence 24029-24060 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP026234 Citrobacter freundii complex sp. CFNIH4 plasmid pCFR-4109, complete sequence 248686-248717 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP026496 Klebsiella pneumoniae strain 616 plasmid pKp616_1, complete sequence 8266-8297 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 AP022354 Escherichia coli E033 plasmid pE033_IMP6 DNA, complete sequence 49386-49417 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 AP022355 Escherichia coli E034 plasmid pE034_IMP6 DNA, complete sequence 85801-85832 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 AP022356 Escherichia coli E119 plasmid pE119_5kIMP6 DNA, complete sequence 25791-25822 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 AP022358 Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence 38076-38107 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 AP022359 Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence 111683-111714 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_011617 Klebsiella pneumoniae plasmid pKP96, complete sequence 44221-44252 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_016839 Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence 26383-26414 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP043184 Escherichia coli O16:H48 strain PG20180172 plasmid pPG20180172.1-IncN, complete sequence 24213-24244 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP043188 Escherichia coli O16:H48 strain PG20180170 plasmid pPG20180170.1-IncN, complete sequence 24214-24245 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP024564 Klebsiella pneumoniae strain INF278 plasmid unnamed1, complete sequence 28982-29013 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 AP022349 Klebsiella pneumoniae E105 plasmid pKPI-1 DNA, complete sequence 25233-25264 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP014775 Aeromonas veronii strain AVNIH1 plasmid pASP-a58, complete sequence 100509-100540 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_022374 Escherichia coli plasmid pHKU1, complete sequence 30744-30775 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_AP018362 Escherichia coli strain A56-1S plasmid pA56-1S, complete sequence 28255-28286 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_AP019550 Klebsiella pneumoniae strain THC11 plasmid pTHC11-2, complete sequence 26586-26617 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_AP018363 Escherichia coli strain A56-1R plasmid pA56-1R, complete sequence 29795-29826 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 CP052394 Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-2, complete sequence 33251-33282 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_AP019403 Klebsiella pneumoniae strain E129 plasmid pE129_IMP6, complete sequence 25979-26010 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_AP019402 Klebsiella pneumoniae strain E013 plasmid pE013_IMP6, complete sequence 25979-26010 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_AP019404 Klebsiella pneumoniae strain E188 plasmid pE188_IMP6, complete sequence 27319-27350 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 75057-75088 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_LT991956 Enterobacter hormaechei subsp. steigerwaltii isolate C309 plasmid pC309-p2 12374-12405 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP018649 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-1, complete sequence 3635-3666 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 LC225353 Photobacterium damselae subsp. piscicida plasmid pP0855 DNA, complete sequence 148548-148579 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP021734 Escherichia coli strain AR_0114 plasmid unitig_2, complete sequence 47874-47905 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP026590 Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence 31397-31428 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP023981 Klebsiella variicola strain X39 plasmid pX39-4, complete sequence 32557-32588 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_LR745047 Klebsiella pneumoniae isolate Kpn2166 plasmid pCTX-M15_Kpn2166 51057-51088 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP027695 Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence 71513-71544 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP018643 Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence 88426-88457 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_LT985259 Escherichia coli strain 592 plasmid RCS44_p, complete sequence 19038-19069 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_LT985245 Escherichia coli strain 523 plasmid RCS42_p, complete sequence 18976-19007 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_LT985242 Escherichia coli strain 604 plasmid RCS43_p, complete sequence 21114-21145 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_LT985224 Escherichia coli strain 513 plasmid RCS30_p, complete sequence 12716-12747 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_LT985251 Escherichia coli strain 502 plasmid RCS45_p, complete sequence 19035-19066 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP026934 Escherichia coli strain CFS3273 plasmid pCFS3273-2, complete sequence 19220-19251 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MK461931 Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence 248303-248334 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MK878894 Escherichia coli strain J53 plasmid pMG334, complete sequence 46453-46484 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MK416183 Escherichia coli strain Ec-2Lar plasmid unnamed, complete sequence 20776-20807 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MN101850 Escherichia coli strain 13ZX28 plasmid p13ZX28-272, complete sequence 28169-28200 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MN101853 Escherichia coli strain 13ZX36 plasmid p13ZX36-200, complete sequence 28169-28200 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MN241904 Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM62, complete sequence 38768-38799 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_019888 Klebsiella pneumoniae strain BK31551 plasmid pBK31551, complete sequence 21354-21385 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH909339 Klebsiella pneumoniae strain 24632 plasmid p24632-IMP, complete sequence 24301-24332 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH909337 Klebsiella pneumoniae strain 20389 plasmid p20389-IMP, complete sequence 24375-24406 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH909334 Klebsiella pneumoniae strain 13-sp plasmid p13SP-IMP, complete sequence 25006-25037 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH909336 Klebsiella pneumoniae strain 201311334 plasmid p11334-IMP, complete sequence 4866-4897 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH909328 Klebsiella pneumoniae strain D920 plasmid pD920-IMP, complete sequence 16968-16999 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH917123 Klebsiella pneumoniae strain Kp735 plasmid pSZN_KPC, complete sequence 26273-26304 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MK036890 Klebsiella pneumoniae strain D610 plasmid pD610-1IMP, complete sequence 10601-10632 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH287085 Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence 258708-258739 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH917284 Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence 43364-43395 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH287084 Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence 245499-245530 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH011352 Klebsiella pneumoniae strain 185 plasmid pNDM-185, complete sequence 28205-28236 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH476540 Klebsiella pneumoniae strain KP1276 plasmid pIA/C-KLUC, complete sequence 53140-53171 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MK356561 Escherichia coli strain J53 plasmid pSa1423TC-59K, complete sequence 41110-41141 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MK862125 Enterobacter hormaechei strain 1-RC-17-04408-5 plasmid P04408-5-KPC40, complete sequence 21774-21805 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 MT199177 Escherichia coli strain 100 plasmid p100_NDM5_IncN, complete sequence 69478-69509 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MG886286 Escherichia coli strain ECSIC9 plasmid pECSIC9, complete sequence 29327-29358 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH001166 Escherichia coli strain TAEC1 plasmid pNDM-TAEC1, complete sequence 28205-28236 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MF150121 Klebsiella pneumoniae strain A64477 plasmid pKP64477c, complete sequence 104182-104213 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MF150123 Klebsiella pneumoniae strain A64216 plasmid pKP64216b, complete sequence 103123-103154 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MF344572 Enterobacter hormaechei strain 24845 plasmid p24845-Ct2, complete sequence 28205-28236 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MG764554 Enterobacter cloacae strain 30860 plasmid p30860-tetA, complete sequence 70594-70625 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH536949 Citrobacter freundii strain AA535 plasmid pIBACIncN, complete sequence 12885-12916 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH401970 Enterobacter hormaechei subsp. steigerwaltii strain MED plasmid unnamed, complete sequence 28564-28595 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH727565 Citrobacter freundii strain ECL-14-57 plasmid pIMP-ECL14-57, complete sequence 28780-28811 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MG878866 Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence 107296-107327 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH763829 Citrobacter freundii strain JY-17 plasmid pCFJY-17, complete sequence 28205-28236 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH892479 Citrobacter freundii strain 2262 plasmid pNDM-2262, complete sequence 28205-28236 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MH844629 Escherichia coli strain 2248 plasmid pNDM-2248, complete sequence 28205-28236 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP030132 Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence 64066-64097 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KY271413 Klebsiella pneumoniae strain KL49 plasmid IncN_typeA, complete sequence 43436-43467 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_KY887596 Escherichia coli strain Ec158 plasmid pEc158, complete sequence 29343-29374 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MF344557 Klebsiella pneumoniae strain 10677 plasmid p10677-IMP, complete sequence 28780-28811 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MF953243 Klebsiella pneumoniae strain C5 plasmid pC5_41608, complete sequence 19219-19250 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MF072965 Citrobacter freundii strain P10159 plasmid pP10159-5, complete sequence 28204-28235 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MG288677 Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence 19316-19347 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MG764553 Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence 14729-14760 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MG764552 Klebsiella pneumoniae strain A1763 plasmid pA1763-Ct2, complete sequence 28169-28200 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MF150118 Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence 165506-165537 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MG904997 Escherichia coli strain 15OD0495 plasmid p15ODMR, complete sequence 18271-18302 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_MF627445 Vibrio parahaemolyticus strain Vb0499 plasmid pVb0499, complete sequence 149931-149962 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NC_023323 Escherichia coli ACN001 plasmid pACN001-A, complete sequence 35900-35931 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP029441 Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence 40616-40647 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP020059 Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence 53902-53933 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP017725 Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 strain SGSC 2518 isolate SARB61 plasmid pSARB26_02, complete sequence 46750-46781 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP054304 Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence 27620-27651 1 0.969
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP054305 Klebsiella pneumoniae strain MS14393 plasmid pMS14393B, complete sequence 38018-38049 1 0.969
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 151411-151442 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KX711879 Pseudomonas aeruginosa strain P378 plasmid P378-IMP, complete sequence 13080-13111 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KX928750 Klebsiella pneumoniae strain CRKP-1-KPC plasmid pCRKP-1-KPC, complete sequence 24457-24488 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KX881941 Klebsiella pneumoniae subsp. pneumoniae strain H154180724 plasmid pJF-WMKPCN1, complete sequence 43900-43931 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KX518744 Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence 66313-66344 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KX928751 Klebsiella pneumoniae strain CRKP-5-KPC plasmid pCRKP-5-KPC, complete sequence 32096-32127 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MF072962 Citrobacter freundii strain P10159 plasmid pP10159-2, complete sequence 13080-13111 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KY271415 Klebsiella pneumoniae strain H151400611 plasmid IncN_typeC, complete sequence 50337-50368 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KY271414 Klebsiella pneumoniae strain H151440672 plasmid IncN_typeB, complete sequence 42756-42787 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KY128483 Klebsiella oxytoca strain 97_38 plasmid pKm38_N, complete sequence 10590-10621 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP032197 Klebsiella pneumoniae strain AR_0097 plasmid unnamed3, complete sequence 32425-32456 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KT982614 Escherichia coli strain CRE1504 plasmid pIMP-HK1504, complete sequence 41985-42016 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KT982615 Escherichia coli strain CRE1505 plasmid pIMP-FS1505, complete sequence 41985-42016 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KX807610 Salmonella enterica subsp. enterica serovar Enteritidis strain CNM4839/03 plasmid pUO-SeVR1, complete sequence 23169-23200 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KX711880 Klebsiella pneumoniae strain 1220 plasmid p1220-IMP, complete sequence 8139-8170 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KT982618 Escherichia coli strain CRE1517 plasmid pIMP-GZ1517, complete sequence 39125-39156 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KU295131 Escherichia coli strain BK28009 plasmid pBK28009, complete sequence 25042-25073 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KY128484 Klebsiella michiganensis strain 97_58 plasmid pKm38_N, complete sequence 10887-10918 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KU051707 Escherichia coli strain CRE1502 plasmid pIMP-SZ1502, complete sequence 38898-38929 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KT982613 Klebsiella pneumoniae strain CRE 1496 plasmid pIMP1496, complete sequence 38526-38557 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KU886034 Klebsiella pneumoniae strain Kp1 plasmid pIMP-HZ1, complete sequence 39135-39166 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KU862632 Klebsiella pneumoniae strain CRE1495 plasmid pIMP-KP1495, complete sequence 39127-39158 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KU051710 Citrobacter freundii strain CRE1503 plasmid pIMP-FJ1503, complete sequence 38691-38722 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KT989598 Enterobacter cloacae strain CRE1506 plasmid pIMP-SH1506, complete sequence 42205-42236 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KM977631 Klebsiella pneumoniae strain CRE1495 plasmid pIMP-1495, complete sequence 35342-35373 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KM660724 Morganella morganii strain MRSN22709 plasmid pMR3-OXA181, complete sequence 9119-9150 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KU051708 Klebsiella pneumoniae strain CRE1501 plasmid pIMP-SZ1501, complete sequence 39005-39036 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KU051709 Escherichia coli strain CRE1058 plasmid pIMP-GZ1058, complete sequence 39136-39167 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KT982616 Escherichia coli strain CRE1509 plasmid pIMP-HK1509, complete sequence 41985-42016 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KU295134 Escherichia coli strain BK32602 plasmid pBK32602, complete sequence 10292-10323 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KJ440076 Escherichia coli strain CGMHLK75 plasmid pLK75, complete sequence 20707-20738 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KP345882 Escherichia coli strain BK32533 plasmid pBK32533, complete sequence 59194-59225 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_014368 Klebsiella pneumoniae plasmid pNL194, complete sequence 1373-1404 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_014231 Escherichia coli plasmid pKC394, complete sequence 16224-16255 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_020088 Klebsiella pneumoniae plasmid pK18An, complete sequence 7002-7033 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_020086 Escherichia coli plasmid pE66An, complete sequence 42079-42110 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 LT221037 Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence 49618-49649 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 LT221038 Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence 72004-72035 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 MK356560 Salmonella sp. strain Sa1423 plasmid pSa1423-50K, complete sequence 10405-10436 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP031259 Klebsiella quasipneumoniae strain L22 plasmid pL22-2, complete sequence 48365-48396 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_021660 Klebsiella pneumoniae FCF3SP plasmid pKPC_FCF/3SP, complete sequence 48914-48945 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_021664 Klebsiella pneumoniae FCF1305 plasmid pKPC_FCF13/05, complete sequence 47390-47421 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP028975 Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence 74892-74923 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP018441 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence 69130-69161 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP043048 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-2, complete sequence 7957-7988 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP028486 Escherichia coli strain E41-1 plasmid p3, complete sequence 6315-6346 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_007682 Escherichia coli plasmid pMUR050, complete sequence 28865-28896 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 CP026801 Shigella sonnei strain ATCC 29930 plasmid unnamed 5247-5278 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP043186 Escherichia coli O16:H48 strain PG20180171 plasmid pPG20180171.1-IncN, complete sequence 13031-13062 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP026053 Salmonella enterica strain FDAARGOS_70 plasmid unnamed1, complete sequence 33411-33442 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP018646 Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 plasmid pSE79-2359, complete sequence 23643-23674 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP023420 Klebsiella pneumoniae strain 1050 plasmid pKp1050-4, complete sequence 10962-10993 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 KY075659 Escherichia coli strain GD80 plasmid pGD80-2, complete sequence 84361-84392 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_009980 Salmonella enterica subsp. enterica serovar Dublin plasmid pMAK2, complete sequence 24687-24718 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP053728 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence 66665-66696 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MK878892 Escherichia coli strain J53 plasmid pMG333, complete sequence 74166-74197 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP026277 Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence 2111-2142 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP033394 Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence 102700-102731 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_LS998787 Escherichia coli isolate EC-TO75 plasmid 3, complete sequence 17187-17218 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KJ440075 Klebsiella pneumoniae strain CGMHLK78 plasmid pLK78, complete sequence 21556-21587 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 121292-121323 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 68828-68859 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP009881 Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence 10827-10858 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 MT077883 Escherichia coli plasmid p23, complete sequence 27858-27889 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 KX023260 Escherichia coli plasmid pSCE516-3, complete sequence 3973-4004 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP026169 Leclercia sp. LSNIH1 plasmid pKPC-79f0, complete sequence 47128-47159 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 CP052433 Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-2, complete sequence 13634-13665 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_LT838197 Escherichia coli isolate WI1 isolate plasmid pWI1-KPC3, complete sequence 43374-43405 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_LS992177 Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence 47951-47982 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_EU880929 Klebsiella pneumoniae strain INS23K plasmid pLJ1, complete sequence 24114-24145 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 LN610760 Citrobacter freundii plasmid pCF8698_KPC2, strain CF8698, complete sequence 48345-48376 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 JN102341 Uncultured bacterium plasmid pRSB201, complete sequence 22024-22055 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 JN102342 Uncultured bacterium plasmid pRSB203, complete sequence 13303-13334 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 JN102343 Uncultured bacterium plasmid pRSB205, complete sequence 7330-7361 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 JN102344 Uncultured bacterium plasmid pRSB206, complete sequence 7818-7849 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP028173 Salmonella enterica strain CFSAN064033 plasmid pGMI17-001_1, complete sequence 22954-22985 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP021730 Escherichia coli strain Combat11I9 plasmid pCombat11I9-4, complete sequence 29964-29995 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 30407-30438 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP036363 Klebsiella pneumoniae strain WCHKP2080 plasmid p1_095080, complete sequence 14603-14634 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_025019 Klebsiella pneumoniae subsp. ozaenae plasmid pKo6, complete sequence 15034-15065 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 CP009867 Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence 10826-10857 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP020527 Enterobacter cloacae strain 109 plasmid unnamed2, complete sequence 5674-5705 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP025039 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence 45292-45323 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP044159 Shigella flexneri strain AR-0423 plasmid pAR-0423-1, complete sequence 21982-22013 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP018693 Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence 67180-67211 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_015599 Escherichia coli IncN plasmid N3, complete sequence 28312-28343 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_021238 Klebsiella pneumoniae strain Kpn-1433 plasmid pKP1433, complete sequence 2439-2470 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 CP042643 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-5, complete sequence 12055-12086 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 MN891676 Klebsiella pneumoniae strain 24169 plasmid p24169-KPC, complete sequence 22942-22973 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 MN891682 Klebsiella pneumoniae strain 116753 plasmid p116753-KPC, complete sequence 117982-118013 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 CP052359 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-3, complete sequence 16439-16470 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 CP052446 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-3, complete sequence 14716-14747 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP040895 Leclercia adecarboxylata strain Z96-1 plasmid pIMP-Z96-1, complete sequence 56195-56226 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP014524 Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence 11258-11289 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_025186 Klebsiella pneumoniae subsp. pneumoniae strain OW16C2 plasmid pOW16C2, complete sequence 11155-11186 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP018815 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence 52969-53000 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP040178 Klebsiella pneumoniae strain 2e plasmid unnamed3, complete sequence 47165-47196 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP042617 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence 27975-28006 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP019006 Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_2, complete sequence 23981-24012 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 221102-221133 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_024974 Escherichia coli plasmid pL2-43, complete sequence 30403-30434 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 CP010513 Enterobacter cloacae strain colR/S plasmid, complete sequence 5845-5876 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP044187 Salmonella enterica subsp. enterica strain AR-0402 plasmid pAR-0402 9263-9294 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP027616 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence 53155-53186 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP035387 Enterobacter hormaechei strain S11_16 plasmid unnamed2, complete sequence 24226-24257 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP052872 Enterobacter cloacae strain 3849 plasmid p3846_IncN_VIM-1, complete sequence 2522-2553 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP012143 Shigella flexneri 4c strain 1205 plasmid 1205p3, complete sequence 31297-31328 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP018963 Escherichia coli strain Ecol_517 plasmid pEC517_KPC, complete sequence 43442-43473 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_019033 Escherichia coli plasmid pQNR2078, complete sequence 5329-5360 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_021622 Klebsiella pneumoniae plasmid pK45-67VIM complete sequence 25154-25185 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_025131 Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence 127188-127219 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP033359 Salmonella enterica subsp. enterica strain EQAS2016S1 plasmid pEQAS2016S1-1, complete sequence 30722-30753 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP018884 Klebsiella pneumoniae subsp. pneumoniae strain BR7 plasmid unnamed1, complete sequence 50306-50337 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP028958 Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence 25268-25299 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP039821 Klebsiella pneumoniae strain C2414 plasmid pC2414-3-NDM, complete sequence 10774-10805 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP047460 Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence 86754-86785 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP047466 Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence 28311-28342 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_025183 Escherichia coli strain ECN580 plasmid pECN580, complete sequence 14420-14451 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_003292 Salmonella enterica subsp. enterica serovar Typhimurium plasmid R46, complete sequence 2193-2224 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP018887 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence 81693-81724 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP032203 Escherichia coli strain AR_0086 plasmid unnamed2, complete sequence 760-791 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP040859 Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence 11302-11333 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_024967 Escherichia coli strain YD626E plasmid pYD626E, complete sequence 22882-22913 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP026180 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence 41141-41172 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_019098 Escherichia coli strain HHA45 plasmid pHHA45, complete sequence 7023-7054 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP010363 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence 73357-73388 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 KY940546 Klebsiella pneumoniae plasmid pUCLA3, complete sequence 13146-13177 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_019082 Escherichia coli plasmid pZS50, complete sequence 23908-23939 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP046118 Enterobacter cloacae strain CBG15936 plasmid pNDM1-CBG, complete sequence 11372-11403 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 KF534788 Escherichia coli plasmid pNDM-BTR, complete sequence 9996-10027 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP009862 Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence 10827-10858 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_014208 Klebsiella oxytoca KOX105 plasmid pKOX105, complete sequence 4460-4491 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_023909 Escherichia coli strain EcNDM1 plasmid pEcNDM1, complete sequence 23676-23707 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_023910 Escherichia coli strain EcNDM0 plasmid pEcNDM0, complete sequence 18864-18895 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP009864 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence 10827-10858 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP009773 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pKPC-63d, complete sequence 62865-62896 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP009874 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence 16800-16831 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP009776 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPC-def, complete sequence 59188-59219 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP006926 Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N2, complete sequence 59195-59226 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_LT985266 Escherichia coli strain 177 plasmid RCS53_p, complete sequence 18338-18369 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP040696 Citrobacter freundii strain R47 plasmid pR47-309, complete sequence 87071-87102 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_025141 Escherichia coli plasmid pH1038-142, complete sequence 21247-21278 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP009853 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pKPC-860, complete sequence 10827-10858 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP042533 Klebsiella aerogenes strain C9 plasmid pC9_003, complete sequence 18088-18119 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP018977 Escherichia coli strain Ecol_656 plasmid pEC656_KPC, complete sequence 43438-43469 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP011589 Enterobacter asburiae strain CAV1043 plasmid pKPC_CAV1043, complete sequence 11371-11402 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP024144 Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence 61324-61355 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP026389 Leclercia sp. LSNIH3 plasmid pKPC-3714, complete sequence 47621-47652 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP008901 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pKPC-47e, complete sequence 10827-10858 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_019124 Salmonella enterica subsp. enterica serovar Virchow plasmid pVQS1, complete sequence 30851-30882 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP025965 Klebsiella pneumoniae strain WCHKP34 plasmid pNDM1_LL34, complete sequence 11367-11398 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP020066 Klebsiella pneumoniae strain AR_0117 plasmid unitig_5, complete sequence 36195-36226 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP022157 Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence 17360-17391 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP029436 Klebsiella quasipneumoniae strain CAV2013 plasmid pKPC_CAV2013, complete sequence 403432-403463 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP029431 Klebsiella quasipneumoniae strain CAV2018 plasmid pKPC_CAV2018-435, complete sequence 76164-76195 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP015387 Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence 127180-127211 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP015389 Klebsiella pneumoniae strain NY9 plasmid pNY9_4, complete sequence 26212-26243 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 MN178639 Kluyvera cryocrescens strain SCW13 plasmid pSCW13-1, complete sequence 18999-19030 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP025233 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 plasmid pSNE1-1925, complete sequence 7818-7849 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 CP050160 Escherichia coli plasmid Carbapenemase(IMP-4)_IncN, complete sequence 14407-14438 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP050859 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-NDM, complete sequence 11367-11398 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_014385 Escherichia coli plasmid pEC_L46, complete sequence 89748-89779 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP025758 Citrobacter freundii complex sp. CFNIH12 strain CFNIH2 plasmid pKPC-349c, complete sequence 10827-10858 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP024130 Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence 43316-43347 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 CP050159 Enterobacter cloacae plasmid Carbapenemase(IMP-26)_IncN, complete sequence 15172-15203 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_019087 Escherichia coli O25b:H4-ST131 str. EC958 plasmid pKC396, complete sequence 7250-7281 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP018945 Escherichia coli strain Ecol_224 plasmid pEC224_KPC, complete sequence 48811-48842 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP018959 Escherichia coli strain Ecol_422 plasmid pEC422_KPC, complete sequence 23112-23143 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP019026 Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence 56122-56153 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 MH061383 Pseudomonas aeruginosa plasmid pP6qnrS1, complete sequence 47005-47036 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP026213 Citrobacter sp. CFNIH10 plasmid pKPC-933d, complete sequence 152437-152468 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP042589 Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence 31898-31929 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP045022 Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-KPC14, complete sequence 9813-9844 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 AP022367 Escherichia coli E317 plasmid pE317_IMP6 DNA, complete sequence 76470-76501 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 AP022370 Klebsiella pneumoniae E328 plasmid pE328_IMP6 DNA, complete sequence 70784-70815 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP027050 Klebsiella pneumoniae strain 20_GR_12 plasmid IncN, complete sequence 34213-34244 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP021899 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_4_pilon, complete sequence 45900-45931 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP028582 Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence 22471-22502 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP025710 Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence 11371-11402 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP026198 Enterobacteriaceae bacterium ENNIH3 plasmid pKPC-c606, complete sequence 119770-119801 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP030335 Escherichia coli strain AR_451 plasmid unnamed1, complete sequence 19095-19126 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP036368 Klebsiella pneumoniae strain WCHKP115068 plasmid p1_115068, complete sequence 20291-20322 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 MN816373 Escherichia coli strain A127 plasmid pA127-X1, complete sequence 31898-31929 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_009132 Escherichia coli plasmid pLEW517, complete sequence 42694-42725 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP013215 Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence 216534-216565 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP031109 Escherichia coli strain AMSCJX02 plasmid pAMSC4, complete sequence 5666-5697 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP033830 Serratia sp. FDAARGOS_506 plasmid unnamed, complete sequence 22565-22596 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_011383 Klebsiella pneumoniae plasmid 9, complete sequence 65825-65856 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_011385 Klebsiella pneumoniae plasmid 12, complete sequence 71665-71696 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 LN879484 Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSEN-BT, strain D7795 71296-71327 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP042581 Enterobacter kobei strain C16 plasmid pC16_003, complete sequence 18651-18682 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP020119 Escherichia coli strain AR_0104 plasmid unitig_7, complete sequence 49913-49944 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 KC170280 Uncultured bacterium plasmid pDS2, complete sequence 38096-38127 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP043224 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.2-IncN, complete sequence 12846-12877 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP026496 Klebsiella pneumoniae strain 616 plasmid pKp616_1, complete sequence 19450-19481 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP041629 Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence 18387-18418 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 AP022354 Escherichia coli E033 plasmid pE033_IMP6 DNA, complete sequence 38202-38233 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 AP022355 Escherichia coli E034 plasmid pE034_IMP6 DNA, complete sequence 74617-74648 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 AP022356 Escherichia coli E119 plasmid pE119_5kIMP6 DNA, complete sequence 14607-14638 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 AP022357 Escherichia coli E119 plasmid pE119_6kIMP6 DNA, complete sequence 19554-19585 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 AP022358 Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence 26892-26923 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 AP022359 Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence 100499-100530 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP049193 Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence 209083-209114 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 CP052352 Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-1, complete sequence 144259-144290 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_011617 Klebsiella pneumoniae plasmid pKP96, complete sequence 33037-33068 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP043184 Escherichia coli O16:H48 strain PG20180172 plasmid pPG20180172.1-IncN, complete sequence 13030-13061 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP043188 Escherichia coli O16:H48 strain PG20180170 plasmid pPG20180170.1-IncN, complete sequence 13031-13062 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 AP022349 Klebsiella pneumoniae E105 plasmid pKPI-1 DNA, complete sequence 14049-14080 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 AP022350 Escherichia coli E109 plasmid pE109_IMP6 DNA, complete sequence 13938-13969 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP049189 Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence 21696-21727 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 LC520276 Escherichia coli F0090 plasmid pF0090 DNA, complete sequence 6488-6519 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_022374 Escherichia coli plasmid pHKU1, complete sequence 19560-19591 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP041444 Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence 35568-35599 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_AP018362 Escherichia coli strain A56-1S plasmid pA56-1S, complete sequence 17071-17102 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_AP019550 Klebsiella pneumoniae strain THC11 plasmid pTHC11-2, complete sequence 15402-15433 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_AP018363 Escherichia coli strain A56-1R plasmid pA56-1R, complete sequence 40979-41010 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 CP052394 Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-2, complete sequence 22067-22098 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_AP019403 Klebsiella pneumoniae strain E129 plasmid pE129_IMP6, complete sequence 14795-14826 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_AP019402 Klebsiella pneumoniae strain E013 plasmid pE013_IMP6, complete sequence 14795-14826 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_AP019404 Klebsiella pneumoniae strain E188 plasmid pE188_IMP6, complete sequence 16135-16166 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 63873-63904 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP018649 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-1, complete sequence 46993-47024 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP021734 Escherichia coli strain AR_0114 plasmid unitig_2, complete sequence 59058-59089 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP026590 Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence 20213-20244 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP021778 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_3, complete sequence 34821-34852 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 MN937241 Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence 167146-167177 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP023981 Klebsiella variicola strain X39 plasmid pX39-4, complete sequence 43698-43729 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_LR745047 Klebsiella pneumoniae isolate Kpn2166 plasmid pCTX-M15_Kpn2166 39870-39901 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP018643 Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence 77243-77274 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_LT985259 Escherichia coli strain 592 plasmid RCS44_p, complete sequence 30221-30252 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_LT985245 Escherichia coli strain 523 plasmid RCS42_p, complete sequence 30159-30190 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_LT985242 Escherichia coli strain 604 plasmid RCS43_p, complete sequence 32297-32328 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_LT985251 Escherichia coli strain 502 plasmid RCS45_p, complete sequence 30217-30248 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MK656937 Escherichia coli strain T3 plasmid pT3, complete sequence 40319-40350 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MK878894 Escherichia coli strain J53 plasmid pMG334, complete sequence 35269-35300 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MN241904 Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM62, complete sequence 27584-27615 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_019888 Klebsiella pneumoniae strain BK31551 plasmid pBK31551, complete sequence 10170-10201 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MH829594 Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence 229878-229909 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MH909344 Enterobacter cloacae strain 12949 plasmid p12949-FIIY, complete sequence 148129-148160 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MH909339 Klebsiella pneumoniae strain 24632 plasmid p24632-IMP, complete sequence 13117-13148 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MH909337 Klebsiella pneumoniae strain 20389 plasmid p20389-IMP, complete sequence 13191-13222 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MH909334 Klebsiella pneumoniae strain 13-sp plasmid p13SP-IMP, complete sequence 13822-13853 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MH909336 Klebsiella pneumoniae strain 201311334 plasmid p11334-IMP, complete sequence 16050-16081 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MH909328 Klebsiella pneumoniae strain D920 plasmid pD920-IMP, complete sequence 28151-28182 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MH917123 Klebsiella pneumoniae strain Kp735 plasmid pSZN_KPC, complete sequence 15089-15120 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MK036890 Klebsiella pneumoniae strain D610 plasmid pD610-1IMP, complete sequence 55494-55525 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MK036889 Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence 156272-156303 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MK356561 Escherichia coli strain J53 plasmid pSa1423TC-59K, complete sequence 23343-23374 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MK862125 Enterobacter hormaechei strain 1-RC-17-04408-5 plasmid P04408-5-KPC40, complete sequence 10590-10621 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 MT199177 Escherichia coli strain 100 plasmid p100_NDM5_IncN, complete sequence 80661-80692 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MG886286 Escherichia coli strain ECSIC9 plasmid pECSIC9, complete sequence 40515-40546 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MF398271 Klebsiella pneumoniae subsp. pneumoniae strain 70-2 plasmid pKP70-2, complete sequence 93368-93399 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MF474175 Escherichia coli strain J53/pNIT-HK plasmid pNIT-HK, complete sequence 15532-15563 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MF344559 Enterobacter hormaechei strain 128379 plasmid p128379-IMP, complete sequence 29852-29883 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MH536949 Citrobacter freundii strain AA535 plasmid pIBACIncN, complete sequence 1697-1728 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MH401970 Enterobacter hormaechei subsp. steigerwaltii strain MED plasmid unnamed, complete sequence 39748-39779 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MH399264 Enterobacter cloacae strain RJ702 plasmid pIMP26, complete sequence 307794-307825 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MH727565 Citrobacter freundii strain ECL-14-57 plasmid pIMP-ECL14-57, complete sequence 39964-39995 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MG878866 Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence 96112-96143 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP049047 Enterobacter hormaechei strain Y233 plasmid pIHI2-233, complete sequence 59955-59986 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KY271413 Klebsiella pneumoniae strain KL49 plasmid IncN_typeA, complete sequence 32252-32283 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MF344557 Klebsiella pneumoniae strain 10677 plasmid p10677-IMP, complete sequence 39964-39995 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MF953243 Klebsiella pneumoniae strain C5 plasmid pC5_41608, complete sequence 30402-30433 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MG288677 Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence 8133-8164 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_KY978628 Cronobacter sakazakii strain 505108 plasmid p505108-MDR, complete sequence 133375-133406 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MG764553 Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence 25913-25944 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_MG904997 Escherichia coli strain 15OD0495 plasmid p15ODMR, complete sequence 29454-29485 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NC_023323 Escherichia coli ACN001 plasmid pACN001-A, complete sequence 47083-47114 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP029442 Klebsiella quasipneumoniae strain CAV1947 plasmid pKPC_CAV1947-412, complete sequence 48191-48222 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP020059 Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence 65086-65117 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP017725 Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 strain SGSC 2518 isolate SARB61 plasmid pSARB26_02, complete sequence 35567-35598 2 0.938
NC_020260_12 12.1|2847227|31|NC_020260|CRT 2847227-2847257 31 HQ201308 Cronobacter phage ENT47670, complete genome 11173-11203 2 0.935
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX711879 Pseudomonas aeruginosa strain P378 plasmid P378-IMP, complete sequence 43355-43386 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX928750 Klebsiella pneumoniae strain CRKP-1-KPC plasmid pCRKP-1-KPC, complete sequence 59479-59510 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF072962 Citrobacter freundii strain P10159 plasmid pP10159-2, complete sequence 44488-44519 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY271415 Klebsiella pneumoniae strain H151400611 plasmid IncN_typeC, complete sequence 15325-15356 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY271414 Klebsiella pneumoniae strain H151440672 plasmid IncN_typeB, complete sequence 7726-7757 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY128483 Klebsiella oxytoca strain 97_38 plasmid pKm38_N, complete sequence 62073-62104 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982614 Escherichia coli strain CRE1504 plasmid pIMP-HK1504, complete sequence 7380-7411 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982615 Escherichia coli strain CRE1505 plasmid pIMP-FS1505, complete sequence 7380-7411 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX711880 Klebsiella pneumoniae strain 1220 plasmid p1220-IMP, complete sequence 38778-38809 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982618 Escherichia coli strain CRE1517 plasmid pIMP-GZ1517, complete sequence 7380-7411 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU295131 Escherichia coli strain BK28009 plasmid pBK28009, complete sequence 101070-101101 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY128484 Klebsiella michiganensis strain 97_58 plasmid pKm38_N, complete sequence 63198-63229 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051707 Escherichia coli strain CRE1502 plasmid pIMP-SZ1502, complete sequence 7380-7411 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982613 Klebsiella pneumoniae strain CRE 1496 plasmid pIMP1496, complete sequence 7380-7411 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU886034 Klebsiella pneumoniae strain Kp1 plasmid pIMP-HZ1, complete sequence 7379-7410 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU862632 Klebsiella pneumoniae strain CRE1495 plasmid pIMP-KP1495, complete sequence 7377-7408 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051710 Citrobacter freundii strain CRE1503 plasmid pIMP-FJ1503, complete sequence 7380-7411 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT989598 Enterobacter cloacae strain CRE1506 plasmid pIMP-SH1506, complete sequence 7380-7411 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KM977631 Klebsiella pneumoniae strain CRE1495 plasmid pIMP-1495, complete sequence 7380-7411 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KM660724 Morganella morganii strain MRSN22709 plasmid pMR3-OXA181, complete sequence 50119-50150 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051708 Klebsiella pneumoniae strain CRE1501 plasmid pIMP-SZ1501, complete sequence 7379-7410 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051709 Escherichia coli strain CRE1058 plasmid pIMP-GZ1058, complete sequence 7380-7411 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982616 Escherichia coli strain CRE1509 plasmid pIMP-HK1509, complete sequence 7380-7411 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU295134 Escherichia coli strain BK32602 plasmid pBK32602, complete sequence 81292-81323 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KJ440076 Escherichia coli strain CGMHLK75 plasmid pLK75, complete sequence 49799-49830 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_014231 Escherichia coli plasmid pKC394, complete sequence 46019-46050 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_014231 Escherichia coli plasmid pKC394, complete sequence 47229-47260 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_014231 Escherichia coli plasmid pKC394, complete sequence 46802-46833 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 LT221037 Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence 7380-7411 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 LT221038 Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence 31276-31307 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MK356560 Salmonella sp. strain Sa1423 plasmid pSa1423-50K, complete sequence 42102-42133 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MK356560 Salmonella sp. strain Sa1423 plasmid pSa1423-50K, complete sequence 43312-43343 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MK356560 Salmonella sp. strain Sa1423 plasmid pSa1423-50K, complete sequence 42885-42916 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP031259 Klebsiella quasipneumoniae strain L22 plasmid pL22-2, complete sequence 22336-22367 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP048785 Serratia liquefaciens strain S1 plasmid pSl1, complete sequence 16234-16265 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP048785 Serratia liquefaciens strain S1 plasmid pSl1, complete sequence 17444-17475 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP048785 Serratia liquefaciens strain S1 plasmid pSl1, complete sequence 17017-17048 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_021660 Klebsiella pneumoniae FCF3SP plasmid pKPC_FCF/3SP, complete sequence 12852-12883 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028486 Escherichia coli strain E41-1 plasmid p3, complete sequence 27423-27454 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043186 Escherichia coli O16:H48 strain PG20180171 plasmid pPG20180171.1-IncN, complete sequence 35413-35444 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043186 Escherichia coli O16:H48 strain PG20180171 plasmid pPG20180171.1-IncN, complete sequence 36622-36653 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043186 Escherichia coli O16:H48 strain PG20180171 plasmid pPG20180171.1-IncN, complete sequence 36195-36226 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026053 Salmonella enterica strain FDAARGOS_70 plasmid unnamed1, complete sequence 635-666 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026053 Salmonella enterica strain FDAARGOS_70 plasmid unnamed1, complete sequence 47218-47249 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026053 Salmonella enterica strain FDAARGOS_70 plasmid unnamed1, complete sequence 47645-47676 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018646 Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 plasmid pSE79-2359, complete sequence 44246-44277 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018646 Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 plasmid pSE79-2359, complete sequence 45456-45487 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018646 Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 plasmid pSE79-2359, complete sequence 44673-44704 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP023420 Klebsiella pneumoniae strain 1050 plasmid pKp1050-4, complete sequence 58250-58281 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK878892 Escherichia coli strain J53 plasmid pMG333, complete sequence 102289-102320 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026277 Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence 20172-20203 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP033394 Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence 135517-135548 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LS998788 Escherichia coli isolate EC-TO75 plasmid 4, complete sequence 7540-7571 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KJ440075 Klebsiella pneumoniae strain CGMHLK78 plasmid pLK78, complete sequence 49362-49393 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026236 Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence 32100-32131 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 54149-54180 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 55359-55390 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 54932-54963 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009881 Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence 43099-43130 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026169 Leclercia sp. LSNIH1 plasmid pKPC-79f0, complete sequence 28583-28614 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052433 Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-2, complete sequence 45240-45271 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT838197 Escherichia coli isolate WI1 isolate plasmid pWI1-KPC3, complete sequence 7380-7411 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LS992177 Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence 20145-20176 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LS992177 Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence 69453-69484 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 LN610760 Citrobacter freundii plasmid pCF8698_KPC2, strain CF8698, complete sequence 12338-12369 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102341 Uncultured bacterium plasmid pRSB201, complete sequence 44356-44387 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102341 Uncultured bacterium plasmid pRSB201, complete sequence 45566-45597 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102341 Uncultured bacterium plasmid pRSB201, complete sequence 45139-45170 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102342 Uncultured bacterium plasmid pRSB203, complete sequence 35687-35718 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102342 Uncultured bacterium plasmid pRSB203, complete sequence 36908-36939 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102342 Uncultured bacterium plasmid pRSB203, complete sequence 36481-36512 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102343 Uncultured bacterium plasmid pRSB205, complete sequence 41937-41968 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102343 Uncultured bacterium plasmid pRSB205, complete sequence 41510-41541 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102344 Uncultured bacterium plasmid pRSB206, complete sequence 45631-45662 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102344 Uncultured bacterium plasmid pRSB206, complete sequence 46841-46872 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102344 Uncultured bacterium plasmid pRSB206, complete sequence 46414-46445 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028173 Salmonella enterica strain CFSAN064033 plasmid pGMI17-001_1, complete sequence 36666-36697 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028173 Salmonella enterica strain CFSAN064033 plasmid pGMI17-001_1, complete sequence 37876-37907 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028173 Salmonella enterica strain CFSAN064033 plasmid pGMI17-001_1, complete sequence 37093-37124 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP021730 Escherichia coli strain Combat11I9 plasmid pCombat11I9-4, complete sequence 15378-15409 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP021730 Escherichia coli strain Combat11I9 plasmid pCombat11I9-4, complete sequence 16588-16619 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP021730 Escherichia coli strain Combat11I9 plasmid pCombat11I9-4, complete sequence 16161-16192 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP036363 Klebsiella pneumoniae strain WCHKP2080 plasmid p1_095080, complete sequence 47420-47451 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_025019 Klebsiella pneumoniae subsp. ozaenae plasmid pKo6, complete sequence 58859-58890 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP009867 Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence 46766-46797 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020527 Enterobacter cloacae strain 109 plasmid unnamed2, complete sequence 58530-58561 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP044159 Shigella flexneri strain AR-0423 plasmid pAR-0423-1, complete sequence 54135-54166 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP042643 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-5, complete sequence 34459-34490 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP042643 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-5, complete sequence 35671-35702 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP042643 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-5, complete sequence 35244-35275 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN891676 Klebsiella pneumoniae strain 24169 plasmid p24169-KPC, complete sequence 40971-41002 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052359 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-3, complete sequence 44300-44331 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052446 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-3, complete sequence 42589-42620 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP040895 Leclercia adecarboxylata strain Z96-1 plasmid pIMP-Z96-1, complete sequence 87945-87976 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP014524 Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence 42739-42770 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP040178 Klebsiella pneumoniae strain 2e plasmid unnamed3, complete sequence 29104-29135 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 3508-3539 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_024974 Escherichia coli plasmid pL2-43, complete sequence 6808-6839 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_024974 Escherichia coli plasmid pL2-43, complete sequence 8018-8049 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_024974 Escherichia coli plasmid pL2-43, complete sequence 7235-7266 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP044187 Salmonella enterica subsp. enterica strain AR-0402 plasmid pAR-0402 55009-55040 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026757 Klebsiella aerogenes strain AR_0062 plasmid tig00000053_pilon, complete sequence 30994-31025 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP035387 Enterobacter hormaechei strain S11_16 plasmid unnamed2, complete sequence 56679-56710 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP012143 Shigella flexneri 4c strain 1205 plasmid 1205p3, complete sequence 7729-7760 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP012143 Shigella flexneri 4c strain 1205 plasmid 1205p3, complete sequence 8937-8968 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP012143 Shigella flexneri 4c strain 1205 plasmid 1205p3, complete sequence 8156-8187 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018963 Escherichia coli strain Ecol_517 plasmid pEC517_KPC, complete sequence 7380-7411 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019033 Escherichia coli plasmid pQNR2078, complete sequence 33122-33153 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019033 Escherichia coli plasmid pQNR2078, complete sequence 34332-34363 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019033 Escherichia coli plasmid pQNR2078, complete sequence 33905-33936 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP033359 Salmonella enterica subsp. enterica strain EQAS2016S1 plasmid pEQAS2016S1-1, complete sequence 15841-15872 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP033359 Salmonella enterica subsp. enterica strain EQAS2016S1 plasmid pEQAS2016S1-1, complete sequence 17051-17082 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP033359 Salmonella enterica subsp. enterica strain EQAS2016S1 plasmid pEQAS2016S1-1, complete sequence 16624-16655 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028958 Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence 4791-4822 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP039821 Klebsiella pneumoniae strain C2414 plasmid pC2414-3-NDM, complete sequence 56356-56387 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP018758 Metakosakonia sp. MRY16-398 plasmid pMRY16-398_2, complete sequence 39322-39353 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_025183 Escherichia coli strain ECN580 plasmid pECN580, complete sequence 58245-58276 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_003292 Salmonella enterica subsp. enterica serovar Typhimurium plasmid R46, complete sequence 24568-24599 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_003292 Salmonella enterica subsp. enterica serovar Typhimurium plasmid R46, complete sequence 25778-25809 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_003292 Salmonella enterica subsp. enterica serovar Typhimurium plasmid R46, complete sequence 25351-25382 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018887 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence 7089-7120 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018887 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence 117755-117786 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP032203 Escherichia coli strain AR_0086 plasmid unnamed2, complete sequence 15766-15797 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP040859 Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence 29363-29394 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 52679-52710 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019098 Escherichia coli strain HHA45 plasmid pHHA45, complete sequence 29395-29426 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019098 Escherichia coli strain HHA45 plasmid pHHA45, complete sequence 30605-30636 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019098 Escherichia coli strain HHA45 plasmid pHHA45, complete sequence 30178-30209 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP046118 Enterobacter cloacae strain CBG15936 plasmid pNDM1-CBG, complete sequence 55973-56004 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 KF534788 Escherichia coli plasmid pNDM-BTR, complete sequence 52710-52741 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009862 Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence 72952-72983 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_023909 Escherichia coli strain EcNDM1 plasmid pEcNDM1, complete sequence 51538-51569 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_023910 Escherichia coli strain EcNDM0 plasmid pEcNDM0, complete sequence 46726-46757 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009864 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence 55424-55455 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009874 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence 42818-42849 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985266 Escherichia coli strain 177 plasmid RCS53_p, complete sequence 36398-36429 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_025141 Escherichia coli plasmid pH1038-142, complete sequence 43632-43663 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_025141 Escherichia coli plasmid pH1038-142, complete sequence 44842-44873 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_025141 Escherichia coli plasmid pH1038-142, complete sequence 44415-44446 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009853 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pKPC-860, complete sequence 49323-49354 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP042533 Klebsiella aerogenes strain C9 plasmid pC9_003, complete sequence 44097-44128 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018977 Escherichia coli strain Ecol_656 plasmid pEC656_KPC, complete sequence 7380-7411 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP011589 Enterobacter asburiae strain CAV1043 plasmid pKPC_CAV1043, complete sequence 52448-52479 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026389 Leclercia sp. LSNIH3 plasmid pKPC-3714, complete sequence 29560-29591 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP008901 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pKPC-47e, complete sequence 43099-43130 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019124 Salmonella enterica subsp. enterica serovar Virchow plasmid pVQS1, complete sequence 7268-7299 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019124 Salmonella enterica subsp. enterica serovar Virchow plasmid pVQS1, complete sequence 8478-8509 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019124 Salmonella enterica subsp. enterica serovar Virchow plasmid pVQS1, complete sequence 7695-7726 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025965 Klebsiella pneumoniae strain WCHKP34 plasmid pNDM1_LL34, complete sequence 53040-53071 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020066 Klebsiella pneumoniae strain AR_0117 plasmid unitig_5, complete sequence 18134-18165 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP022157 Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence 50999-51030 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP022157 Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence 52208-52239 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP022157 Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence 51426-51457 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP015389 Klebsiella pneumoniae strain NY9 plasmid pNY9_4, complete sequence 46611-46642 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN178639 Kluyvera cryocrescens strain SCW13 plasmid pSCW13-1, complete sequence 1905-1936 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP038278 Raoultella ornithinolytica strain WLK218 plasmid pWLK-IncN, complete sequence 34231-34262 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025233 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 plasmid pSNE1-1925, complete sequence 53408-53439 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025233 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 plasmid pSNE1-1925, complete sequence 54618-54649 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025233 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 plasmid pSNE1-1925, complete sequence 54191-54222 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP050160 Escherichia coli plasmid Carbapenemase(IMP-4)_IncN, complete sequence 53384-53415 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP050859 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-NDM, complete sequence 53078-53109 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025758 Citrobacter freundii complex sp. CFNIH12 strain CFNIH2 plasmid pKPC-349c, complete sequence 55423-55454 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP050159 Enterobacter cloacae plasmid Carbapenemase(IMP-26)_IncN, complete sequence 50090-50121 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019087 Escherichia coli O25b:H4-ST131 str. EC958 plasmid pKC396, complete sequence 35702-35733 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019087 Escherichia coli O25b:H4-ST131 str. EC958 plasmid pKC396, complete sequence 37043-37074 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019087 Escherichia coli O25b:H4-ST131 str. EC958 plasmid pKC396, complete sequence 38253-38284 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019087 Escherichia coli O25b:H4-ST131 str. EC958 plasmid pKC396, complete sequence 37826-37857 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018945 Escherichia coli strain Ecol_224 plasmid pEC224_KPC, complete sequence 15449-15480 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP019026 Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence 24290-24321 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026211 Citrobacter sp. CFNIH10 plasmid pCIT-eb1a, complete sequence 49365-49396 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022367 Escherichia coli E317 plasmid pE317_IMP6 DNA, complete sequence 48618-48649 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP027050 Klebsiella pneumoniae strain 20_GR_12 plasmid IncN, complete sequence 19217-19248 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP027050 Klebsiella pneumoniae strain 20_GR_12 plasmid IncN, complete sequence 20427-20458 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP027050 Klebsiella pneumoniae strain 20_GR_12 plasmid IncN, complete sequence 20000-20031 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028579 Klebsiella pneumoniae strain WCHKP36 plasmid p1_020036, complete sequence 12337-12368 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025710 Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence 63682-63713 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026198 Enterobacteriaceae bacterium ENNIH3 plasmid pKPC-c606, complete sequence 105085-105116 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP030335 Escherichia coli strain AR_451 plasmid unnamed1, complete sequence 37156-37187 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP036368 Klebsiella pneumoniae strain WCHKP115068 plasmid p1_115068, complete sequence 53108-53139 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP052879 Escherichia coli strain C21 plasmid pC21-2, complete sequence 15306-15337 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP052879 Escherichia coli strain C21 plasmid pC21-2, complete sequence 16516-16547 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP052879 Escherichia coli strain C21 plasmid pC21-2, complete sequence 16089-16120 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025984 Enterobacteriaceae bacterium A-F18 plasmid pAF18_2, complete sequence 7517-7548 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP031109 Escherichia coli strain AMSCJX02 plasmid pAMSC4, complete sequence 37941-37972 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP031109 Escherichia coli strain AMSCJX02 plasmid pAMSC4, complete sequence 39151-39182 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP031109 Escherichia coli strain AMSCJX02 plasmid pAMSC4, complete sequence 38724-38755 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP033830 Serratia sp. FDAARGOS_506 plasmid unnamed, complete sequence 40498-40529 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_011383 Klebsiella pneumoniae plasmid 9, complete sequence 39816-39847 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP042581 Enterobacter kobei strain C16 plasmid pC16_003, complete sequence 37940-37971 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020119 Escherichia coli strain AR_0104 plasmid unitig_7, complete sequence 33079-33110 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_022885 Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence 56896-56927 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 KC170280 Uncultured bacterium plasmid pDS2, complete sequence 7542-7573 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043224 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.2-IncN, complete sequence 35230-35261 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043224 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.2-IncN, complete sequence 36440-36471 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043224 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.2-IncN, complete sequence 36013-36044 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026496 Klebsiella pneumoniae strain 616 plasmid pKp616_1, complete sequence 51420-51451 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022354 Escherichia coli E033 plasmid pE033_IMP6 DNA, complete sequence 66064-66095 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022355 Escherichia coli E034 plasmid pE034_IMP6 DNA, complete sequence 102479-102510 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022356 Escherichia coli E119 plasmid pE119_5kIMP6 DNA, complete sequence 42469-42500 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022358 Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence 54754-54785 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022359 Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence 128361-128392 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_011617 Klebsiella pneumoniae plasmid pKP96, complete sequence 61160-61191 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043184 Escherichia coli O16:H48 strain PG20180172 plasmid pPG20180172.1-IncN, complete sequence 35415-35446 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043184 Escherichia coli O16:H48 strain PG20180172 plasmid pPG20180172.1-IncN, complete sequence 37159-37190 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043184 Escherichia coli O16:H48 strain PG20180172 plasmid pPG20180172.1-IncN, complete sequence 36732-36763 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043188 Escherichia coli O16:H48 strain PG20180170 plasmid pPG20180170.1-IncN, complete sequence 35417-35448 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043188 Escherichia coli O16:H48 strain PG20180170 plasmid pPG20180170.1-IncN, complete sequence 36628-36659 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043188 Escherichia coli O16:H48 strain PG20180170 plasmid pPG20180170.1-IncN, complete sequence 36201-36232 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022349 Klebsiella pneumoniae E105 plasmid pKPI-1 DNA, complete sequence 41911-41942 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_022374 Escherichia coli plasmid pHKU1, complete sequence 47683-47714 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP018362 Escherichia coli strain A56-1S plasmid pA56-1S, complete sequence 44933-44964 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019550 Klebsiella pneumoniae strain THC11 plasmid pTHC11-2, complete sequence 43264-43295 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP018363 Escherichia coli strain A56-1R plasmid pA56-1R, complete sequence 13117-13148 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052394 Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-2, complete sequence 49929-49960 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019403 Klebsiella pneumoniae strain E129 plasmid pE129_IMP6, complete sequence 42655-42686 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019402 Klebsiella pneumoniae strain E013 plasmid pE013_IMP6, complete sequence 42630-42661 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019404 Klebsiella pneumoniae strain E188 plasmid pE188_IMP6, complete sequence 43645-43676 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 40784-40815 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018649 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-1, complete sequence 25436-25467 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018649 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-1, complete sequence 26646-26677 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018649 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-1, complete sequence 26219-26250 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026590 Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence 1849-1880 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP023981 Klebsiella variicola strain X39 plasmid pX39-4, complete sequence 15957-15988 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LR745047 Klebsiella pneumoniae isolate Kpn2166 plasmid pCTX-M15_Kpn2166 70347-70378 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018643 Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence 115715-115746 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018643 Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence 116925-116956 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018643 Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence 116498-116529 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985259 Escherichia coli strain 592 plasmid RCS44_p, complete sequence 7862-7893 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985259 Escherichia coli strain 592 plasmid RCS44_p, complete sequence 7079-7110 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985245 Escherichia coli strain 523 plasmid RCS42_p, complete sequence 7862-7893 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985245 Escherichia coli strain 523 plasmid RCS42_p, complete sequence 7079-7110 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985242 Escherichia coli strain 604 plasmid RCS43_p, complete sequence 6654-6685 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985242 Escherichia coli strain 604 plasmid RCS43_p, complete sequence 7864-7895 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985242 Escherichia coli strain 604 plasmid RCS43_p, complete sequence 7081-7112 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985251 Escherichia coli strain 502 plasmid RCS45_p, complete sequence 6652-6683 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985251 Escherichia coli strain 502 plasmid RCS45_p, complete sequence 7862-7893 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985251 Escherichia coli strain 502 plasmid RCS45_p, complete sequence 7079-7110 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK878894 Escherichia coli strain J53 plasmid pMG334, complete sequence 3668-3699 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK416183 Escherichia coli strain Ec-2Lar plasmid unnamed, complete sequence 7382-7413 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MN241904 Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM62, complete sequence 55394-55425 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019888 Klebsiella pneumoniae strain BK31551 plasmid pBK31551, complete sequence 77022-77053 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909339 Klebsiella pneumoniae strain 24632 plasmid p24632-IMP, complete sequence 44703-44734 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909337 Klebsiella pneumoniae strain 20389 plasmid p20389-IMP, complete sequence 44947-44978 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909334 Klebsiella pneumoniae strain 13-sp plasmid p13SP-IMP, complete sequence 46929-46960 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909336 Klebsiella pneumoniae strain 201311334 plasmid p11334-IMP, complete sequence 44018-44049 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909328 Klebsiella pneumoniae strain D920 plasmid pD920-IMP, complete sequence 47052-47083 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH917123 Klebsiella pneumoniae strain Kp735 plasmid pSZN_KPC, complete sequence 57677-57708 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK036890 Klebsiella pneumoniae strain D610 plasmid pD610-1IMP, complete sequence 31173-31204 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH128095 Klebsiella pneumoniae strain CZPF1510086 plasmid pTBCZNDM02, complete sequence 13052-13083 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK862125 Enterobacter hormaechei strain 1-RC-17-04408-5 plasmid P04408-5-KPC40, complete sequence 48386-48417 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN657245 Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence 37233-37264 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN657245 Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence 38443-38474 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN657245 Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence 38016-38047 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN657246 Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence 42225-42256 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN657246 Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence 43435-43466 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN657246 Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence 43008-43039 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MT199177 Escherichia coli strain 100 plasmid p100_NDM5_IncN, complete sequence 57067-57098 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MT199177 Escherichia coli strain 100 plasmid p100_NDM5_IncN, complete sequence 58277-58308 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MT199177 Escherichia coli strain 100 plasmid p100_NDM5_IncN, complete sequence 57494-57525 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG886286 Escherichia coli strain ECSIC9 plasmid pECSIC9, complete sequence 7314-7345 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF474175 Escherichia coli strain J53/pNIT-HK plasmid pNIT-HK, complete sequence 28908-28939 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF474175 Escherichia coli strain J53/pNIT-HK plasmid pNIT-HK, complete sequence 30118-30149 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF474175 Escherichia coli strain J53/pNIT-HK plasmid pNIT-HK, complete sequence 29335-29366 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF344559 Enterobacter hormaechei strain 128379 plasmid p128379-IMP, complete sequence 7380-7411 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH727565 Citrobacter freundii strain ECL-14-57 plasmid pIMP-ECL14-57, complete sequence 7380-7411 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG878866 Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence 123968-123999 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY271413 Klebsiella pneumoniae strain KL49 plasmid IncN_typeA, complete sequence 1849-1880 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF344557 Klebsiella pneumoniae strain 10677 plasmid p10677-IMP, complete sequence 8208-8239 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF953243 Klebsiella pneumoniae strain C5 plasmid pC5_41608, complete sequence 6808-6839 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF953243 Klebsiella pneumoniae strain C5 plasmid pC5_41608, complete sequence 8018-8049 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF953243 Klebsiella pneumoniae strain C5 plasmid pC5_41608, complete sequence 7235-7266 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG288677 Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence 59465-59496 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG288677 Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence 60676-60707 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG288677 Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence 60249-60280 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG904997 Escherichia coli strain 15OD0495 plasmid p15ODMR, complete sequence 43129-43160 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020059 Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence 82068-82099 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP017725 Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 strain SGSC 2518 isolate SARB61 plasmid pSARB26_02, complete sequence 20534-20565 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP017725 Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 strain SGSC 2518 isolate SARB61 plasmid pSARB26_02, complete sequence 21744-21775 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP017725 Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 strain SGSC 2518 isolate SARB61 plasmid pSARB26_02, complete sequence 21317-21348 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_014368 Klebsiella pneumoniae plasmid pNL194, complete sequence 63996-64027 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_014368 Klebsiella pneumoniae plasmid pNL194, complete sequence 66177-66208 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MT077883 Escherichia coli plasmid p23, complete sequence 50281-50312 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MT077883 Escherichia coli plasmid p23, complete sequence 52460-52491 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_032101 Enterobacter cloacae plasmid pG6809-2, complete sequence 49259-49290 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_032101 Enterobacter cloacae plasmid pG6809-2, complete sequence 51437-51468 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX928751 Klebsiella pneumoniae strain CRKP-5-KPC plasmid pCRKP-5-KPC, complete sequence 42912-42943 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX928751 Klebsiella pneumoniae strain CRKP-5-KPC plasmid pCRKP-5-KPC, complete sequence 40733-40764 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN891680 Klebsiella pneumoniae strain A1718 plasmid pA1718-KPC, complete sequence 36440-36471 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN891680 Klebsiella pneumoniae strain A1718 plasmid pA1718-KPC, complete sequence 35492-35523 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MT230182 Escherichia coli strain DH5alpha plasmid pESBL176, complete sequence 27-58 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX881941 Klebsiella pneumoniae subsp. pneumoniae strain H154180724 plasmid pJF-WMKPCN1, complete sequence 12299-12330 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_020086 Escherichia coli plasmid pE66An, complete sequence 24316-24347 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_021664 Klebsiella pneumoniae FCF1305 plasmid pKPC_FCF13/05, complete sequence 12409-12440 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018442 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-3, complete sequence 33217-33248 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_EU880929 Klebsiella pneumoniae strain INS23K plasmid pLJ1, complete sequence 46860-46891 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_EU880929 Klebsiella pneumoniae strain INS23K plasmid pLJ1, complete sequence 56542-56573 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018959 Escherichia coli strain Ecol_422 plasmid pEC422_KPC, complete sequence 844-875 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP045022 Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-KPC14, complete sequence 43945-43976 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP021899 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_4_pilon, complete sequence 63913-63944 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022350 Escherichia coli E109 plasmid pE109_IMP6 DNA, complete sequence 25457-25488 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH401970 Enterobacter hormaechei subsp. steigerwaltii strain MED plasmid unnamed, complete sequence 7380-7411 2 0.938
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG764553 Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence 42599-42630 2 0.938
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 546-577 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX711879 Pseudomonas aeruginosa strain P378 plasmid P378-IMP, complete sequence 41178-41209 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX711879 Pseudomonas aeruginosa strain P378 plasmid P378-IMP, complete sequence 44074-44105 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX928750 Klebsiella pneumoniae strain CRKP-1-KPC plasmid pCRKP-1-KPC, complete sequence 56063-56094 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX928750 Klebsiella pneumoniae strain CRKP-1-KPC plasmid pCRKP-1-KPC, complete sequence 60198-60229 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF072962 Citrobacter freundii strain P10159 plasmid pP10159-2, complete sequence 41177-41208 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF072962 Citrobacter freundii strain P10159 plasmid pP10159-2, complete sequence 45207-45238 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY271415 Klebsiella pneumoniae strain H151400611 plasmid IncN_typeC, complete sequence 14606-14637 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY271414 Klebsiella pneumoniae strain H151440672 plasmid IncN_typeB, complete sequence 7007-7038 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY128483 Klebsiella oxytoca strain 97_38 plasmid pKm38_N, complete sequence 58657-58688 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY128483 Klebsiella oxytoca strain 97_38 plasmid pKm38_N, complete sequence 62792-62823 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982614 Escherichia coli strain CRE1504 plasmid pIMP-HK1504, complete sequence 6661-6692 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982614 Escherichia coli strain CRE1504 plasmid pIMP-HK1504, complete sequence 10796-10827 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982615 Escherichia coli strain CRE1505 plasmid pIMP-FS1505, complete sequence 6661-6692 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982615 Escherichia coli strain CRE1505 plasmid pIMP-FS1505, complete sequence 10796-10827 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX711880 Klebsiella pneumoniae strain 1220 plasmid p1220-IMP, complete sequence 36601-36632 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX711880 Klebsiella pneumoniae strain 1220 plasmid p1220-IMP, complete sequence 39497-39528 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982618 Escherichia coli strain CRE1517 plasmid pIMP-GZ1517, complete sequence 6661-6692 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982618 Escherichia coli strain CRE1517 plasmid pIMP-GZ1517, complete sequence 10796-10827 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU295131 Escherichia coli strain BK28009 plasmid pBK28009, complete sequence 97655-97686 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU295131 Escherichia coli strain BK28009 plasmid pBK28009, complete sequence 101789-101820 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY128484 Klebsiella michiganensis strain 97_58 plasmid pKm38_N, complete sequence 59782-59813 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY128484 Klebsiella michiganensis strain 97_58 plasmid pKm38_N, complete sequence 63917-63948 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051707 Escherichia coli strain CRE1502 plasmid pIMP-SZ1502, complete sequence 6661-6692 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051707 Escherichia coli strain CRE1502 plasmid pIMP-SZ1502, complete sequence 10796-10827 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982613 Klebsiella pneumoniae strain CRE 1496 plasmid pIMP1496, complete sequence 6661-6692 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982613 Klebsiella pneumoniae strain CRE 1496 plasmid pIMP1496, complete sequence 10796-10827 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU886034 Klebsiella pneumoniae strain Kp1 plasmid pIMP-HZ1, complete sequence 6660-6691 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU886034 Klebsiella pneumoniae strain Kp1 plasmid pIMP-HZ1, complete sequence 10795-10826 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU862632 Klebsiella pneumoniae strain CRE1495 plasmid pIMP-KP1495, complete sequence 6658-6689 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU862632 Klebsiella pneumoniae strain CRE1495 plasmid pIMP-KP1495, complete sequence 10790-10821 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051710 Citrobacter freundii strain CRE1503 plasmid pIMP-FJ1503, complete sequence 6661-6692 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051710 Citrobacter freundii strain CRE1503 plasmid pIMP-FJ1503, complete sequence 10796-10827 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT989598 Enterobacter cloacae strain CRE1506 plasmid pIMP-SH1506, complete sequence 6661-6692 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT989598 Enterobacter cloacae strain CRE1506 plasmid pIMP-SH1506, complete sequence 10796-10827 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KM977631 Klebsiella pneumoniae strain CRE1495 plasmid pIMP-1495, complete sequence 6661-6692 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KM977631 Klebsiella pneumoniae strain CRE1495 plasmid pIMP-1495, complete sequence 10796-10827 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KM660724 Morganella morganii strain MRSN22709 plasmid pMR3-OXA181, complete sequence 46703-46734 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KM660724 Morganella morganii strain MRSN22709 plasmid pMR3-OXA181, complete sequence 50838-50869 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051708 Klebsiella pneumoniae strain CRE1501 plasmid pIMP-SZ1501, complete sequence 6660-6691 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051708 Klebsiella pneumoniae strain CRE1501 plasmid pIMP-SZ1501, complete sequence 10795-10826 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051709 Escherichia coli strain CRE1058 plasmid pIMP-GZ1058, complete sequence 6661-6692 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051709 Escherichia coli strain CRE1058 plasmid pIMP-GZ1058, complete sequence 10796-10827 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982616 Escherichia coli strain CRE1509 plasmid pIMP-HK1509, complete sequence 6661-6692 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982616 Escherichia coli strain CRE1509 plasmid pIMP-HK1509, complete sequence 10796-10827 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU295134 Escherichia coli strain BK32602 plasmid pBK32602, complete sequence 77876-77907 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU295134 Escherichia coli strain BK32602 plasmid pBK32602, complete sequence 82011-82042 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KJ440076 Escherichia coli strain CGMHLK75 plasmid pLK75, complete sequence 46356-46387 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KJ440076 Escherichia coli strain CGMHLK75 plasmid pLK75, complete sequence 50518-50549 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_014231 Escherichia coli plasmid pKC394, complete sequence 44677-44708 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 LT221037 Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence 6661-6692 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 LT221037 Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence 10796-10827 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 LT221038 Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence 31995-32026 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MK356560 Salmonella sp. strain Sa1423 plasmid pSa1423-50K, complete sequence 40760-40791 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP048785 Serratia liquefaciens strain S1 plasmid pSl1, complete sequence 14892-14923 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP045256 Proteus mirabilis strain L90-1 plasmid pL901, complete sequence 16947-16978 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_021660 Klebsiella pneumoniae FCF3SP plasmid pKPC_FCF/3SP, complete sequence 12133-12164 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028486 Escherichia coli strain E41-1 plasmid p3, complete sequence 26704-26735 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028486 Escherichia coli strain E41-1 plasmid p3, complete sequence 30838-30869 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043186 Escherichia coli O16:H48 strain PG20180171 plasmid pPG20180171.1-IncN, complete sequence 34073-34104 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026053 Salmonella enterica strain FDAARGOS_70 plasmid unnamed1, complete sequence 1977-2008 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018646 Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 plasmid pSE79-2359, complete sequence 46798-46829 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP023420 Klebsiella pneumoniae strain 1050 plasmid pKp1050-4, complete sequence 54834-54865 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP023420 Klebsiella pneumoniae strain 1050 plasmid pKp1050-4, complete sequence 58969-59000 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK878892 Escherichia coli strain J53 plasmid pMG333, complete sequence 98873-98904 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK878892 Escherichia coli strain J53 plasmid pMG333, complete sequence 103008-103039 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026277 Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence 19453-19484 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026277 Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence 23588-23619 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP033394 Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence 132101-132132 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP033394 Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence 136236-136267 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LS998788 Escherichia coli isolate EC-TO75 plasmid 4, complete sequence 6821-6852 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LS998788 Escherichia coli isolate EC-TO75 plasmid 4, complete sequence 10956-10987 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KJ440075 Klebsiella pneumoniae strain CGMHLK78 plasmid pLK78, complete sequence 45996-46027 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KJ440075 Klebsiella pneumoniae strain CGMHLK78 plasmid pLK78, complete sequence 50081-50112 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026236 Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence 31381-31412 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026236 Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence 44326-44357 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 52912-52943 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009881 Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence 39683-39714 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009881 Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence 43818-43849 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026169 Leclercia sp. LSNIH1 plasmid pKPC-79f0, complete sequence 25167-25198 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026169 Leclercia sp. LSNIH1 plasmid pKPC-79f0, complete sequence 29302-29333 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052433 Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-2, complete sequence 41824-41855 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052433 Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-2, complete sequence 45959-45990 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT838197 Escherichia coli isolate WI1 isolate plasmid pWI1-KPC3, complete sequence 6661-6692 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LS992177 Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence 19426-19457 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LS992177 Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence 23509-23540 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LS992177 Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence 68730-68761 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 LN610760 Citrobacter freundii plasmid pCF8698_KPC2, strain CF8698, complete sequence 11619-11650 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102341 Uncultured bacterium plasmid pRSB201, complete sequence 43015-43046 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102342 Uncultured bacterium plasmid pRSB203, complete sequence 34345-34376 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102343 Uncultured bacterium plasmid pRSB205, complete sequence 40725-40756 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 JN102344 Uncultured bacterium plasmid pRSB206, complete sequence 44313-44344 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028173 Salmonella enterica strain CFSAN064033 plasmid pGMI17-001_1, complete sequence 39194-39225 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP021730 Escherichia coli strain Combat11I9 plasmid pCombat11I9-4, complete sequence 14036-14067 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP036363 Klebsiella pneumoniae strain WCHKP2080 plasmid p1_095080, complete sequence 44004-44035 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP036363 Klebsiella pneumoniae strain WCHKP2080 plasmid p1_095080, complete sequence 48139-48170 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_025019 Klebsiella pneumoniae subsp. ozaenae plasmid pKo6, complete sequence 55443-55474 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_025019 Klebsiella pneumoniae subsp. ozaenae plasmid pKo6, complete sequence 59578-59609 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP009867 Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence 43350-43381 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP009867 Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence 47485-47516 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020527 Enterobacter cloacae strain 109 plasmid unnamed2, complete sequence 55114-55145 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020527 Enterobacter cloacae strain 109 plasmid unnamed2, complete sequence 59249-59280 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP044159 Shigella flexneri strain AR-0423 plasmid pAR-0423-1, complete sequence 50719-50750 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP044159 Shigella flexneri strain AR-0423 plasmid pAR-0423-1, complete sequence 54854-54885 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP042643 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-5, complete sequence 33111-33142 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN891676 Klebsiella pneumoniae strain 24169 plasmid p24169-KPC, complete sequence 40252-40283 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN891676 Klebsiella pneumoniae strain 24169 plasmid p24169-KPC, complete sequence 44387-44418 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052359 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-3, complete sequence 40885-40916 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052359 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-3, complete sequence 45019-45050 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052446 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-3, complete sequence 39173-39204 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052446 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-3, complete sequence 43308-43339 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP040895 Leclercia adecarboxylata strain Z96-1 plasmid pIMP-Z96-1, complete sequence 84535-84566 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP040895 Leclercia adecarboxylata strain Z96-1 plasmid pIMP-Z96-1, complete sequence 88664-88695 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP014524 Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence 39323-39354 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP014524 Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence 43458-43489 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_025186 Klebsiella pneumoniae subsp. pneumoniae strain OW16C2 plasmid pOW16C2, complete sequence 52212-52243 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP040178 Klebsiella pneumoniae strain 2e plasmid unnamed3, complete sequence 25688-25719 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP040178 Klebsiella pneumoniae strain 2e plasmid unnamed3, complete sequence 29823-29854 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 2789-2820 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 6924-6955 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_024974 Escherichia coli plasmid pL2-43, complete sequence 9360-9391 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP044187 Salmonella enterica subsp. enterica strain AR-0402 plasmid pAR-0402 51593-51624 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP044187 Salmonella enterica subsp. enterica strain AR-0402 plasmid pAR-0402 55728-55759 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026757 Klebsiella aerogenes strain AR_0062 plasmid tig00000053_pilon, complete sequence 27578-27609 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026757 Klebsiella aerogenes strain AR_0062 plasmid tig00000053_pilon, complete sequence 31713-31744 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP035387 Enterobacter hormaechei strain S11_16 plasmid unnamed2, complete sequence 57398-57429 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP052872 Enterobacter cloacae strain 3849 plasmid p3846_IncN_VIM-1, complete sequence 48611-48642 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP012143 Shigella flexneri 4c strain 1205 plasmid 1205p3, complete sequence 10275-10306 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018963 Escherichia coli strain Ecol_517 plasmid pEC517_KPC, complete sequence 6661-6692 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019033 Escherichia coli plasmid pQNR2078, complete sequence 31780-31811 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_021622 Klebsiella pneumoniae plasmid pK45-67VIM complete sequence 53256-53287 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP033359 Salmonella enterica subsp. enterica strain EQAS2016S1 plasmid pEQAS2016S1-1, complete sequence 14523-14554 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028958 Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence 1375-1406 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028958 Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence 5510-5541 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP039821 Klebsiella pneumoniae strain C2414 plasmid pC2414-3-NDM, complete sequence 52940-52971 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP039821 Klebsiella pneumoniae strain C2414 plasmid pC2414-3-NDM, complete sequence 57075-57106 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP018758 Metakosakonia sp. MRY16-398 plasmid pMRY16-398_2, complete sequence 35906-35937 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP018758 Metakosakonia sp. MRY16-398 plasmid pMRY16-398_2, complete sequence 40041-40072 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_025183 Escherichia coli strain ECN580 plasmid pECN580, complete sequence 54829-54860 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_025183 Escherichia coli strain ECN580 plasmid pECN580, complete sequence 58964-58995 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_003292 Salmonella enterica subsp. enterica serovar Typhimurium plasmid R46, complete sequence 23227-23258 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018887 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence 7808-7839 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018887 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence 118474-118505 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP032203 Escherichia coli strain AR_0086 plasmid unnamed2, complete sequence 15047-15078 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP040859 Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence 28644-28675 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP040859 Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence 32779-32810 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_024967 Escherichia coli strain YD626E plasmid pYD626E, complete sequence 62670-62701 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_024967 Escherichia coli strain YD626E plasmid pYD626E, complete sequence 66828-66859 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_024967 Escherichia coli strain YD626E plasmid pYD626E, complete sequence 66109-66140 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 49263-49294 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 53398-53429 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019098 Escherichia coli strain HHA45 plasmid pHHA45, complete sequence 28053-28084 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP046118 Enterobacter cloacae strain CBG15936 plasmid pNDM1-CBG, complete sequence 52557-52588 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP046118 Enterobacter cloacae strain CBG15936 plasmid pNDM1-CBG, complete sequence 56692-56723 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP017086 Proteus mirabilis strain T18 plasmid pT18, complete sequence 15057-15088 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 KF534788 Escherichia coli plasmid pNDM-BTR, complete sequence 49293-49324 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 KF534788 Escherichia coli plasmid pNDM-BTR, complete sequence 53429-53460 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009862 Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence 69536-69567 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009862 Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence 73671-73702 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_014208 Klebsiella oxytoca KOX105 plasmid pKOX105, complete sequence 30852-30883 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_023909 Escherichia coli strain EcNDM1 plasmid pEcNDM1, complete sequence 48122-48153 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_023909 Escherichia coli strain EcNDM1 plasmid pEcNDM1, complete sequence 52257-52288 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_023910 Escherichia coli strain EcNDM0 plasmid pEcNDM0, complete sequence 43310-43341 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_023910 Escherichia coli strain EcNDM0 plasmid pEcNDM0, complete sequence 47445-47476 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009864 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence 52008-52039 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009864 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence 56143-56174 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985266 Escherichia coli strain 177 plasmid RCS53_p, complete sequence 35679-35710 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985266 Escherichia coli strain 177 plasmid RCS53_p, complete sequence 39816-39847 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_025141 Escherichia coli plasmid pH1038-142, complete sequence 42290-42321 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009853 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pKPC-860, complete sequence 45907-45938 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009853 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pKPC-860, complete sequence 50042-50073 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP042533 Klebsiella aerogenes strain C9 plasmid pC9_003, complete sequence 44816-44847 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018977 Escherichia coli strain Ecol_656 plasmid pEC656_KPC, complete sequence 6661-6692 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP011589 Enterobacter asburiae strain CAV1043 plasmid pKPC_CAV1043, complete sequence 49032-49063 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP011589 Enterobacter asburiae strain CAV1043 plasmid pKPC_CAV1043, complete sequence 53167-53198 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026389 Leclercia sp. LSNIH3 plasmid pKPC-3714, complete sequence 26144-26175 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026389 Leclercia sp. LSNIH3 plasmid pKPC-3714, complete sequence 30279-30310 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP008901 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pKPC-47e, complete sequence 39683-39714 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP008901 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pKPC-47e, complete sequence 43818-43849 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019124 Salmonella enterica subsp. enterica serovar Virchow plasmid pVQS1, complete sequence 9820-9851 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025965 Klebsiella pneumoniae strain WCHKP34 plasmid pNDM1_LL34, complete sequence 49624-49655 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025965 Klebsiella pneumoniae strain WCHKP34 plasmid pNDM1_LL34, complete sequence 53759-53790 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020066 Klebsiella pneumoniae strain AR_0117 plasmid unitig_5, complete sequence 14718-14749 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020066 Klebsiella pneumoniae strain AR_0117 plasmid unitig_5, complete sequence 18853-18884 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP022157 Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence 53550-53581 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP015389 Klebsiella pneumoniae strain NY9 plasmid pNY9_4, complete sequence 47330-47361 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN178639 Kluyvera cryocrescens strain SCW13 plasmid pSCW13-1, complete sequence 2624-2655 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN178639 Kluyvera cryocrescens strain SCW13 plasmid pSCW13-1, complete sequence 53304-53335 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP038278 Raoultella ornithinolytica strain WLK218 plasmid pWLK-IncN, complete sequence 33512-33543 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025233 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 plasmid pSNE1-1925, complete sequence 52091-52122 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP050160 Escherichia coli plasmid Carbapenemase(IMP-4)_IncN, complete sequence 50546-50577 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP050160 Escherichia coli plasmid Carbapenemase(IMP-4)_IncN, complete sequence 54103-54134 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP050859 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-NDM, complete sequence 49836-49867 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP050859 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-NDM, complete sequence 53799-53830 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025758 Citrobacter freundii complex sp. CFNIH12 strain CFNIH2 plasmid pKPC-349c, complete sequence 52007-52038 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025758 Citrobacter freundii complex sp. CFNIH12 strain CFNIH2 plasmid pKPC-349c, complete sequence 56142-56173 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP050159 Enterobacter cloacae plasmid Carbapenemase(IMP-26)_IncN, complete sequence 46674-46705 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP050159 Enterobacter cloacae plasmid Carbapenemase(IMP-26)_IncN, complete sequence 50809-50840 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018945 Escherichia coli strain Ecol_224 plasmid pEC224_KPC, complete sequence 14730-14761 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018945 Escherichia coli strain Ecol_224 plasmid pEC224_KPC, complete sequence 18865-18896 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP017083 Proteus mirabilis strain T21 plasmid pT211, complete sequence 18288-18319 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP019026 Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence 23571-23602 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP019026 Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence 28943-28974 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026211 Citrobacter sp. CFNIH10 plasmid pCIT-eb1a, complete sequence 1514-1545 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026211 Citrobacter sp. CFNIH10 plasmid pCIT-eb1a, complete sequence 48646-48677 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022367 Escherichia coli E317 plasmid pE317_IMP6 DNA, complete sequence 47899-47930 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022367 Escherichia coli E317 plasmid pE317_IMP6 DNA, complete sequence 52034-52065 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP027050 Klebsiella pneumoniae strain 20_GR_12 plasmid IncN, complete sequence 17899-17930 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028579 Klebsiella pneumoniae strain WCHKP36 plasmid p1_020036, complete sequence 11618-11649 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028579 Klebsiella pneumoniae strain WCHKP36 plasmid p1_020036, complete sequence 15753-15784 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025710 Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence 60266-60297 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025710 Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence 64401-64432 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026198 Enterobacteriaceae bacterium ENNIH3 plasmid pKPC-c606, complete sequence 101669-101700 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026198 Enterobacteriaceae bacterium ENNIH3 plasmid pKPC-c606, complete sequence 105804-105835 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP030335 Escherichia coli strain AR_451 plasmid unnamed1, complete sequence 36437-36468 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP030335 Escherichia coli strain AR_451 plasmid unnamed1, complete sequence 40571-40602 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP036368 Klebsiella pneumoniae strain WCHKP115068 plasmid p1_115068, complete sequence 49692-49723 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP036368 Klebsiella pneumoniae strain WCHKP115068 plasmid p1_115068, complete sequence 53827-53858 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_009132 Escherichia coli plasmid pLEW517, complete sequence 77-108 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025984 Enterobacteriaceae bacterium A-F18 plasmid pAF18_2, complete sequence 6798-6829 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025984 Enterobacteriaceae bacterium A-F18 plasmid pAF18_2, complete sequence 10931-10962 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP031109 Escherichia coli strain AMSCJX02 plasmid pAMSC4, complete sequence 36599-36630 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP033830 Serratia sp. FDAARGOS_506 plasmid unnamed, complete sequence 39779-39810 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_011383 Klebsiella pneumoniae plasmid 9, complete sequence 39097-39128 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP042581 Enterobacter kobei strain C16 plasmid pC16_003, complete sequence 34576-34607 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP042581 Enterobacter kobei strain C16 plasmid pC16_003, complete sequence 38659-38690 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020119 Escherichia coli strain AR_0104 plasmid unitig_7, complete sequence 29663-29694 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020119 Escherichia coli strain AR_0104 plasmid unitig_7, complete sequence 33798-33829 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_022885 Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence 53480-53511 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_022885 Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence 57615-57646 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 KC170280 Uncultured bacterium plasmid pDS2, complete sequence 6823-6854 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043224 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.2-IncN, complete sequence 33888-33919 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026496 Klebsiella pneumoniae strain 616 plasmid pKp616_1, complete sequence 48582-48613 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026496 Klebsiella pneumoniae strain 616 plasmid pKp616_1, complete sequence 52139-52170 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022354 Escherichia coli E033 plasmid pE033_IMP6 DNA, complete sequence 62648-62679 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022354 Escherichia coli E033 plasmid pE033_IMP6 DNA, complete sequence 66783-66814 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022355 Escherichia coli E034 plasmid pE034_IMP6 DNA, complete sequence 99063-99094 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022355 Escherichia coli E034 plasmid pE034_IMP6 DNA, complete sequence 103198-103229 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022356 Escherichia coli E119 plasmid pE119_5kIMP6 DNA, complete sequence 39053-39084 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022356 Escherichia coli E119 plasmid pE119_5kIMP6 DNA, complete sequence 43188-43219 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022358 Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence 51338-51369 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022358 Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence 55473-55504 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022359 Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence 124945-124976 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022359 Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence 129080-129111 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_011617 Klebsiella pneumoniae plasmid pKP96, complete sequence 57744-57775 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_011617 Klebsiella pneumoniae plasmid pKP96, complete sequence 61879-61910 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043184 Escherichia coli O16:H48 strain PG20180172 plasmid pPG20180172.1-IncN, complete sequence 34072-34103 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043188 Escherichia coli O16:H48 strain PG20180170 plasmid pPG20180170.1-IncN, complete sequence 34073-34104 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022349 Klebsiella pneumoniae E105 plasmid pKPI-1 DNA, complete sequence 38495-38526 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022349 Klebsiella pneumoniae E105 plasmid pKPI-1 DNA, complete sequence 42630-42661 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_022374 Escherichia coli plasmid pHKU1, complete sequence 44267-44298 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_022374 Escherichia coli plasmid pHKU1, complete sequence 48402-48433 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP018362 Escherichia coli strain A56-1S plasmid pA56-1S, complete sequence 41517-41548 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP018362 Escherichia coli strain A56-1S plasmid pA56-1S, complete sequence 45652-45683 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019550 Klebsiella pneumoniae strain THC11 plasmid pTHC11-2, complete sequence 39848-39879 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019550 Klebsiella pneumoniae strain THC11 plasmid pTHC11-2, complete sequence 43983-44014 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP018363 Escherichia coli strain A56-1R plasmid pA56-1R, complete sequence 12398-12429 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP018363 Escherichia coli strain A56-1R plasmid pA56-1R, complete sequence 16533-16564 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052394 Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-2, complete sequence 46513-46544 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052394 Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-2, complete sequence 50648-50679 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019403 Klebsiella pneumoniae strain E129 plasmid pE129_IMP6, complete sequence 39241-39272 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019403 Klebsiella pneumoniae strain E129 plasmid pE129_IMP6, complete sequence 43374-43405 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019402 Klebsiella pneumoniae strain E013 plasmid pE013_IMP6, complete sequence 39241-39272 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019402 Klebsiella pneumoniae strain E013 plasmid pE013_IMP6, complete sequence 43349-43380 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019404 Klebsiella pneumoniae strain E188 plasmid pE188_IMP6, complete sequence 40229-40260 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019404 Klebsiella pneumoniae strain E188 plasmid pE188_IMP6, complete sequence 44364-44395 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 37368-37399 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 41503-41534 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018649 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-1, complete sequence 24094-24125 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026590 Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence 2568-2599 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026590 Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence 47648-47679 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP023981 Klebsiella variicola strain X39 plasmid pX39-4, complete sequence 15237-15268 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP023981 Klebsiella variicola strain X39 plasmid pX39-4, complete sequence 19352-19383 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LR745047 Klebsiella pneumoniae isolate Kpn2166 plasmid pCTX-M15_Kpn2166 71066-71097 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018643 Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence 114373-114404 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985259 Escherichia coli strain 592 plasmid RCS44_p, complete sequence 9180-9211 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985251 Escherichia coli strain 502 plasmid RCS45_p, complete sequence 9180-9211 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK878894 Escherichia coli strain J53 plasmid pMG334, complete sequence 252-283 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK878894 Escherichia coli strain J53 plasmid pMG334, complete sequence 4387-4418 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK416183 Escherichia coli strain Ec-2Lar plasmid unnamed, complete sequence 6663-6694 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK416183 Escherichia coli strain Ec-2Lar plasmid unnamed, complete sequence 10910-10941 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MN241904 Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM62, complete sequence 52030-52061 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MN241904 Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM62, complete sequence 56113-56144 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019888 Klebsiella pneumoniae strain BK31551 plasmid pBK31551, complete sequence 73606-73637 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019888 Klebsiella pneumoniae strain BK31551 plasmid pBK31551, complete sequence 77741-77772 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909339 Klebsiella pneumoniae strain 24632 plasmid p24632-IMP, complete sequence 41287-41318 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909339 Klebsiella pneumoniae strain 24632 plasmid p24632-IMP, complete sequence 45422-45453 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909337 Klebsiella pneumoniae strain 20389 plasmid p20389-IMP, complete sequence 41531-41562 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909337 Klebsiella pneumoniae strain 20389 plasmid p20389-IMP, complete sequence 45666-45697 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909334 Klebsiella pneumoniae strain 13-sp plasmid p13SP-IMP, complete sequence 43513-43544 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909334 Klebsiella pneumoniae strain 13-sp plasmid p13SP-IMP, complete sequence 47648-47679 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909336 Klebsiella pneumoniae strain 201311334 plasmid p11334-IMP, complete sequence 40603-40634 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909336 Klebsiella pneumoniae strain 201311334 plasmid p11334-IMP, complete sequence 44737-44768 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909328 Klebsiella pneumoniae strain D920 plasmid pD920-IMP, complete sequence 46333-46364 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH917123 Klebsiella pneumoniae strain Kp735 plasmid pSZN_KPC, complete sequence 55498-55529 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH917123 Klebsiella pneumoniae strain Kp735 plasmid pSZN_KPC, complete sequence 58396-58427 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK036890 Klebsiella pneumoniae strain D610 plasmid pD610-1IMP, complete sequence 27757-27788 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK036890 Klebsiella pneumoniae strain D610 plasmid pD610-1IMP, complete sequence 31892-31923 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH128095 Klebsiella pneumoniae strain CZPF1510086 plasmid pTBCZNDM02, complete sequence 10654-10685 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH128095 Klebsiella pneumoniae strain CZPF1510086 plasmid pTBCZNDM02, complete sequence 13771-13802 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK356561 Escherichia coli strain J53 plasmid pSa1423TC-59K, complete sequence 50969-51000 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK862125 Enterobacter hormaechei strain 1-RC-17-04408-5 plasmid P04408-5-KPC40, complete sequence 44970-45001 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK862125 Enterobacter hormaechei strain 1-RC-17-04408-5 plasmid P04408-5-KPC40, complete sequence 49105-49136 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN657245 Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence 35915-35946 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN657246 Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence 40907-40938 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MT199177 Escherichia coli strain 100 plasmid p100_NDM5_IncN, complete sequence 59619-59650 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG886286 Escherichia coli strain ECSIC9 plasmid pECSIC9, complete sequence 6595-6626 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF474175 Escherichia coli strain J53/pNIT-HK plasmid pNIT-HK, complete sequence 31460-31491 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF344559 Enterobacter hormaechei strain 128379 plasmid p128379-IMP, complete sequence 6661-6692 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF344559 Enterobacter hormaechei strain 128379 plasmid p128379-IMP, complete sequence 10796-10827 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH727565 Citrobacter freundii strain ECL-14-57 plasmid pIMP-ECL14-57, complete sequence 6661-6692 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH727565 Citrobacter freundii strain ECL-14-57 plasmid pIMP-ECL14-57, complete sequence 10796-10827 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG878866 Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence 120552-120583 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG878866 Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence 124687-124718 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY271413 Klebsiella pneumoniae strain KL49 plasmid IncN_typeA, complete sequence 2568-2599 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY271413 Klebsiella pneumoniae strain KL49 plasmid IncN_typeA, complete sequence 52778-52809 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF344557 Klebsiella pneumoniae strain 10677 plasmid p10677-IMP, complete sequence 7489-7520 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF344557 Klebsiella pneumoniae strain 10677 plasmid p10677-IMP, complete sequence 11624-11655 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF953243 Klebsiella pneumoniae strain C5 plasmid pC5_41608, complete sequence 9360-9391 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG288677 Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence 58123-58154 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG904997 Escherichia coli strain 15OD0495 plasmid p15ODMR, complete sequence 44447-44478 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020059 Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence 81349-81380 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020059 Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence 85484-85515 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP017725 Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 strain SGSC 2518 isolate SARB61 plasmid pSARB26_02, complete sequence 19216-19247 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_014368 Klebsiella pneumoniae plasmid pNL194, complete sequence 62654-62685 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_014368 Klebsiella pneumoniae plasmid pNL194, complete sequence 66896-66927 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MT077883 Escherichia coli plasmid p23, complete sequence 53179-53210 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_032101 Enterobacter cloacae plasmid pG6809-2, complete sequence 47918-47949 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_032101 Enterobacter cloacae plasmid pG6809-2, complete sequence 52156-52187 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX928751 Klebsiella pneumoniae strain CRKP-5-KPC plasmid pCRKP-5-KPC, complete sequence 44149-44180 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX928751 Klebsiella pneumoniae strain CRKP-5-KPC plasmid pCRKP-5-KPC, complete sequence 61527-61558 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN891680 Klebsiella pneumoniae strain A1718 plasmid pA1718-KPC, complete sequence 33082-33113 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN891680 Klebsiella pneumoniae strain A1718 plasmid pA1718-KPC, complete sequence 34997-35028 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX881941 Klebsiella pneumoniae subsp. pneumoniae strain H154180724 plasmid pJF-WMKPCN1, complete sequence 11580-11611 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_020088 Klebsiella pneumoniae plasmid pK18An, complete sequence 45176-45207 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_020086 Escherichia coli plasmid pE66An, complete sequence 23822-23853 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_020086 Escherichia coli plasmid pE66An, complete sequence 25035-25066 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_021664 Klebsiella pneumoniae FCF1305 plasmid pKPC_FCF13/05, complete sequence 11690-11721 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018442 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-3, complete sequence 444-475 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018442 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-3, complete sequence 32498-32529 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_009980 Salmonella enterica subsp. enterica serovar Dublin plasmid pMAK2, complete sequence 56862-56893 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LR130556 Escherichia coli strain MS14385 isolate MS14385 plasmid 2 36955-36986 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_EU880929 Klebsiella pneumoniae strain INS23K plasmid pLJ1, complete sequence 45236-45267 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_EU880929 Klebsiella pneumoniae strain INS23K plasmid pLJ1, complete sequence 46365-46396 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_EU880929 Klebsiella pneumoniae strain INS23K plasmid pLJ1, complete sequence 54810-54841 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_EU880929 Klebsiella pneumoniae strain INS23K plasmid pLJ1, complete sequence 56047-56078 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP019247 Escherichia coli strain Combat13F7 plasmid pCombat13F7-2, complete sequence 20948-20979 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_015599 Escherichia coli IncN plasmid N3, complete sequence 7285-7316 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN891686 Klebsiella pneumoniae strain ZZ58 plasmid pZZ58-KPC, complete sequence 39620-39651 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP019006 Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_2, complete sequence 3629-3660 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP008824 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKEC-39c, complete sequence 44103-44134 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP007732 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKEC-dc3, complete sequence 44114-44145 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018959 Escherichia coli strain Ecol_422 plasmid pEC422_KPC, complete sequence 1563-1594 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018959 Escherichia coli strain Ecol_422 plasmid pEC422_KPC, complete sequence 50602-50633 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP045022 Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-KPC14, complete sequence 41766-41797 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP045022 Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-KPC14, complete sequence 44664-44695 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP021899 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_4_pilon, complete sequence 63194-63225 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP021899 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_4_pilon, complete sequence 66092-66123 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP029368 Escherichia coli strain WCHEC035148 plasmid pQnrS1_035148, complete sequence 36028-36059 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP007558 Citrobacter freundii CFNIH1 plasmid pKEC-a3c, complete sequence 44103-44134 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_011385 Klebsiella pneumoniae plasmid 12, complete sequence 12089-12120 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022350 Escherichia coli E109 plasmid pE109_IMP6 DNA, complete sequence 23278-23309 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022350 Escherichia coli E109 plasmid pE109_IMP6 DNA, complete sequence 26176-26207 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP050770 Salmonella enterica subsp. enterica serovar Indiana strain SI108 plasmid pSI108-1, complete sequence 63058-63089 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025402 Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence 93984-94015 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MN328348 Salmonella enterica subsp. enterica serovar Enteritidis strain S14 plasmid pTS14, complete sequence 40586-40617 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH401970 Enterobacter hormaechei subsp. steigerwaltii strain MED plasmid unnamed, complete sequence 6661-6692 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH401970 Enterobacter hormaechei subsp. steigerwaltii strain MED plasmid unnamed, complete sequence 9559-9590 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG764553 Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence 41880-41911 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG764553 Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence 44778-44809 3 0.906
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX711879 Pseudomonas aeruginosa strain P378 plasmid P378-IMP, complete sequence 42862-42893 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX928750 Klebsiella pneumoniae strain CRKP-1-KPC plasmid pCRKP-1-KPC, complete sequence 58985-59016 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF072962 Citrobacter freundii strain P10159 plasmid pP10159-2, complete sequence 43994-44025 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY271415 Klebsiella pneumoniae strain H151400611 plasmid IncN_typeC, complete sequence 15819-15850 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY271415 Klebsiella pneumoniae strain H151400611 plasmid IncN_typeC, complete sequence 18719-18750 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY271414 Klebsiella pneumoniae strain H151440672 plasmid IncN_typeB, complete sequence 8220-8251 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY271414 Klebsiella pneumoniae strain H151440672 plasmid IncN_typeB, complete sequence 11139-11170 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY128483 Klebsiella oxytoca strain 97_38 plasmid pKm38_N, complete sequence 61579-61610 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982614 Escherichia coli strain CRE1504 plasmid pIMP-HK1504, complete sequence 7874-7905 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982615 Escherichia coli strain CRE1505 plasmid pIMP-FS1505, complete sequence 7874-7905 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX711880 Klebsiella pneumoniae strain 1220 plasmid p1220-IMP, complete sequence 38284-38315 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982618 Escherichia coli strain CRE1517 plasmid pIMP-GZ1517, complete sequence 7874-7905 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU295131 Escherichia coli strain BK28009 plasmid pBK28009, complete sequence 100576-100607 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY128484 Klebsiella michiganensis strain 97_58 plasmid pKm38_N, complete sequence 62704-62735 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051707 Escherichia coli strain CRE1502 plasmid pIMP-SZ1502, complete sequence 7874-7905 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982613 Klebsiella pneumoniae strain CRE 1496 plasmid pIMP1496, complete sequence 7874-7905 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU886034 Klebsiella pneumoniae strain Kp1 plasmid pIMP-HZ1, complete sequence 7873-7904 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU862632 Klebsiella pneumoniae strain CRE1495 plasmid pIMP-KP1495, complete sequence 7871-7902 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051710 Citrobacter freundii strain CRE1503 plasmid pIMP-FJ1503, complete sequence 7874-7905 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT989598 Enterobacter cloacae strain CRE1506 plasmid pIMP-SH1506, complete sequence 7874-7905 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KM977631 Klebsiella pneumoniae strain CRE1495 plasmid pIMP-1495, complete sequence 7874-7905 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KM660724 Morganella morganii strain MRSN22709 plasmid pMR3-OXA181, complete sequence 49625-49656 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051708 Klebsiella pneumoniae strain CRE1501 plasmid pIMP-SZ1501, complete sequence 7873-7904 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU051709 Escherichia coli strain CRE1058 plasmid pIMP-GZ1058, complete sequence 7874-7905 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KT982616 Escherichia coli strain CRE1509 plasmid pIMP-HK1509, complete sequence 7874-7905 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KU295134 Escherichia coli strain BK32602 plasmid pBK32602, complete sequence 80798-80829 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KJ440076 Escherichia coli strain CGMHLK75 plasmid pLK75, complete sequence 49305-49336 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 LT221037 Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence 7874-7905 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 LT221038 Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence 27757-27788 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 LT221038 Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence 30782-30813 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP031259 Klebsiella quasipneumoniae strain L22 plasmid pL22-2, complete sequence 22830-22861 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP031259 Klebsiella quasipneumoniae strain L22 plasmid pL22-2, complete sequence 25856-25887 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_021660 Klebsiella pneumoniae FCF3SP plasmid pKPC_FCF/3SP, complete sequence 13346-13377 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_021660 Klebsiella pneumoniae FCF3SP plasmid pKPC_FCF/3SP, complete sequence 16380-16411 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028486 Escherichia coli strain E41-1 plasmid p3, complete sequence 27917-27948 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP023420 Klebsiella pneumoniae strain 1050 plasmid pKp1050-4, complete sequence 57756-57787 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK878892 Escherichia coli strain J53 plasmid pMG333, complete sequence 101795-101826 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026277 Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence 20666-20697 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP033394 Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence 135023-135054 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KJ440075 Klebsiella pneumoniae strain CGMHLK78 plasmid pLK78, complete sequence 48868-48899 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026236 Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence 41404-41435 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009881 Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence 42605-42636 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026169 Leclercia sp. LSNIH1 plasmid pKPC-79f0, complete sequence 28089-28120 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052433 Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-2, complete sequence 44746-44777 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT838197 Escherichia coli isolate WI1 isolate plasmid pWI1-KPC3, complete sequence 7874-7905 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT838197 Escherichia coli isolate WI1 isolate plasmid pWI1-KPC3, complete sequence 10908-10939 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LS992177 Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence 20639-20670 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 LN610760 Citrobacter freundii plasmid pCF8698_KPC2, strain CF8698, complete sequence 12832-12863 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 LN610760 Citrobacter freundii plasmid pCF8698_KPC2, strain CF8698, complete sequence 15866-15897 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP036363 Klebsiella pneumoniae strain WCHKP2080 plasmid p1_095080, complete sequence 46926-46957 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_025019 Klebsiella pneumoniae subsp. ozaenae plasmid pKo6, complete sequence 58365-58396 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP009867 Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence 46272-46303 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020527 Enterobacter cloacae strain 109 plasmid unnamed2, complete sequence 58036-58067 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP044159 Shigella flexneri strain AR-0423 plasmid pAR-0423-1, complete sequence 53641-53672 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN891676 Klebsiella pneumoniae strain 24169 plasmid p24169-KPC, complete sequence 41465-41496 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052359 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-3, complete sequence 43806-43837 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052446 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-3, complete sequence 42095-42126 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP040895 Leclercia adecarboxylata strain Z96-1 plasmid pIMP-Z96-1, complete sequence 87451-87482 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP014524 Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence 42245-42276 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP040178 Klebsiella pneumoniae strain 2e plasmid unnamed3, complete sequence 28610-28641 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 4002-4033 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP044187 Salmonella enterica subsp. enterica strain AR-0402 plasmid pAR-0402 54515-54546 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026757 Klebsiella aerogenes strain AR_0062 plasmid tig00000053_pilon, complete sequence 30500-30531 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP035387 Enterobacter hormaechei strain S11_16 plasmid unnamed2, complete sequence 53151-53182 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP035387 Enterobacter hormaechei strain S11_16 plasmid unnamed2, complete sequence 56185-56216 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018963 Escherichia coli strain Ecol_517 plasmid pEC517_KPC, complete sequence 7874-7905 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018963 Escherichia coli strain Ecol_517 plasmid pEC517_KPC, complete sequence 10908-10939 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028958 Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence 4297-4328 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP039821 Klebsiella pneumoniae strain C2414 plasmid pC2414-3-NDM, complete sequence 55862-55893 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP018758 Metakosakonia sp. MRY16-398 plasmid pMRY16-398_2, complete sequence 38828-38859 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_025183 Escherichia coli strain ECN580 plasmid pECN580, complete sequence 57751-57782 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018887 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence 3561-3592 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018887 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence 6595-6626 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018887 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence 114227-114258 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018887 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence 117261-117292 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP032203 Escherichia coli strain AR_0086 plasmid unnamed2, complete sequence 16260-16291 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP032203 Escherichia coli strain AR_0086 plasmid unnamed2, complete sequence 19285-19316 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP040859 Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence 29857-29888 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_024967 Escherichia coli strain YD626E plasmid pYD626E, complete sequence 65615-65646 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 52185-52216 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP046118 Enterobacter cloacae strain CBG15936 plasmid pNDM1-CBG, complete sequence 55479-55510 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 KF534788 Escherichia coli plasmid pNDM-BTR, complete sequence 52216-52247 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009862 Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence 72458-72489 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_023909 Escherichia coli strain EcNDM1 plasmid pEcNDM1, complete sequence 51044-51075 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_023910 Escherichia coli strain EcNDM0 plasmid pEcNDM0, complete sequence 46232-46263 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009864 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence 54930-54961 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009874 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence 39298-39329 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009874 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence 42324-42355 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985266 Escherichia coli strain 177 plasmid RCS53_p, complete sequence 36892-36923 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP009853 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pKPC-860, complete sequence 48829-48860 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP042533 Klebsiella aerogenes strain C9 plasmid pC9_003, complete sequence 40578-40609 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP042533 Klebsiella aerogenes strain C9 plasmid pC9_003, complete sequence 43603-43634 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018977 Escherichia coli strain Ecol_656 plasmid pEC656_KPC, complete sequence 7874-7905 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018977 Escherichia coli strain Ecol_656 plasmid pEC656_KPC, complete sequence 10908-10939 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP011589 Enterobacter asburiae strain CAV1043 plasmid pKPC_CAV1043, complete sequence 51954-51985 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026389 Leclercia sp. LSNIH3 plasmid pKPC-3714, complete sequence 29066-29097 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP008901 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pKPC-47e, complete sequence 42605-42636 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025965 Klebsiella pneumoniae strain WCHKP34 plasmid pNDM1_LL34, complete sequence 52546-52577 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020066 Klebsiella pneumoniae strain AR_0117 plasmid unitig_5, complete sequence 17640-17671 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP015389 Klebsiella pneumoniae strain NY9 plasmid pNY9_4, complete sequence 43197-43228 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP015389 Klebsiella pneumoniae strain NY9 plasmid pNY9_4, complete sequence 46117-46148 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MN178639 Kluyvera cryocrescens strain SCW13 plasmid pSCW13-1, complete sequence 1411-1442 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP038278 Raoultella ornithinolytica strain WLK218 plasmid pWLK-IncN, complete sequence 34725-34756 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP038278 Raoultella ornithinolytica strain WLK218 plasmid pWLK-IncN, complete sequence 39112-39143 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP050160 Escherichia coli plasmid Carbapenemase(IMP-4)_IncN, complete sequence 52890-52921 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP050859 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-NDM, complete sequence 52758-52789 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025758 Citrobacter freundii complex sp. CFNIH12 strain CFNIH2 plasmid pKPC-349c, complete sequence 54929-54960 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP050159 Enterobacter cloacae plasmid Carbapenemase(IMP-26)_IncN, complete sequence 49596-49627 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018945 Escherichia coli strain Ecol_224 plasmid pEC224_KPC, complete sequence 15943-15974 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP019026 Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence 24784-24815 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026211 Citrobacter sp. CFNIH10 plasmid pCIT-eb1a, complete sequence 49859-49890 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022367 Escherichia coli E317 plasmid pE317_IMP6 DNA, complete sequence 49112-49143 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP028579 Klebsiella pneumoniae strain WCHKP36 plasmid p1_020036, complete sequence 12831-12862 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025710 Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence 63188-63219 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026198 Enterobacteriaceae bacterium ENNIH3 plasmid pKPC-c606, complete sequence 104591-104622 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP030335 Escherichia coli strain AR_451 plasmid unnamed1, complete sequence 37650-37681 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP036368 Klebsiella pneumoniae strain WCHKP115068 plasmid p1_115068, complete sequence 52614-52645 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP025984 Enterobacteriaceae bacterium A-F18 plasmid pAF18_2, complete sequence 8011-8042 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP033830 Serratia sp. FDAARGOS_506 plasmid unnamed, complete sequence 64-95 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP033830 Serratia sp. FDAARGOS_506 plasmid unnamed, complete sequence 40992-41023 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_011383 Klebsiella pneumoniae plasmid 9, complete sequence 40310-40341 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_011383 Klebsiella pneumoniae plasmid 9, complete sequence 43335-43366 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP042581 Enterobacter kobei strain C16 plasmid pC16_003, complete sequence 37446-37477 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020119 Escherichia coli strain AR_0104 plasmid unitig_7, complete sequence 32585-32616 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_022885 Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence 56402-56433 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 KC170280 Uncultured bacterium plasmid pDS2, complete sequence 8036-8067 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 KC170280 Uncultured bacterium plasmid pDS2, complete sequence 11060-11091 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026496 Klebsiella pneumoniae strain 616 plasmid pKp616_1, complete sequence 50926-50957 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022354 Escherichia coli E033 plasmid pE033_IMP6 DNA, complete sequence 65570-65601 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022355 Escherichia coli E034 plasmid pE034_IMP6 DNA, complete sequence 101985-102016 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022356 Escherichia coli E119 plasmid pE119_5kIMP6 DNA, complete sequence 41975-42006 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022358 Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence 54260-54291 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022359 Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence 127867-127898 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_011617 Klebsiella pneumoniae plasmid pKP96, complete sequence 60666-60697 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP043184 Escherichia coli O16:H48 strain PG20180172 plasmid pPG20180172.1-IncN, complete sequence 36077-36108 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022349 Klebsiella pneumoniae E105 plasmid pKPI-1 DNA, complete sequence 41417-41448 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_022374 Escherichia coli plasmid pHKU1, complete sequence 47189-47220 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP018362 Escherichia coli strain A56-1S plasmid pA56-1S, complete sequence 44439-44470 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019550 Klebsiella pneumoniae strain THC11 plasmid pTHC11-2, complete sequence 42770-42801 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP018363 Escherichia coli strain A56-1R plasmid pA56-1R, complete sequence 13611-13642 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 CP052394 Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-2, complete sequence 49435-49466 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019403 Klebsiella pneumoniae strain E129 plasmid pE129_IMP6, complete sequence 42161-42192 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019402 Klebsiella pneumoniae strain E013 plasmid pE013_IMP6, complete sequence 42136-42167 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019404 Klebsiella pneumoniae strain E188 plasmid pE188_IMP6, complete sequence 43151-43182 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 40290-40321 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP026590 Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence 1355-1386 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP023981 Klebsiella variicola strain X39 plasmid pX39-4, complete sequence 16448-16479 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LR745047 Klebsiella pneumoniae isolate Kpn2166 plasmid pCTX-M15_Kpn2166 66828-66859 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LR745047 Klebsiella pneumoniae isolate Kpn2166 plasmid pCTX-M15_Kpn2166 69853-69884 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985259 Escherichia coli strain 592 plasmid RCS44_p, complete sequence 6653-6684 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_LT985245 Escherichia coli strain 523 plasmid RCS42_p, complete sequence 6653-6684 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK878894 Escherichia coli strain J53 plasmid pMG334, complete sequence 3174-3205 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK416183 Escherichia coli strain Ec-2Lar plasmid unnamed, complete sequence 7876-7907 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MN241904 Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM62, complete sequence 54900-54931 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_019888 Klebsiella pneumoniae strain BK31551 plasmid pBK31551, complete sequence 76528-76559 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909339 Klebsiella pneumoniae strain 24632 plasmid p24632-IMP, complete sequence 44209-44240 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909337 Klebsiella pneumoniae strain 20389 plasmid p20389-IMP, complete sequence 44453-44484 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909334 Klebsiella pneumoniae strain 13-sp plasmid p13SP-IMP, complete sequence 46435-46466 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909336 Klebsiella pneumoniae strain 201311334 plasmid p11334-IMP, complete sequence 43524-43555 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH909328 Klebsiella pneumoniae strain D920 plasmid pD920-IMP, complete sequence 47546-47577 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH917123 Klebsiella pneumoniae strain Kp735 plasmid pSZN_KPC, complete sequence 57183-57214 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK036890 Klebsiella pneumoniae strain D610 plasmid pD610-1IMP, complete sequence 30679-30710 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH128095 Klebsiella pneumoniae strain CZPF1510086 plasmid pTBCZNDM02, complete sequence 12558-12589 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MK862125 Enterobacter hormaechei strain 1-RC-17-04408-5 plasmid P04408-5-KPC40, complete sequence 47892-47923 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG886286 Escherichia coli strain ECSIC9 plasmid pECSIC9, complete sequence 7808-7839 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG886286 Escherichia coli strain ECSIC9 plasmid pECSIC9, complete sequence 10842-10873 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF344559 Enterobacter hormaechei strain 128379 plasmid p128379-IMP, complete sequence 7874-7905 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH727565 Citrobacter freundii strain ECL-14-57 plasmid pIMP-ECL14-57, complete sequence 7874-7905 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG878866 Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence 123474-123505 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KY271413 Klebsiella pneumoniae strain KL49 plasmid IncN_typeA, complete sequence 1355-1386 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MF344557 Klebsiella pneumoniae strain 10677 plasmid p10677-IMP, complete sequence 8702-8733 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP020059 Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence 82562-82593 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_014368 Klebsiella pneumoniae plasmid pNL194, complete sequence 65682-65713 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MT077883 Escherichia coli plasmid p23, complete sequence 48939-48970 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 MT077883 Escherichia coli plasmid p23, complete sequence 51966-51997 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_032101 Enterobacter cloacae plasmid pG6809-2, complete sequence 50942-50973 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX928751 Klebsiella pneumoniae strain CRKP-5-KPC plasmid pCRKP-5-KPC, complete sequence 41227-41258 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX881941 Klebsiella pneumoniae subsp. pneumoniae strain H154180724 plasmid pJF-WMKPCN1, complete sequence 12793-12824 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_KX881941 Klebsiella pneumoniae subsp. pneumoniae strain H154180724 plasmid pJF-WMKPCN1, complete sequence 14485-14516 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_021664 Klebsiella pneumoniae FCF1305 plasmid pKPC_FCF13/05, complete sequence 12903-12934 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_021664 Klebsiella pneumoniae FCF1305 plasmid pKPC_FCF13/05, complete sequence 14595-14626 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018442 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-3, complete sequence 33711-33742 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP018959 Escherichia coli strain Ecol_422 plasmid pEC422_KPC, complete sequence 350-381 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP045022 Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-KPC14, complete sequence 43451-43482 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP021899 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_4_pilon, complete sequence 64407-64438 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 AP022350 Escherichia coli E109 plasmid pE109_IMP6 DNA, complete sequence 24963-24994 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH401970 Enterobacter hormaechei subsp. steigerwaltii strain MED plasmid unnamed, complete sequence 7874-7905 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MG764553 Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence 43093-43124 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NC_014385 Escherichia coli plasmid pEC_L46, complete sequence 112249-112280 4 0.875
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_MH536949 Citrobacter freundii strain AA535 plasmid pIBACIncN, complete sequence 33971-34002 4 0.875
NC_020260_20 20.1|4309905|30|NC_020260|CRISPRCasFinder 4309905-4309934 30 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 207884-207913 4 0.867
NC_020260_5 5.1|1706330|27|NC_020260|CRISPRCasFinder 1706330-1706356 27 NZ_CP019638 Nostocales cyanobacterium HT-58-2 plasmid pHT582-2, complete sequence 1261-1287 5 0.815
NC_020260_9 9.1|2538705|28|NC_020260|CRISPRCasFinder 2538705-2538732 28 NZ_CP024907 Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence 158113-158140 5 0.821
NC_020260_10 10.2|2714261|30|NC_020260|CRT 2714261-2714290 30 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 34854-34883 5 0.833
NC_020260_10 10.2|2714261|30|NC_020260|CRT 2714261-2714290 30 NZ_LT703506 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2 253028-253057 6 0.8
NC_020260_10 10.2|2714261|30|NC_020260|CRT 2714261-2714290 30 MK224592 UNVERIFIED: Mycobacterium phage Henu3, complete genome 39591-39620 6 0.8
NC_020260_10 10.3|2714309|30|NC_020260|CRT 2714309-2714338 30 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 34854-34883 6 0.8
NC_020260_11 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820617-2820648 32 NZ_CP033075 Buttiauxella sp. 3AFRM03 plasmid pBTX_57, complete sequence 35974-36005 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KX711879 Pseudomonas aeruginosa strain P378 plasmid P378-IMP, complete sequence 20234-20265 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KX928750 Klebsiella pneumoniae strain CRKP-1-KPC plasmid pCRKP-1-KPC, complete sequence 17304-17335 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KX881941 Klebsiella pneumoniae subsp. pneumoniae strain H154180724 plasmid pJF-WMKPCN1, complete sequence 36742-36773 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KX928751 Klebsiella pneumoniae strain CRKP-5-KPC plasmid pCRKP-5-KPC, complete sequence 24936-24967 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MF072962 Citrobacter freundii strain P10159 plasmid pP10159-2, complete sequence 20234-20265 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KY271415 Klebsiella pneumoniae strain H151400611 plasmid IncN_typeC, complete sequence 43179-43210 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KY271414 Klebsiella pneumoniae strain H151440672 plasmid IncN_typeB, complete sequence 35598-35629 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KY128483 Klebsiella oxytoca strain 97_38 plasmid pKm38_N, complete sequence 17744-17775 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KT982614 Escherichia coli strain CRE1504 plasmid pIMP-HK1504, complete sequence 34831-34862 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KT982615 Escherichia coli strain CRE1505 plasmid pIMP-FS1505, complete sequence 34831-34862 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KX711880 Klebsiella pneumoniae strain 1220 plasmid p1220-IMP, complete sequence 15293-15324 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KT982618 Escherichia coli strain CRE1517 plasmid pIMP-GZ1517, complete sequence 31971-32002 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KU295131 Escherichia coli strain BK28009 plasmid pBK28009, complete sequence 17888-17919 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KY128484 Klebsiella michiganensis strain 97_58 plasmid pKm38_N, complete sequence 18041-18072 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KU051707 Escherichia coli strain CRE1502 plasmid pIMP-SZ1502, complete sequence 31744-31775 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KT982613 Klebsiella pneumoniae strain CRE 1496 plasmid pIMP1496, complete sequence 31372-31403 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KU886034 Klebsiella pneumoniae strain Kp1 plasmid pIMP-HZ1, complete sequence 31981-32012 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KU862632 Klebsiella pneumoniae strain CRE1495 plasmid pIMP-KP1495, complete sequence 31973-32004 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KU051710 Citrobacter freundii strain CRE1503 plasmid pIMP-FJ1503, complete sequence 31537-31568 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KT989598 Enterobacter cloacae strain CRE1506 plasmid pIMP-SH1506, complete sequence 35051-35082 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KM977631 Klebsiella pneumoniae strain CRE1495 plasmid pIMP-1495, complete sequence 42496-42527 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KM660724 Morganella morganii strain MRSN22709 plasmid pMR3-OXA181, complete sequence 16273-16304 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KU051708 Klebsiella pneumoniae strain CRE1501 plasmid pIMP-SZ1501, complete sequence 31851-31882 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KU051709 Escherichia coli strain CRE1058 plasmid pIMP-GZ1058, complete sequence 31982-32013 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KT982616 Escherichia coli strain CRE1509 plasmid pIMP-HK1509, complete sequence 34831-34862 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KU295134 Escherichia coli strain BK32602 plasmid pBK32602, complete sequence 17446-17477 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KJ440076 Escherichia coli strain CGMHLK75 plasmid pLK75, complete sequence 13553-13584 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_014368 Klebsiella pneumoniae plasmid pNL194, complete sequence 8528-8559 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_020086 Escherichia coli plasmid pE66An, complete sequence 49233-49264 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 LT221037 Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence 42464-42495 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 LT221038 Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence 64846-64877 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP031259 Klebsiella quasipneumoniae strain L22 plasmid pL22-2, complete sequence 41211-41242 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_021660 Klebsiella pneumoniae FCF3SP plasmid pKPC_FCF/3SP, complete sequence 41756-41787 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_021664 Klebsiella pneumoniae FCF1305 plasmid pKPC_FCF13/05, complete sequence 40232-40263 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP028486 Escherichia coli strain E41-1 plasmid p3, complete sequence 52024-52055 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP023420 Klebsiella pneumoniae strain 1050 plasmid pKp1050-4, complete sequence 18116-18147 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MK878892 Escherichia coli strain J53 plasmid pMG333, complete sequence 81320-81351 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP026277 Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence 45290-45321 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP033394 Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence 109854-109885 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_LS998787 Escherichia coli isolate EC-TO75 plasmid 3, complete sequence 10033-10064 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KJ440075 Klebsiella pneumoniae strain CGMHLK78 plasmid pLK78, complete sequence 28710-28741 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP009881 Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence 17981-18012 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 MT077883 Escherichia coli plasmid p23, complete sequence 35012-35043 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP026169 Leclercia sp. LSNIH1 plasmid pKPC-79f0, complete sequence 54282-54313 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 CP052433 Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-2, complete sequence 20788-20819 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_LT838197 Escherichia coli isolate WI1 isolate plasmid pWI1-KPC3, complete sequence 36216-36247 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_LS992177 Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence 40797-40828 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 LN610760 Citrobacter freundii plasmid pCF8698_KPC2, strain CF8698, complete sequence 41187-41218 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP036363 Klebsiella pneumoniae strain WCHKP2080 plasmid p1_095080, complete sequence 21757-21788 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_025019 Klebsiella pneumoniae subsp. ozaenae plasmid pKo6, complete sequence 22188-22219 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 CP009867 Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence 21649-21680 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP044159 Shigella flexneri strain AR-0423 plasmid pAR-0423-1, complete sequence 29136-29167 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_015599 Escherichia coli IncN plasmid N3, complete sequence 21158-21189 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_021238 Klebsiella pneumoniae strain Kpn-1433 plasmid pKP1433, complete sequence 9596-9627 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 MN891676 Klebsiella pneumoniae strain 24169 plasmid p24169-KPC, complete sequence 15788-15819 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 MN891682 Klebsiella pneumoniae strain 116753 plasmid p116753-KPC, complete sequence 110828-110859 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 CP052359 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-3, complete sequence 23593-23624 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 CP052446 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-3, complete sequence 21870-21901 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP040895 Leclercia adecarboxylata strain Z96-1 plasmid pIMP-Z96-1, complete sequence 63349-63380 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP014524 Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence 18412-18443 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_025186 Klebsiella pneumoniae subsp. pneumoniae strain OW16C2 plasmid pOW16C2, complete sequence 18309-18340 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP040178 Klebsiella pneumoniae strain 2e plasmid unnamed3, complete sequence 54319-54350 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP019006 Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_2, complete sequence 31135-31166 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 213948-213979 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP044187 Salmonella enterica subsp. enterica strain AR-0402 plasmid pAR-0402 16417-16448 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP026757 Klebsiella aerogenes strain AR_0062 plasmid tig00000053_pilon, complete sequence 10286-10317 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP035387 Enterobacter hormaechei strain S11_16 plasmid unnamed2, complete sequence 17068-17099 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP052872 Enterobacter cloacae strain 3849 plasmid p3846_IncN_VIM-1, complete sequence 9676-9707 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP018963 Escherichia coli strain Ecol_517 plasmid pEC517_KPC, complete sequence 36284-36315 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_021622 Klebsiella pneumoniae plasmid pK45-67VIM complete sequence 32308-32339 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP018884 Klebsiella pneumoniae subsp. pneumoniae strain BR7 plasmid unnamed1, complete sequence 43148-43179 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP028958 Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence 32422-32453 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP039821 Klebsiella pneumoniae strain C2414 plasmid pC2414-3-NDM, complete sequence 17928-17959 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_025183 Escherichia coli strain ECN580 plasmid pECN580, complete sequence 21574-21605 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP018887 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence 88851-88882 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP032203 Escherichia coli strain AR_0086 plasmid unnamed2, complete sequence 35468-35499 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP040859 Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence 4148-4179 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_024967 Escherichia coli strain YD626E plasmid pYD626E, complete sequence 15728-15759 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_019082 Escherichia coli plasmid pZS50, complete sequence 31063-31094 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP046118 Enterobacter cloacae strain CBG15936 plasmid pNDM1-CBG, complete sequence 18526-18557 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 KF534788 Escherichia coli plasmid pNDM-BTR, complete sequence 17150-17181 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP009862 Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence 17981-18012 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_014208 Klebsiella oxytoca KOX105 plasmid pKOX105, complete sequence 11614-11645 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_023909 Escherichia coli strain EcNDM1 plasmid pEcNDM1, complete sequence 30830-30861 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_023910 Escherichia coli strain EcNDM0 plasmid pEcNDM0, complete sequence 26018-26049 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP009864 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence 17981-18012 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP009874 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence 23954-23985 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_LT985266 Escherichia coli strain 177 plasmid RCS53_p, complete sequence 11184-11215 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP009853 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pKPC-860, complete sequence 17981-18012 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP042533 Klebsiella aerogenes strain C9 plasmid pC9_003, complete sequence 25245-25276 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP018977 Escherichia coli strain Ecol_656 plasmid pEC656_KPC, complete sequence 36284-36315 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP011589 Enterobacter asburiae strain CAV1043 plasmid pKPC_CAV1043, complete sequence 31910-31941 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP026389 Leclercia sp. LSNIH3 plasmid pKPC-3714, complete sequence 4442-4473 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP008901 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pKPC-47e, complete sequence 17981-18012 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_032101 Enterobacter cloacae plasmid pG6809-2, complete sequence 17867-17898 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP025965 Klebsiella pneumoniae strain WCHKP34 plasmid pNDM1_LL34, complete sequence 18521-18552 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP020066 Klebsiella pneumoniae strain AR_0117 plasmid unitig_5, complete sequence 43349-43380 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 MN178639 Kluyvera cryocrescens strain SCW13 plasmid pSCW13-1, complete sequence 26153-26184 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP038278 Raoultella ornithinolytica strain WLK218 plasmid pWLK-IncN, complete sequence 53028-53059 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 CP050160 Escherichia coli plasmid Carbapenemase(IMP-4)_IncN, complete sequence 21561-21592 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP050859 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-NDM, complete sequence 18521-18552 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_014385 Escherichia coli plasmid pEC_L46, complete sequence 96905-96936 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP025758 Citrobacter freundii complex sp. CFNIH12 strain CFNIH2 plasmid pKPC-349c, complete sequence 17981-18012 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 CP050159 Enterobacter cloacae plasmid Carbapenemase(IMP-26)_IncN, complete sequence 22326-22357 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP018945 Escherichia coli strain Ecol_224 plasmid pEC224_KPC, complete sequence 41657-41688 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP018959 Escherichia coli strain Ecol_422 plasmid pEC422_KPC, complete sequence 30266-30297 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP019026 Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence 48968-48999 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP026213 Citrobacter sp. CFNIH10 plasmid pKPC-933d, complete sequence 169296-169327 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP045022 Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-KPC14, complete sequence 16967-16998 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 AP022367 Escherichia coli E317 plasmid pE317_IMP6 DNA, complete sequence 69328-69359 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 AP022370 Klebsiella pneumoniae E328 plasmid pE328_IMP6 DNA, complete sequence 77938-77969 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP028582 Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence 29625-29656 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP025710 Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence 21350-21381 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP030335 Escherichia coli strain AR_451 plasmid unnamed1, complete sequence 11941-11972 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP036368 Klebsiella pneumoniae strain WCHKP115068 plasmid p1_115068, complete sequence 27445-27476 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP033830 Serratia sp. FDAARGOS_506 plasmid unnamed, complete sequence 15408-15439 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_011383 Klebsiella pneumoniae plasmid 9, complete sequence 58668-58699 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_011385 Klebsiella pneumoniae plasmid 12, complete sequence 55699-55730 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 KC170280 Uncultured bacterium plasmid pDS2, complete sequence 30940-30971 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP026496 Klebsiella pneumoniae strain 616 plasmid pKp616_1, complete sequence 12296-12327 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 AP022354 Escherichia coli E033 plasmid pE033_IMP6 DNA, complete sequence 45356-45387 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 AP022355 Escherichia coli E034 plasmid pE034_IMP6 DNA, complete sequence 81771-81802 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 AP022356 Escherichia coli E119 plasmid pE119_5kIMP6 DNA, complete sequence 21761-21792 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 AP022358 Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence 34046-34077 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 AP022359 Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence 107653-107684 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_011617 Klebsiella pneumoniae plasmid pKP96, complete sequence 40191-40222 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 AP022349 Klebsiella pneumoniae E105 plasmid pKPI-1 DNA, complete sequence 21203-21234 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_022374 Escherichia coli plasmid pHKU1, complete sequence 26714-26745 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_AP018362 Escherichia coli strain A56-1S plasmid pA56-1S, complete sequence 24225-24256 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_AP019550 Klebsiella pneumoniae strain THC11 plasmid pTHC11-2, complete sequence 22556-22587 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_AP018363 Escherichia coli strain A56-1R plasmid pA56-1R, complete sequence 33825-33856 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 CP052394 Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-2, complete sequence 29221-29252 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_AP019403 Klebsiella pneumoniae strain E129 plasmid pE129_IMP6, complete sequence 21949-21980 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_AP019402 Klebsiella pneumoniae strain E013 plasmid pE013_IMP6, complete sequence 21949-21980 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_AP019404 Klebsiella pneumoniae strain E188 plasmid pE188_IMP6, complete sequence 23289-23320 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 71027-71058 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP021734 Escherichia coli strain AR_0114 plasmid unitig_2, complete sequence 51904-51935 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP026590 Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence 27367-27398 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP023981 Klebsiella variicola strain X39 plasmid pX39-4, complete sequence 36582-36613 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_LR745047 Klebsiella pneumoniae isolate Kpn2166 plasmid pCTX-M15_Kpn2166 47027-47058 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MK878894 Escherichia coli strain J53 plasmid pMG334, complete sequence 42423-42454 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MK416183 Escherichia coli strain Ec-2Lar plasmid unnamed, complete sequence 24806-24837 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MN241904 Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM62, complete sequence 34738-34769 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MH909344 Enterobacter cloacae strain 12949 plasmid p12949-FIIY, complete sequence 155283-155314 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MH909339 Klebsiella pneumoniae strain 24632 plasmid p24632-IMP, complete sequence 20271-20302 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MH909337 Klebsiella pneumoniae strain 20389 plasmid p20389-IMP, complete sequence 20345-20376 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MH909334 Klebsiella pneumoniae strain 13-sp plasmid p13SP-IMP, complete sequence 20976-21007 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MH909336 Klebsiella pneumoniae strain 201311334 plasmid p11334-IMP, complete sequence 8896-8927 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MH909328 Klebsiella pneumoniae strain D920 plasmid pD920-IMP, complete sequence 20997-21028 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MH917123 Klebsiella pneumoniae strain Kp735 plasmid pSZN_KPC, complete sequence 22243-22274 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MK036890 Klebsiella pneumoniae strain D610 plasmid pD610-1IMP, complete sequence 6571-6602 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MK862125 Enterobacter hormaechei strain 1-RC-17-04408-5 plasmid P04408-5-KPC40, complete sequence 17744-17775 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MG886286 Escherichia coli strain ECSIC9 plasmid pECSIC9, complete sequence 33357-33388 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MH536949 Citrobacter freundii strain AA535 plasmid pIBACIncN, complete sequence 8855-8886 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MH401970 Enterobacter hormaechei subsp. steigerwaltii strain MED plasmid unnamed, complete sequence 32594-32625 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MH727565 Citrobacter freundii strain ECL-14-57 plasmid pIMP-ECL14-57, complete sequence 32810-32841 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MG878866 Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence 103266-103297 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_KY271413 Klebsiella pneumoniae strain KL49 plasmid IncN_typeA, complete sequence 39406-39437 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MF344557 Klebsiella pneumoniae strain 10677 plasmid p10677-IMP, complete sequence 32810-32841 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_MG764553 Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence 18759-18790 6 0.812
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NZ_CP020059 Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence 57932-57963 6 0.812
NC_020260_18 18.1|3798132|27|NC_020260|CRISPRCasFinder 3798132-3798158 27 NZ_CP041974 Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 plasmid unnamed1, complete sequence 110791-110817 6 0.778
NC_020260_20 20.1|4309905|30|NC_020260|CRISPRCasFinder 4309905-4309934 30 NZ_CP010421 Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence 255435-255464 6 0.8
NC_020260_2 2.1|146459|29|NC_020260|CRISPRCasFinder 146459-146487 29 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 693796-693824 7 0.759
NC_020260_10 10.3|2714309|30|NC_020260|CRT 2714309-2714338 30 NZ_CP020811 Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed2, complete sequence 48929-48958 7 0.767
NC_020260_10 10.3|2714309|30|NC_020260|CRT 2714309-2714338 30 NZ_CP038032 Rhodococcus ruber strain R1 plasmid unnamed2, complete sequence 15599-15628 7 0.767
NC_020260_12 12.6|2847531|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2847531-2847562 32 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 489929-489960 7 0.781
NC_020260_12 12.6|2847531|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2847531-2847562 32 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 512027-512058 7 0.781
NC_020260_12 12.6|2847531|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2847531-2847562 32 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 606837-606868 7 0.781
NC_020260_12 12.15|2848080|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848080-2848111 32 MT701595 Streptomyces phage Shaeky, complete genome 31712-31743 7 0.781
NC_020260_12 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848202-2848233 32 NZ_CP013345 Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence 233593-233624 7 0.781
NC_020260_20 20.1|4309905|30|NC_020260|CRISPRCasFinder 4309905-4309934 30 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 373375-373404 7 0.767
NC_020260_10 10.2|2714261|30|NC_020260|CRT 2714261-2714290 30 NZ_CP014599 Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence 74435-74464 8 0.733
NC_020260_10 10.3|2714309|30|NC_020260|CRT 2714309-2714338 30 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 763722-763751 8 0.733
NC_020260_10 10.3|2714309|30|NC_020260|CRT 2714309-2714338 30 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 760798-760827 8 0.733
NC_020260_10 10.3|2714309|30|NC_020260|CRT 2714309-2714338 30 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 658911-658940 8 0.733
NC_020260_10 10.3|2714309|30|NC_020260|CRT 2714309-2714338 30 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 734133-734162 8 0.733
NC_020260_10 10.3|2714309|30|NC_020260|CRT 2714309-2714338 30 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 658026-658055 8 0.733
NC_020260_10 10.3|2714309|30|NC_020260|CRT 2714309-2714338 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 660853-660882 8 0.733
NC_020260_10 10.3|2714309|30|NC_020260|CRT 2714309-2714338 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 660843-660872 8 0.733
NC_020260_10 10.3|2714309|30|NC_020260|CRT 2714309-2714338 30 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 658898-658927 8 0.733
NC_020260_10 10.3|2714309|30|NC_020260|CRT 2714309-2714338 30 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 658917-658946 8 0.733
NC_020260_10 10.3|2714309|30|NC_020260|CRT 2714309-2714338 30 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 658895-658924 8 0.733
NC_020260_10 10.3|2714309|30|NC_020260|CRT 2714309-2714338 30 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 763787-763816 8 0.733
NC_020260_10 10.3|2714309|30|NC_020260|CRT 2714309-2714338 30 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 763787-763816 8 0.733
NC_020260_10 10.3|2714309|30|NC_020260|CRT 2714309-2714338 30 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 763772-763801 8 0.733
NC_020260_11 11.7|2820739|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820739-2820770 32 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 314548-314579 8 0.75
NC_020260_12 12.13|2847958|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2847958-2847989 32 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 352734-352765 8 0.75
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 MK448234 Klebsiella phage ST11-VIM1phi8.2, complete genome 43663-43694 8 0.75
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 MK416013 Klebsiella phage ST16-OXA48phi5.1, complete genome 10792-10823 8 0.75
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 KX758539 Mycobacterium phage Jaan, complete genome 34618-34649 8 0.75
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 EU744250 Mycobacterium virus Pukovnik, complete genome 34118-34149 8 0.75
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 MK448237 Klebsiella phage ST974-OXA48phi18.2, complete genome 4550-4581 8 0.75
NC_020260_12 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848324-2848355 32 NC_031279 Mycobacterium phage Bactobuster, complete genome 34266-34297 8 0.75
NC_020260_11 11.2|2820434|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT 2820434-2820465 32 MN694637 Marine virus AFVG_250M580, complete genome 3910-3941 9 0.719
NC_020260_12 12.1|2847227|31|NC_020260|CRT 2847227-2847257 31 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 176986-177016 9 0.71
NC_020260_12 12.10|2847775|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2847775-2847806 32 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 661895-661926 9 0.719
NC_020260_12 12.10|2847775|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2847775-2847806 32 AP014011 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C79-MedDCM-OCT-S38-C32, *** SEQUENCING IN PROGRESS *** 33834-33865 9 0.719
NC_020260_12 12.10|2847775|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2847775-2847806 32 AP013546 Uncultured phage_MedDCM-OCT-S37-C6 DNA, complete genome, group G9, isolate: uvMED-CGR-C79-MedDCM-OCT-S37-C6 35106-35137 9 0.719
NC_020260_12 12.12|2847897|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2847897-2847928 32 NC_024385 Leuconostoc phage phiLN12, complete genome 25163-25194 9 0.719
NC_020260_12 12.12|2847897|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2847897-2847928 32 KC013023 Leuconostoc phage phiLN04, complete genome 24283-24314 9 0.719
NC_020260_12 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848263-2848294 32 NZ_CP031163 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence 77919-77950 9 0.719
NC_020260_12 12.20|2848385|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848385-2848416 32 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 254107-254138 9 0.719
NC_020260_12 12.21|2848446|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848446-2848477 32 NZ_CP049813 Monaibacterium sp. ALG8 plasmid unnamed2, complete sequence 77940-77971 9 0.719
NC_020260_12 12.2|2847287|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2847287-2847318 32 NZ_CP045276 Bacillus megaterium strain FDU301 plasmid pFDU301D, complete sequence 81364-81395 10 0.688
NC_020260_12 12.2|2847287|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2847287-2847318 32 NC_016034 Lactobacillus buchneri subsp. silagei CD034 plasmid pCD034-2, complete sequence 612-643 10 0.688
NC_020260_12 12.5|2847470|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2847470-2847501 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 138618-138649 10 0.688
NC_020260_12 12.5|2847470|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2847470-2847501 32 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 574592-574623 10 0.688
NC_020260_12 12.21|2848446|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2848446-2848477 32 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 307277-307308 10 0.688
NC_020260_20 20.1|4309905|30|NC_020260|CRISPRCasFinder 4309905-4309934 30 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 424214-424243 10 0.667
NC_020260_12 12.2|2847287|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2847287-2847318 32 MN693792 Marine virus AFVG_250M943, complete genome 23751-23782 11 0.656
NC_020260_12 12.2|2847287|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder 2847287-2847318 32 MN694234 Marine virus AFVG_250M972, complete genome 19332-19363 11 0.656

1. spacer 12.8|2847653|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023822 (Escherichia coli strain 7/2 plasmid p7_2.2, complete sequence) position: , mismatch: 0, identity: 1.0

acgctggtatctaataagcgtacctatatttt	CRISPR spacer
acgctggtatctaataagcgtacctatatttt	Protospacer
********************************

2. spacer 12.16|2848141|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JF314845 (Cronobacter phage ES2, complete genome) position: , mismatch: 1, identity: 0.969

ttgattttggcaacccattcaatgccctgaga	CRISPR spacer
ttgattttggcaacccattcaatgccctgagc	Protospacer
******************************* 

3. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX711879 (Pseudomonas aeruginosa strain P378 plasmid P378-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

4. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX928750 (Klebsiella pneumoniae strain CRKP-1-KPC plasmid pCRKP-1-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

5. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF072962 (Citrobacter freundii strain P10159 plasmid pP10159-2, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

6. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271415 (Klebsiella pneumoniae strain H151400611 plasmid IncN_typeC, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

7. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271414 (Klebsiella pneumoniae strain H151440672 plasmid IncN_typeB, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

8. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY128483 (Klebsiella oxytoca strain 97_38 plasmid pKm38_N, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

9. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982614 (Escherichia coli strain CRE1504 plasmid pIMP-HK1504, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

10. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982615 (Escherichia coli strain CRE1505 plasmid pIMP-FS1505, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

11. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX711880 (Klebsiella pneumoniae strain 1220 plasmid p1220-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

12. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982618 (Escherichia coli strain CRE1517 plasmid pIMP-GZ1517, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

13. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU295131 (Escherichia coli strain BK28009 plasmid pBK28009, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

14. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY128484 (Klebsiella michiganensis strain 97_58 plasmid pKm38_N, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

15. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051707 (Escherichia coli strain CRE1502 plasmid pIMP-SZ1502, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

16. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982613 (Klebsiella pneumoniae strain CRE 1496 plasmid pIMP1496, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

17. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU886034 (Klebsiella pneumoniae strain Kp1 plasmid pIMP-HZ1, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

18. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU862632 (Klebsiella pneumoniae strain CRE1495 plasmid pIMP-KP1495, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

19. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051710 (Citrobacter freundii strain CRE1503 plasmid pIMP-FJ1503, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

20. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT989598 (Enterobacter cloacae strain CRE1506 plasmid pIMP-SH1506, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

21. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KM977631 (Klebsiella pneumoniae strain CRE1495 plasmid pIMP-1495, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

22. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KM660724 (Morganella morganii strain MRSN22709 plasmid pMR3-OXA181, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

23. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051708 (Klebsiella pneumoniae strain CRE1501 plasmid pIMP-SZ1501, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

24. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051709 (Escherichia coli strain CRE1058 plasmid pIMP-GZ1058, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

25. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982616 (Escherichia coli strain CRE1509 plasmid pIMP-HK1509, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

26. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU295134 (Escherichia coli strain BK32602 plasmid pBK32602, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

27. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ440076 (Escherichia coli strain CGMHLK75 plasmid pLK75, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

28. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014231 (Escherichia coli plasmid pKC394, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

29. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LT221037 (Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

30. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LT221038 (Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

31. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MK356560 (Salmonella sp. strain Sa1423 plasmid pSa1423-50K, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

32. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031259 (Klebsiella quasipneumoniae strain L22 plasmid pL22-2, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

33. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031259 (Klebsiella quasipneumoniae strain L22 plasmid pL22-2, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

34. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP048785 (Serratia liquefaciens strain S1 plasmid pSl1, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

35. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP045256 (Proteus mirabilis strain L90-1 plasmid pL901, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

36. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021660 (Klebsiella pneumoniae FCF3SP plasmid pKPC_FCF/3SP, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

37. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028486 (Escherichia coli strain E41-1 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

38. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_007682 (Escherichia coli plasmid pMUR050, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

39. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043186 (Escherichia coli O16:H48 strain PG20180171 plasmid pPG20180171.1-IncN, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

40. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026053 (Salmonella enterica strain FDAARGOS_70 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

41. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018646 (Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 plasmid pSE79-2359, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

42. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023420 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-4, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

43. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK878892 (Escherichia coli strain J53 plasmid pMG333, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

44. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026277 (Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

45. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033394 (Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

46. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS998788 (Escherichia coli isolate EC-TO75 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

47. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ440075 (Klebsiella pneumoniae strain CGMHLK78 plasmid pLK78, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

48. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026236 (Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

49. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

50. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009881 (Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

51. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026169 (Leclercia sp. LSNIH1 plasmid pKPC-79f0, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

52. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052433 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-2, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

53. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT838197 (Escherichia coli isolate WI1 isolate plasmid pWI1-KPC3, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

54. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992177 (Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

55. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LN610760 (Citrobacter freundii plasmid pCF8698_KPC2, strain CF8698, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

56. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102341 (Uncultured bacterium plasmid pRSB201, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

57. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102342 (Uncultured bacterium plasmid pRSB203, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

58. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102343 (Uncultured bacterium plasmid pRSB205, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

59. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102344 (Uncultured bacterium plasmid pRSB206, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

60. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028173 (Salmonella enterica strain CFSAN064033 plasmid pGMI17-001_1, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

61. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021730 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-4, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

62. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036363 (Klebsiella pneumoniae strain WCHKP2080 plasmid p1_095080, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

63. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025019 (Klebsiella pneumoniae subsp. ozaenae plasmid pKo6, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

64. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP009867 (Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

65. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020527 (Enterobacter cloacae strain 109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

66. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044159 (Shigella flexneri strain AR-0423 plasmid pAR-0423-1, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

67. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP042643 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-5, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

68. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN891676 (Klebsiella pneumoniae strain 24169 plasmid p24169-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

69. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052359 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-3, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

70. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052446 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-3, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

71. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040895 (Leclercia adecarboxylata strain Z96-1 plasmid pIMP-Z96-1, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

72. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014524 (Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

73. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025186 (Klebsiella pneumoniae subsp. pneumoniae strain OW16C2 plasmid pOW16C2, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

74. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040178 (Klebsiella pneumoniae strain 2e plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

75. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

76. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_024974 (Escherichia coli plasmid pL2-43, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

77. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044187 (Salmonella enterica subsp. enterica strain AR-0402 plasmid pAR-0402) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

78. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026757 (Klebsiella aerogenes strain AR_0062 plasmid tig00000053_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

79. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP035387 (Enterobacter hormaechei strain S11_16 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

80. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052872 (Enterobacter cloacae strain 3849 plasmid p3846_IncN_VIM-1, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

81. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012143 (Shigella flexneri 4c strain 1205 plasmid 1205p3, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

82. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018963 (Escherichia coli strain Ecol_517 plasmid pEC517_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

83. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019033 (Escherichia coli plasmid pQNR2078, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

84. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021622 (Klebsiella pneumoniae plasmid pK45-67VIM complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

85. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033359 (Salmonella enterica subsp. enterica strain EQAS2016S1 plasmid pEQAS2016S1-1, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

86. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028958 (Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

87. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039821 (Klebsiella pneumoniae strain C2414 plasmid pC2414-3-NDM, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

88. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018758 (Metakosakonia sp. MRY16-398 plasmid pMRY16-398_2, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

89. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025183 (Escherichia coli strain ECN580 plasmid pECN580, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

90. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_003292 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R46, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

91. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018887 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

92. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018887 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

93. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032203 (Escherichia coli strain AR_0086 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

94. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040859 (Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

95. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_024967 (Escherichia coli strain YD626E plasmid pYD626E, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

96. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

97. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019098 (Escherichia coli strain HHA45 plasmid pHHA45, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

98. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP046118 (Enterobacter cloacae strain CBG15936 plasmid pNDM1-CBG, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

99. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017086 (Proteus mirabilis strain T18 plasmid pT18, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

100. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to KF534788 (Escherichia coli plasmid pNDM-BTR, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

101. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009862 (Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

102. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014208 (Klebsiella oxytoca KOX105 plasmid pKOX105, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

103. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_023909 (Escherichia coli strain EcNDM1 plasmid pEcNDM1, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

104. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_023910 (Escherichia coli strain EcNDM0 plasmid pEcNDM0, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

105. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009864 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

106. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009874 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

107. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009874 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

108. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985266 (Escherichia coli strain 177 plasmid RCS53_p, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

109. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025141 (Escherichia coli plasmid pH1038-142, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

110. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009853 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pKPC-860, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

111. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042533 (Klebsiella aerogenes strain C9 plasmid pC9_003, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

112. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018977 (Escherichia coli strain Ecol_656 plasmid pEC656_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

113. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011589 (Enterobacter asburiae strain CAV1043 plasmid pKPC_CAV1043, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

114. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026389 (Leclercia sp. LSNIH3 plasmid pKPC-3714, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

115. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP008901 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pKPC-47e, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

116. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019124 (Salmonella enterica subsp. enterica serovar Virchow plasmid pVQS1, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

117. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025965 (Klebsiella pneumoniae strain WCHKP34 plasmid pNDM1_LL34, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

118. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020066 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_5, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

119. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022157 (Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

120. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015389 (Klebsiella pneumoniae strain NY9 plasmid pNY9_4, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

121. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN178639 (Kluyvera cryocrescens strain SCW13 plasmid pSCW13-1, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

122. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038278 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-IncN, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

123. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038278 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-IncN, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

124. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025233 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 plasmid pSNE1-1925, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

125. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP050160 (Escherichia coli plasmid Carbapenemase(IMP-4)_IncN, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

126. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050859 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-NDM, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

127. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025758 (Citrobacter freundii complex sp. CFNIH12 strain CFNIH2 plasmid pKPC-349c, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

128. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP050159 (Enterobacter cloacae plasmid Carbapenemase(IMP-26)_IncN, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

129. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019087 (Escherichia coli O25b:H4-ST131 str. EC958 plasmid pKC396, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

130. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018945 (Escherichia coli strain Ecol_224 plasmid pEC224_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

131. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017083 (Proteus mirabilis strain T21 plasmid pT211, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

132. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019026 (Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

133. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019026 (Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

134. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026211 (Citrobacter sp. CFNIH10 plasmid pCIT-eb1a, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

135. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022367 (Escherichia coli E317 plasmid pE317_IMP6 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

136. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027050 (Klebsiella pneumoniae strain 20_GR_12 plasmid IncN, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

137. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028579 (Klebsiella pneumoniae strain WCHKP36 plasmid p1_020036, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

138. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MH339998 (Uncultured bacterium plasmid pHTP1 clone AA-110, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

139. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025710 (Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

140. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026198 (Enterobacteriaceae bacterium ENNIH3 plasmid pKPC-c606, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

141. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030335 (Escherichia coli strain AR_451 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

142. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036368 (Klebsiella pneumoniae strain WCHKP115068 plasmid p1_115068, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

143. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

144. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_009132 (Escherichia coli plasmid pLEW517, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

145. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025984 (Enterobacteriaceae bacterium A-F18 plasmid pAF18_2, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

146. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031109 (Escherichia coli strain AMSCJX02 plasmid pAMSC4, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

147. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033830 (Serratia sp. FDAARGOS_506 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

148. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_011383 (Klebsiella pneumoniae plasmid 9, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

149. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042581 (Enterobacter kobei strain C16 plasmid pC16_003, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

150. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020119 (Escherichia coli strain AR_0104 plasmid unitig_7, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

151. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_022885 (Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

152. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to KC170280 (Uncultured bacterium plasmid pDS2, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

153. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043224 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.2-IncN, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

154. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026496 (Klebsiella pneumoniae strain 616 plasmid pKp616_1, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

155. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022354 (Escherichia coli E033 plasmid pE033_IMP6 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

156. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022355 (Escherichia coli E034 plasmid pE034_IMP6 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

157. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022356 (Escherichia coli E119 plasmid pE119_5kIMP6 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

158. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

159. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022359 (Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

160. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_011617 (Klebsiella pneumoniae plasmid pKP96, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

161. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043184 (Escherichia coli O16:H48 strain PG20180172 plasmid pPG20180172.1-IncN, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

162. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043188 (Escherichia coli O16:H48 strain PG20180170 plasmid pPG20180170.1-IncN, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

163. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022349 (Klebsiella pneumoniae E105 plasmid pKPI-1 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

164. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_022374 (Escherichia coli plasmid pHKU1, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

165. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018362 (Escherichia coli strain A56-1S plasmid pA56-1S, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

166. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019550 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-2, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

167. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018363 (Escherichia coli strain A56-1R plasmid pA56-1R, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

168. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052394 (Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-2, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

169. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019403 (Klebsiella pneumoniae strain E129 plasmid pE129_IMP6, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

170. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019402 (Klebsiella pneumoniae strain E013 plasmid pE013_IMP6, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

171. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019404 (Klebsiella pneumoniae strain E188 plasmid pE188_IMP6, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

172. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

173. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018649 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-1, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

174. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026590 (Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

175. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023981 (Klebsiella variicola strain X39 plasmid pX39-4, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

176. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR745047 (Klebsiella pneumoniae isolate Kpn2166 plasmid pCTX-M15_Kpn2166) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

177. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018643 (Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

178. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985259 (Escherichia coli strain 592 plasmid RCS44_p, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

179. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985245 (Escherichia coli strain 523 plasmid RCS42_p, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

180. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985242 (Escherichia coli strain 604 plasmid RCS43_p, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

181. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985251 (Escherichia coli strain 502 plasmid RCS45_p, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

182. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK878894 (Escherichia coli strain J53 plasmid pMG334, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

183. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK416183 (Escherichia coli strain Ec-2Lar plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

184. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK416152 (Escherichia coli strain 6BS17eCTX plasmid pHNBS17e, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

185. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MN241904 (Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM62, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

186. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019888 (Klebsiella pneumoniae strain BK31551 plasmid pBK31551, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

187. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909339 (Klebsiella pneumoniae strain 24632 plasmid p24632-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

188. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909337 (Klebsiella pneumoniae strain 20389 plasmid p20389-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

189. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909334 (Klebsiella pneumoniae strain 13-sp plasmid p13SP-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

190. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909336 (Klebsiella pneumoniae strain 201311334 plasmid p11334-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

191. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909328 (Klebsiella pneumoniae strain D920 plasmid pD920-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

192. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH917123 (Klebsiella pneumoniae strain Kp735 plasmid pSZN_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

193. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK036890 (Klebsiella pneumoniae strain D610 plasmid pD610-1IMP, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

194. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH128095 (Klebsiella pneumoniae strain CZPF1510086 plasmid pTBCZNDM02, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

195. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK356561 (Escherichia coli strain J53 plasmid pSa1423TC-59K, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

196. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK356561 (Escherichia coli strain J53 plasmid pSa1423TC-59K, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

197. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK862125 (Enterobacter hormaechei strain 1-RC-17-04408-5 plasmid P04408-5-KPC40, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

198. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN657245 (Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

199. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN657246 (Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

200. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MT199177 (Escherichia coli strain 100 plasmid p100_NDM5_IncN, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

201. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG886286 (Escherichia coli strain ECSIC9 plasmid pECSIC9, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

202. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF474175 (Escherichia coli strain J53/pNIT-HK plasmid pNIT-HK, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

203. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF344559 (Enterobacter hormaechei strain 128379 plasmid p128379-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

204. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH727565 (Citrobacter freundii strain ECL-14-57 plasmid pIMP-ECL14-57, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

205. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG878866 (Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

206. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271413 (Klebsiella pneumoniae strain KL49 plasmid IncN_typeA, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

207. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF344557 (Klebsiella pneumoniae strain 10677 plasmid p10677-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

208. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF953243 (Klebsiella pneumoniae strain C5 plasmid pC5_41608, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

209. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG288677 (Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

210. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG904997 (Escherichia coli strain 15OD0495 plasmid p15ODMR, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

211. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020059 (Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggcg	Protospacer
*******************************.

212. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017725 (Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 strain SGSC 2518 isolate SARB61 plasmid pSARB26_02, complete sequence) position: , mismatch: 1, identity: 0.969

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaaaaattgccggtatcggct	Protospacer
******************************* 

213. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026282 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

214. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX711879 (Pseudomonas aeruginosa strain P378 plasmid P378-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

215. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX928750 (Klebsiella pneumoniae strain CRKP-1-KPC plasmid pCRKP-1-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

216. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX881941 (Klebsiella pneumoniae subsp. pneumoniae strain H154180724 plasmid pJF-WMKPCN1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

217. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX928751 (Klebsiella pneumoniae strain CRKP-5-KPC plasmid pCRKP-5-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

218. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY020154 (Klebsiella pneumoniae strain Kpn-431cz plasmid pKpn-431cz, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

219. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF072962 (Citrobacter freundii strain P10159 plasmid pP10159-2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

220. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY887592 (Citrobacter freundii strain Cf52 plasmid pCf52, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

221. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY887593 (Citrobacter freundii strain Cf53 plasmid pCf53, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

222. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY887594 (Klebsiella pneumoniae strain Kp55 plasmid pKp55, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

223. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271415 (Klebsiella pneumoniae strain H151400611 plasmid IncN_typeC, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

224. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271414 (Klebsiella pneumoniae strain H151440672 plasmid IncN_typeB, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

225. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY128483 (Klebsiella oxytoca strain 97_38 plasmid pKm38_N, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

226. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

227. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982614 (Escherichia coli strain CRE1504 plasmid pIMP-HK1504, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

228. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU355873 (Escherichia coli strain FAM22871 plasmid pFAM22871_1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

229. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982615 (Escherichia coli strain CRE1505 plasmid pIMP-FS1505, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

230. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX711880 (Klebsiella pneumoniae strain 1220 plasmid p1220-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

231. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982618 (Escherichia coli strain CRE1517 plasmid pIMP-GZ1517, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

232. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU295131 (Escherichia coli strain BK28009 plasmid pBK28009, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

233. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY128484 (Klebsiella michiganensis strain 97_58 plasmid pKm38_N, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

234. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051707 (Escherichia coli strain CRE1502 plasmid pIMP-SZ1502, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

235. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982613 (Klebsiella pneumoniae strain CRE 1496 plasmid pIMP1496, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

236. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU886034 (Klebsiella pneumoniae strain Kp1 plasmid pIMP-HZ1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

237. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU862632 (Klebsiella pneumoniae strain CRE1495 plasmid pIMP-KP1495, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

238. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051710 (Citrobacter freundii strain CRE1503 plasmid pIMP-FJ1503, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

239. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT989598 (Enterobacter cloacae strain CRE1506 plasmid pIMP-SH1506, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

240. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KM083064 (Vibrio cholerae strain ICDC-1447 plasmid pVC1447, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

241. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KM977631 (Klebsiella pneumoniae strain CRE1495 plasmid pIMP-1495, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

242. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KM660724 (Morganella morganii strain MRSN22709 plasmid pMR3-OXA181, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

243. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051708 (Klebsiella pneumoniae strain CRE1501 plasmid pIMP-SZ1501, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

244. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KM670336 (Salmonella enterica subsp. enterica serovar Senftenberg strain SRC119 plasmid pSRC119-A/C, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

245. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051709 (Escherichia coli strain CRE1058 plasmid pIMP-GZ1058, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

246. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982616 (Escherichia coli strain CRE1509 plasmid pIMP-HK1509, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

247. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU295134 (Escherichia coli strain BK32602 plasmid pBK32602, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

248. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ440076 (Escherichia coli strain CGMHLK75 plasmid pLK75, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

249. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014368 (Klebsiella pneumoniae plasmid pNL194, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

250. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014231 (Escherichia coli plasmid pKC394, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

251. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_020086 (Escherichia coli plasmid pE66An, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

252. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LT221037 (Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

253. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LT221038 (Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

254. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MK356560 (Salmonella sp. strain Sa1423 plasmid pSa1423-50K, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

255. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042628 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-1_MCR3, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

256. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042634 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-7, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

257. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031259 (Klebsiella quasipneumoniae strain L22 plasmid pL22-2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

258. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021660 (Klebsiella pneumoniae FCF3SP plasmid pKPC_FCF/3SP, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

259. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021664 (Klebsiella pneumoniae FCF1305 plasmid pKPC_FCF13/05, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

260. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017387 (Klebsiella pneumoniae strain KP36 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

261. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

262. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028486 (Escherichia coli strain E41-1 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

263. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_007682 (Escherichia coli plasmid pMUR050, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

264. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP026801 (Shigella sonnei strain ATCC 29930 plasmid unnamed) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

265. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043186 (Escherichia coli O16:H48 strain PG20180171 plasmid pPG20180171.1-IncN, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

266. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026053 (Salmonella enterica strain FDAARGOS_70 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

267. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018646 (Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 plasmid pSE79-2359, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

268. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023420 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-4, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

269. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LC055503 (Klebsiella pneumoniae plasmid pHM881QN DNA, complete sequence, strain: Y881) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

270. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_009980 (Salmonella enterica subsp. enterica serovar Dublin plasmid pMAK2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

271. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024192 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

272. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK878892 (Escherichia coli strain J53 plasmid pMG333, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

273. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026277 (Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

274. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033394 (Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

275. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS998787 (Escherichia coli isolate EC-TO75 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

276. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ440075 (Klebsiella pneumoniae strain CGMHLK78 plasmid pLK78, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

277. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042507 (Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

278. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_008612 (Photobacterium damselae subsp. piscicida plasmid pP99-018, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

279. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025470 (Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

280. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

281. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

282. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

283. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009881 (Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

284. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MT077883 (Escherichia coli plasmid p23, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

285. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026169 (Leclercia sp. LSNIH1 plasmid pKPC-79f0, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

286. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052433 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

287. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT838197 (Escherichia coli isolate WI1 isolate plasmid pWI1-KPC3, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

288. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992177 (Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

289. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_EU880929 (Klebsiella pneumoniae strain INS23K plasmid pLJ1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

290. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT904892 (Salmonella enterica subsp. enterica serovar Typhi strain 80-2002 plasmid 2) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

291. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LN610760 (Citrobacter freundii plasmid pCF8698_KPC2, strain CF8698, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

292. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102341 (Uncultured bacterium plasmid pRSB201, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

293. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102342 (Uncultured bacterium plasmid pRSB203, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

294. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102343 (Uncultured bacterium plasmid pRSB205, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

295. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102344 (Uncultured bacterium plasmid pRSB206, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

296. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028173 (Salmonella enterica strain CFSAN064033 plasmid pGMI17-001_1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

297. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021730 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-4, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

298. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036363 (Klebsiella pneumoniae strain WCHKP2080 plasmid p1_095080, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

299. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025019 (Klebsiella pneumoniae subsp. ozaenae plasmid pKo6, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

300. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP009867 (Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

301. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042646 (Escherichia coli strain NCYU-21-79 plasmid pNCYU-21-79-1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

302. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020527 (Enterobacter cloacae strain 109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

303. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044159 (Shigella flexneri strain AR-0423 plasmid pAR-0423-1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

304. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_015599 (Escherichia coli IncN plasmid N3, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

305. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021238 (Klebsiella pneumoniae strain Kpn-1433 plasmid pKP1433, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

306. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP042643 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-5, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

307. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN175387 (Klebsiella pneumoniae strain KP-14-6 plasmid pKP-14-6-NDM-1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

308. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN891676 (Klebsiella pneumoniae strain 24169 plasmid p24169-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

309. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN891682 (Klebsiella pneumoniae strain 116753 plasmid p116753-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

310. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052359 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-3, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

311. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052444 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

312. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052446 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-3, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

313. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040895 (Leclercia adecarboxylata strain Z96-1 plasmid pIMP-Z96-1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

314. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014524 (Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

315. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025186 (Klebsiella pneumoniae subsp. pneumoniae strain OW16C2 plasmid pOW16C2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

316. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040178 (Klebsiella pneumoniae strain 2e plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

317. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030077 (Enterobacter hormaechei strain 20710 plasmid p3-20710, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

318. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019006 (Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

319. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

320. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_024974 (Escherichia coli plasmid pL2-43, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

321. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP010513 (Enterobacter cloacae strain colR/S plasmid, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

322. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044187 (Salmonella enterica subsp. enterica strain AR-0402 plasmid pAR-0402) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

323. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

324. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN310378 (Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

325. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

326. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026757 (Klebsiella aerogenes strain AR_0062 plasmid tig00000053_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

327. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP035387 (Enterobacter hormaechei strain S11_16 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

328. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052872 (Enterobacter cloacae strain 3849 plasmid p3846_IncN_VIM-1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

329. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012143 (Shigella flexneri 4c strain 1205 plasmid 1205p3, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

330. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018963 (Escherichia coli strain Ecol_517 plasmid pEC517_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

331. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019033 (Escherichia coli plasmid pQNR2078, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

332. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021622 (Klebsiella pneumoniae plasmid pK45-67VIM complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

333. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033359 (Salmonella enterica subsp. enterica strain EQAS2016S1 plasmid pEQAS2016S1-1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

334. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018884 (Klebsiella pneumoniae subsp. pneumoniae strain BR7 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

335. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028958 (Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

336. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039821 (Klebsiella pneumoniae strain C2414 plasmid pC2414-3-NDM, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

337. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018758 (Metakosakonia sp. MRY16-398 plasmid pMRY16-398_2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

338. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025183 (Escherichia coli strain ECN580 plasmid pECN580, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

339. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_003292 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R46, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

340. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026206 (Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

341. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018887 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

342. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032203 (Escherichia coli strain AR_0086 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

343. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040859 (Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

344. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040024 (Klebsiella pneumoniae strain KPC160132 plasmid pIncC-L132, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

345. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_024967 (Escherichia coli strain YD626E plasmid pYD626E, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

346. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028996 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

347. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040039 (Klebsiella pneumoniae strain KPC160125 plasmid pIncC-L125) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

348. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040034 (Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

349. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022152 (Citrobacter freundii strain 705SK3 plasmid p705SK3_1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

350. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019098 (Escherichia coli strain HHA45 plasmid pHHA45, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

351. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

352. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP047350 (Proteus cibarius strain ZN2 plasmid pZN2-tetX-171kb, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

353. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019082 (Escherichia coli plasmid pZS50, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

354. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP046118 (Enterobacter cloacae strain CBG15936 plasmid pNDM1-CBG, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

355. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP043545 (Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

356. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to KF534788 (Escherichia coli plasmid pNDM-BTR, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

357. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009862 (Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

358. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014208 (Klebsiella oxytoca KOX105 plasmid pKOX105, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

359. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_023909 (Escherichia coli strain EcNDM1 plasmid pEcNDM1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

360. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_023910 (Escherichia coli strain EcNDM0 plasmid pEcNDM0, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

361. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009864 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

362. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009874 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

363. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985266 (Escherichia coli strain 177 plasmid RCS53_p, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

364. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP047345 (Proteus vulgaris strain ZN3 plasmid pZN3-tetX-171kb, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

365. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP047353 (Proteus mirabilis strain ZA25 plasmid pZA25-tetX-168kb, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

366. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025141 (Escherichia coli plasmid pH1038-142, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

367. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009853 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pKPC-860, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

368. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042533 (Klebsiella aerogenes strain C9 plasmid pC9_003, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

369. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018977 (Escherichia coli strain Ecol_656 plasmid pEC656_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

370. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011589 (Enterobacter asburiae strain CAV1043 plasmid pKPC_CAV1043, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

371. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026389 (Leclercia sp. LSNIH3 plasmid pKPC-3714, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

372. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026390 (Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

373. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013027 (Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

374. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP008901 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pKPC-47e, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

375. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041248 (Raoultella electrica strain DSM 102253 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

376. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019124 (Salmonella enterica subsp. enterica serovar Virchow plasmid pVQS1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

377. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_032101 (Enterobacter cloacae plasmid pG6809-2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

378. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025965 (Klebsiella pneumoniae strain WCHKP34 plasmid pNDM1_LL34, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

379. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020066 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_5, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

380. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022155 (Escherichia coli strain ABWA45 plasmid pABWA45_1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

381. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022157 (Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

382. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029436 (Klebsiella quasipneumoniae strain CAV2013 plasmid pKPC_CAV2013, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

383. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029431 (Klebsiella quasipneumoniae strain CAV2018 plasmid pKPC_CAV2018-435, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

384. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015389 (Klebsiella pneumoniae strain NY9 plasmid pNY9_4, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

385. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN178639 (Kluyvera cryocrescens strain SCW13 plasmid pSCW13-1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

386. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038278 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-IncN, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

387. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024557 (Klebsiella pneumoniae strain INF164 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

388. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025233 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 plasmid pSNE1-1925, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

389. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP050160 (Escherichia coli plasmid Carbapenemase(IMP-4)_IncN, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

390. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050859 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-NDM, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

391. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014385 (Escherichia coli plasmid pEC_L46, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

392. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025758 (Citrobacter freundii complex sp. CFNIH12 strain CFNIH2 plasmid pKPC-349c, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

393. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024529 (Klebsiella pneumoniae strain INF157 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

394. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP050159 (Enterobacter cloacae plasmid Carbapenemase(IMP-26)_IncN, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

395. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024522 (Klebsiella pneumoniae strain INF158 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

396. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012931 (Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

397. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021845 (Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

398. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019087 (Escherichia coli O25b:H4-ST131 str. EC958 plasmid pKC396, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

399. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018945 (Escherichia coli strain Ecol_224 plasmid pEC224_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

400. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018959 (Escherichia coli strain Ecol_422 plasmid pEC422_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

401. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017084 (Proteus mirabilis strain T21 plasmid pT212, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

402. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

403. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040029 (Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

404. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019026 (Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

405. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023724 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

406. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

407. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044075 (Providencia stuartii strain FDAARGOS_645 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

408. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MH061383 (Pseudomonas aeruginosa plasmid pP6qnrS1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

409. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026213 (Citrobacter sp. CFNIH10 plasmid pKPC-933d, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

410. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026213 (Citrobacter sp. CFNIH10 plasmid pKPC-933d, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

411. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP045016 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

412. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP045022 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-KPC14, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

413. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022367 (Escherichia coli E317 plasmid pE317_IMP6 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

414. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022370 (Klebsiella pneumoniae E328 plasmid pE328_IMP6 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

415. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027050 (Klebsiella pneumoniae strain 20_GR_12 plasmid IncN, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

416. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021899 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_4_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

417. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

418. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025710 (Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

419. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024550 (Klebsiella pneumoniae strain INF163 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

420. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026198 (Enterobacteriaceae bacterium ENNIH3 plasmid pKPC-c606, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

421. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030335 (Escherichia coli strain AR_451 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

422. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036368 (Klebsiella pneumoniae strain WCHKP115068 plasmid p1_115068, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

423. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

424. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_009132 (Escherichia coli plasmid pLEW517, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

425. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018672 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

426. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031109 (Escherichia coli strain AMSCJX02 plasmid pAMSC4, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

427. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033830 (Serratia sp. FDAARGOS_506 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

428. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_011383 (Klebsiella pneumoniae plasmid 9, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

429. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_011385 (Klebsiella pneumoniae plasmid 12, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

430. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to KC170280 (Uncultured bacterium plasmid pDS2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

431. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043224 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.2-IncN, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

432. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026234 (Citrobacter freundii complex sp. CFNIH4 plasmid pCFR-4109, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

433. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026496 (Klebsiella pneumoniae strain 616 plasmid pKp616_1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

434. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022354 (Escherichia coli E033 plasmid pE033_IMP6 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

435. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022355 (Escherichia coli E034 plasmid pE034_IMP6 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

436. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022356 (Escherichia coli E119 plasmid pE119_5kIMP6 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

437. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

438. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022359 (Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

439. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_011617 (Klebsiella pneumoniae plasmid pKP96, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

440. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_016839 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

441. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043184 (Escherichia coli O16:H48 strain PG20180172 plasmid pPG20180172.1-IncN, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

442. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043188 (Escherichia coli O16:H48 strain PG20180170 plasmid pPG20180170.1-IncN, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

443. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024564 (Klebsiella pneumoniae strain INF278 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

444. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022349 (Klebsiella pneumoniae E105 plasmid pKPI-1 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

445. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014775 (Aeromonas veronii strain AVNIH1 plasmid pASP-a58, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

446. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_022374 (Escherichia coli plasmid pHKU1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

447. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018362 (Escherichia coli strain A56-1S plasmid pA56-1S, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

448. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019550 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

449. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018363 (Escherichia coli strain A56-1R plasmid pA56-1R, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

450. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052394 (Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

451. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019403 (Klebsiella pneumoniae strain E129 plasmid pE129_IMP6, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

452. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019402 (Klebsiella pneumoniae strain E013 plasmid pE013_IMP6, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

453. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019404 (Klebsiella pneumoniae strain E188 plasmid pE188_IMP6, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

454. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

455. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT991956 (Enterobacter hormaechei subsp. steigerwaltii isolate C309 plasmid pC309-p2) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

456. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018649 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

457. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LC225353 (Photobacterium damselae subsp. piscicida plasmid pP0855 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

458. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021734 (Escherichia coli strain AR_0114 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

459. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026590 (Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

460. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023981 (Klebsiella variicola strain X39 plasmid pX39-4, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

461. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR745047 (Klebsiella pneumoniae isolate Kpn2166 plasmid pCTX-M15_Kpn2166) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

462. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027695 (Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

463. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018643 (Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

464. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985259 (Escherichia coli strain 592 plasmid RCS44_p, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

465. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985245 (Escherichia coli strain 523 plasmid RCS42_p, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

466. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985242 (Escherichia coli strain 604 plasmid RCS43_p, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

467. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985224 (Escherichia coli strain 513 plasmid RCS30_p, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

468. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985251 (Escherichia coli strain 502 plasmid RCS45_p, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

469. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026934 (Escherichia coli strain CFS3273 plasmid pCFS3273-2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

470. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK461931 (Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

471. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK878894 (Escherichia coli strain J53 plasmid pMG334, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

472. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK416183 (Escherichia coli strain Ec-2Lar plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

473. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MN101850 (Escherichia coli strain 13ZX28 plasmid p13ZX28-272, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

474. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MN101853 (Escherichia coli strain 13ZX36 plasmid p13ZX36-200, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

475. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MN241904 (Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM62, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

476. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019888 (Klebsiella pneumoniae strain BK31551 plasmid pBK31551, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

477. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909339 (Klebsiella pneumoniae strain 24632 plasmid p24632-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

478. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909337 (Klebsiella pneumoniae strain 20389 plasmid p20389-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

479. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909334 (Klebsiella pneumoniae strain 13-sp plasmid p13SP-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

480. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909336 (Klebsiella pneumoniae strain 201311334 plasmid p11334-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

481. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909328 (Klebsiella pneumoniae strain D920 plasmid pD920-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

482. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH917123 (Klebsiella pneumoniae strain Kp735 plasmid pSZN_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

483. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK036890 (Klebsiella pneumoniae strain D610 plasmid pD610-1IMP, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

484. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH287085 (Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

485. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH917284 (Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

486. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH287084 (Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

487. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH011352 (Klebsiella pneumoniae strain 185 plasmid pNDM-185, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

488. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH476540 (Klebsiella pneumoniae strain KP1276 plasmid pIA/C-KLUC, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

489. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK356561 (Escherichia coli strain J53 plasmid pSa1423TC-59K, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

490. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK862125 (Enterobacter hormaechei strain 1-RC-17-04408-5 plasmid P04408-5-KPC40, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

491. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MT199177 (Escherichia coli strain 100 plasmid p100_NDM5_IncN, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

492. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG886286 (Escherichia coli strain ECSIC9 plasmid pECSIC9, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

493. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH001166 (Escherichia coli strain TAEC1 plasmid pNDM-TAEC1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

494. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF150121 (Klebsiella pneumoniae strain A64477 plasmid pKP64477c, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

495. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF150123 (Klebsiella pneumoniae strain A64216 plasmid pKP64216b, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

496. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF344572 (Enterobacter hormaechei strain 24845 plasmid p24845-Ct2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

497. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG764554 (Enterobacter cloacae strain 30860 plasmid p30860-tetA, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

498. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH536949 (Citrobacter freundii strain AA535 plasmid pIBACIncN, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

499. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH401970 (Enterobacter hormaechei subsp. steigerwaltii strain MED plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

500. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH727565 (Citrobacter freundii strain ECL-14-57 plasmid pIMP-ECL14-57, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

501. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG878866 (Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

502. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH763829 (Citrobacter freundii strain JY-17 plasmid pCFJY-17, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

503. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH892479 (Citrobacter freundii strain 2262 plasmid pNDM-2262, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

504. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH844629 (Escherichia coli strain 2248 plasmid pNDM-2248, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

505. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030132 (Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

506. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271413 (Klebsiella pneumoniae strain KL49 plasmid IncN_typeA, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

507. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY887596 (Escherichia coli strain Ec158 plasmid pEc158, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

508. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF344557 (Klebsiella pneumoniae strain 10677 plasmid p10677-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

509. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF953243 (Klebsiella pneumoniae strain C5 plasmid pC5_41608, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

510. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF072965 (Citrobacter freundii strain P10159 plasmid pP10159-5, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

511. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG288677 (Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

512. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG764553 (Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

513. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG764552 (Klebsiella pneumoniae strain A1763 plasmid pA1763-Ct2, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

514. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF150118 (Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

515. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG904997 (Escherichia coli strain 15OD0495 plasmid p15ODMR, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

516. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF627445 (Vibrio parahaemolyticus strain Vb0499 plasmid pVb0499, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

517. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_023323 (Escherichia coli ACN001 plasmid pACN001-A, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

518. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

519. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020059 (Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

520. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017725 (Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 strain SGSC 2518 isolate SARB61 plasmid pSARB26_02, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

521. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP054304 (Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

522. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP054305 (Klebsiella pneumoniae strain MS14393 plasmid pMS14393B, complete sequence) position: , mismatch: 1, identity: 0.969

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gaatgctctactccaccattgacgttgtggtg	Protospacer
**************************** ***

523. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

524. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX711879 (Pseudomonas aeruginosa strain P378 plasmid P378-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

525. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX928750 (Klebsiella pneumoniae strain CRKP-1-KPC plasmid pCRKP-1-KPC, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

526. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX881941 (Klebsiella pneumoniae subsp. pneumoniae strain H154180724 plasmid pJF-WMKPCN1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

527. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX518744 (Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

528. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX928751 (Klebsiella pneumoniae strain CRKP-5-KPC plasmid pCRKP-5-KPC, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

529. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF072962 (Citrobacter freundii strain P10159 plasmid pP10159-2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

530. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY271415 (Klebsiella pneumoniae strain H151400611 plasmid IncN_typeC, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

531. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY271414 (Klebsiella pneumoniae strain H151440672 plasmid IncN_typeB, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

532. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY128483 (Klebsiella oxytoca strain 97_38 plasmid pKm38_N, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

533. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032197 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

534. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT982614 (Escherichia coli strain CRE1504 plasmid pIMP-HK1504, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

535. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT982615 (Escherichia coli strain CRE1505 plasmid pIMP-FS1505, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

536. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX807610 (Salmonella enterica subsp. enterica serovar Enteritidis strain CNM4839/03 plasmid pUO-SeVR1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

537. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX711880 (Klebsiella pneumoniae strain 1220 plasmid p1220-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

538. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT982618 (Escherichia coli strain CRE1517 plasmid pIMP-GZ1517, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

539. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU295131 (Escherichia coli strain BK28009 plasmid pBK28009, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

540. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY128484 (Klebsiella michiganensis strain 97_58 plasmid pKm38_N, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

541. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU051707 (Escherichia coli strain CRE1502 plasmid pIMP-SZ1502, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

542. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT982613 (Klebsiella pneumoniae strain CRE 1496 plasmid pIMP1496, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

543. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU886034 (Klebsiella pneumoniae strain Kp1 plasmid pIMP-HZ1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

544. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU862632 (Klebsiella pneumoniae strain CRE1495 plasmid pIMP-KP1495, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

545. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU051710 (Citrobacter freundii strain CRE1503 plasmid pIMP-FJ1503, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

546. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT989598 (Enterobacter cloacae strain CRE1506 plasmid pIMP-SH1506, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

547. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KM977631 (Klebsiella pneumoniae strain CRE1495 plasmid pIMP-1495, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

548. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KM660724 (Morganella morganii strain MRSN22709 plasmid pMR3-OXA181, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

549. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU051708 (Klebsiella pneumoniae strain CRE1501 plasmid pIMP-SZ1501, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

550. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU051709 (Escherichia coli strain CRE1058 plasmid pIMP-GZ1058, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

551. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT982616 (Escherichia coli strain CRE1509 plasmid pIMP-HK1509, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

552. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU295134 (Escherichia coli strain BK32602 plasmid pBK32602, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

553. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KJ440076 (Escherichia coli strain CGMHLK75 plasmid pLK75, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

554. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP345882 (Escherichia coli strain BK32533 plasmid pBK32533, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

555. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_014368 (Klebsiella pneumoniae plasmid pNL194, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

556. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_014231 (Escherichia coli plasmid pKC394, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

557. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_020088 (Klebsiella pneumoniae plasmid pK18An, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

558. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_020086 (Escherichia coli plasmid pE66An, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

559. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to LT221037 (Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

560. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to LT221038 (Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

561. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to MK356560 (Salmonella sp. strain Sa1423 plasmid pSa1423-50K, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

562. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031259 (Klebsiella quasipneumoniae strain L22 plasmid pL22-2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

563. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_021660 (Klebsiella pneumoniae FCF3SP plasmid pKPC_FCF/3SP, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

564. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_021664 (Klebsiella pneumoniae FCF1305 plasmid pKPC_FCF13/05, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

565. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028975 (Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

566. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

567. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043048 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

568. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028486 (Escherichia coli strain E41-1 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

569. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_007682 (Escherichia coli plasmid pMUR050, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

570. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to CP026801 (Shigella sonnei strain ATCC 29930 plasmid unnamed) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

571. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043186 (Escherichia coli O16:H48 strain PG20180171 plasmid pPG20180171.1-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

572. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026053 (Salmonella enterica strain FDAARGOS_70 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

573. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018646 (Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 plasmid pSE79-2359, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

574. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023420 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-4, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

575. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to KY075659 (Escherichia coli strain GD80 plasmid pGD80-2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

576. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_009980 (Salmonella enterica subsp. enterica serovar Dublin plasmid pMAK2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

577. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053728 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

578. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK878892 (Escherichia coli strain J53 plasmid pMG333, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

579. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026277 (Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

580. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033394 (Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

581. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LS998787 (Escherichia coli isolate EC-TO75 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

582. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KJ440075 (Klebsiella pneumoniae strain CGMHLK78 plasmid pLK78, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

583. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

584. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

585. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009881 (Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

586. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to MT077883 (Escherichia coli plasmid p23, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

587. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to KX023260 (Escherichia coli plasmid pSCE516-3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

588. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026169 (Leclercia sp. LSNIH1 plasmid pKPC-79f0, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

589. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to CP052433 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

590. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT838197 (Escherichia coli isolate WI1 isolate plasmid pWI1-KPC3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

591. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LS992177 (Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

592. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_EU880929 (Klebsiella pneumoniae strain INS23K plasmid pLJ1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

593. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to LN610760 (Citrobacter freundii plasmid pCF8698_KPC2, strain CF8698, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

594. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to JN102341 (Uncultured bacterium plasmid pRSB201, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

595. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to JN102342 (Uncultured bacterium plasmid pRSB203, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

596. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to JN102343 (Uncultured bacterium plasmid pRSB205, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

597. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to JN102344 (Uncultured bacterium plasmid pRSB206, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

598. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028173 (Salmonella enterica strain CFSAN064033 plasmid pGMI17-001_1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

599. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021730 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-4, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

600. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

601. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036363 (Klebsiella pneumoniae strain WCHKP2080 plasmid p1_095080, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

602. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_025019 (Klebsiella pneumoniae subsp. ozaenae plasmid pKo6, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

603. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to CP009867 (Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

604. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020527 (Enterobacter cloacae strain 109 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

605. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

606. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044159 (Shigella flexneri strain AR-0423 plasmid pAR-0423-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

607. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

608. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_015599 (Escherichia coli IncN plasmid N3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

609. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_021238 (Klebsiella pneumoniae strain Kpn-1433 plasmid pKP1433, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

610. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to CP042643 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-5, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

611. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to MN891676 (Klebsiella pneumoniae strain 24169 plasmid p24169-KPC, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

612. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to MN891682 (Klebsiella pneumoniae strain 116753 plasmid p116753-KPC, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

613. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to CP052359 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

614. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to CP052446 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

615. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040895 (Leclercia adecarboxylata strain Z96-1 plasmid pIMP-Z96-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

616. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014524 (Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

617. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_025186 (Klebsiella pneumoniae subsp. pneumoniae strain OW16C2 plasmid pOW16C2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

618. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

619. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040178 (Klebsiella pneumoniae strain 2e plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

620. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042617 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

621. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019006 (Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

622. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

623. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_024974 (Escherichia coli plasmid pL2-43, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

624. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to CP010513 (Enterobacter cloacae strain colR/S plasmid, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

625. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044187 (Salmonella enterica subsp. enterica strain AR-0402 plasmid pAR-0402) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

626. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027616 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

627. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035387 (Enterobacter hormaechei strain S11_16 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

628. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052872 (Enterobacter cloacae strain 3849 plasmid p3846_IncN_VIM-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

629. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012143 (Shigella flexneri 4c strain 1205 plasmid 1205p3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

630. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018963 (Escherichia coli strain Ecol_517 plasmid pEC517_KPC, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

631. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_019033 (Escherichia coli plasmid pQNR2078, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

632. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_021622 (Klebsiella pneumoniae plasmid pK45-67VIM complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

633. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

634. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033359 (Salmonella enterica subsp. enterica strain EQAS2016S1 plasmid pEQAS2016S1-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

635. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018884 (Klebsiella pneumoniae subsp. pneumoniae strain BR7 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

636. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028958 (Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

637. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039821 (Klebsiella pneumoniae strain C2414 plasmid pC2414-3-NDM, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

638. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

639. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

640. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_025183 (Escherichia coli strain ECN580 plasmid pECN580, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

641. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_003292 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R46, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

642. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018887 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

643. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032203 (Escherichia coli strain AR_0086 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

644. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040859 (Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

645. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_024967 (Escherichia coli strain YD626E plasmid pYD626E, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

646. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026180 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

647. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_019098 (Escherichia coli strain HHA45 plasmid pHHA45, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

648. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

649. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to KY940546 (Klebsiella pneumoniae plasmid pUCLA3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

650. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_019082 (Escherichia coli plasmid pZS50, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggttttttacccaac	Protospacer
*************.***** ************

651. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046118 (Enterobacter cloacae strain CBG15936 plasmid pNDM1-CBG, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

652. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to KF534788 (Escherichia coli plasmid pNDM-BTR, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

653. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009862 (Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

654. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_014208 (Klebsiella oxytoca KOX105 plasmid pKOX105, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

655. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_023909 (Escherichia coli strain EcNDM1 plasmid pEcNDM1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

656. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_023910 (Escherichia coli strain EcNDM0 plasmid pEcNDM0, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

657. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009864 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

658. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009773 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pKPC-63d, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

659. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009874 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

660. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009776 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPC-def, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

661. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006926 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

662. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985266 (Escherichia coli strain 177 plasmid RCS53_p, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

663. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040696 (Citrobacter freundii strain R47 plasmid pR47-309, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

664. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_025141 (Escherichia coli plasmid pH1038-142, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

665. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009853 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pKPC-860, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

666. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042533 (Klebsiella aerogenes strain C9 plasmid pC9_003, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

667. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018977 (Escherichia coli strain Ecol_656 plasmid pEC656_KPC, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

668. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011589 (Enterobacter asburiae strain CAV1043 plasmid pKPC_CAV1043, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

669. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024144 (Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

670. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026389 (Leclercia sp. LSNIH3 plasmid pKPC-3714, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

671. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP008901 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pKPC-47e, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

672. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_019124 (Salmonella enterica subsp. enterica serovar Virchow plasmid pVQS1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

673. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025965 (Klebsiella pneumoniae strain WCHKP34 plasmid pNDM1_LL34, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

674. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020066 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_5, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

675. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022157 (Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

676. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029436 (Klebsiella quasipneumoniae strain CAV2013 plasmid pKPC_CAV2013, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

677. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029431 (Klebsiella quasipneumoniae strain CAV2018 plasmid pKPC_CAV2018-435, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

678. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

679. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015389 (Klebsiella pneumoniae strain NY9 plasmid pNY9_4, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

680. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to MN178639 (Kluyvera cryocrescens strain SCW13 plasmid pSCW13-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

681. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025233 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 plasmid pSNE1-1925, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

682. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to CP050160 (Escherichia coli plasmid Carbapenemase(IMP-4)_IncN, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

683. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050859 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-NDM, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

684. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_014385 (Escherichia coli plasmid pEC_L46, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

685. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025758 (Citrobacter freundii complex sp. CFNIH12 strain CFNIH2 plasmid pKPC-349c, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

686. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024130 (Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

687. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to CP050159 (Enterobacter cloacae plasmid Carbapenemase(IMP-26)_IncN, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

688. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_019087 (Escherichia coli O25b:H4-ST131 str. EC958 plasmid pKC396, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

689. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018945 (Escherichia coli strain Ecol_224 plasmid pEC224_KPC, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

690. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018959 (Escherichia coli strain Ecol_422 plasmid pEC422_KPC, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

691. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019026 (Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

692. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to MH061383 (Pseudomonas aeruginosa plasmid pP6qnrS1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

693. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026213 (Citrobacter sp. CFNIH10 plasmid pKPC-933d, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

694. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042589 (Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

695. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045022 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-KPC14, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

696. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to AP022367 (Escherichia coli E317 plasmid pE317_IMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

697. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to AP022370 (Klebsiella pneumoniae E328 plasmid pE328_IMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

698. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027050 (Klebsiella pneumoniae strain 20_GR_12 plasmid IncN, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

699. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021899 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_4_pilon, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

700. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

701. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025710 (Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

702. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026198 (Enterobacteriaceae bacterium ENNIH3 plasmid pKPC-c606, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

703. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030335 (Escherichia coli strain AR_451 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

704. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036368 (Klebsiella pneumoniae strain WCHKP115068 plasmid p1_115068, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

705. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to MN816373 (Escherichia coli strain A127 plasmid pA127-X1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

706. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_009132 (Escherichia coli plasmid pLEW517, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

707. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013215 (Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

708. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031109 (Escherichia coli strain AMSCJX02 plasmid pAMSC4, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

709. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033830 (Serratia sp. FDAARGOS_506 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

710. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_011383 (Klebsiella pneumoniae plasmid 9, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

711. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_011385 (Klebsiella pneumoniae plasmid 12, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

712. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to LN879484 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSEN-BT, strain D7795) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

713. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042581 (Enterobacter kobei strain C16 plasmid pC16_003, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

714. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020119 (Escherichia coli strain AR_0104 plasmid unitig_7, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

715. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to KC170280 (Uncultured bacterium plasmid pDS2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

716. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043224 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.2-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

717. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026496 (Klebsiella pneumoniae strain 616 plasmid pKp616_1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

718. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041629 (Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

719. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to AP022354 (Escherichia coli E033 plasmid pE033_IMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

720. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to AP022355 (Escherichia coli E034 plasmid pE034_IMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

721. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to AP022356 (Escherichia coli E119 plasmid pE119_5kIMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

722. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to AP022357 (Escherichia coli E119 plasmid pE119_6kIMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

723. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

724. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to AP022359 (Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

725. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049193 (Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

726. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to CP052352 (Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

727. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_011617 (Klebsiella pneumoniae plasmid pKP96, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

728. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043184 (Escherichia coli O16:H48 strain PG20180172 plasmid pPG20180172.1-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

729. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043188 (Escherichia coli O16:H48 strain PG20180170 plasmid pPG20180170.1-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

730. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to AP022349 (Klebsiella pneumoniae E105 plasmid pKPI-1 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

731. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to AP022350 (Escherichia coli E109 plasmid pE109_IMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

732. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

733. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to LC520276 (Escherichia coli F0090 plasmid pF0090 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

734. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_022374 (Escherichia coli plasmid pHKU1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

735. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041444 (Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

736. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018362 (Escherichia coli strain A56-1S plasmid pA56-1S, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

737. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019550 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

738. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018363 (Escherichia coli strain A56-1R plasmid pA56-1R, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

739. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to CP052394 (Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

740. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019403 (Klebsiella pneumoniae strain E129 plasmid pE129_IMP6, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

741. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019402 (Klebsiella pneumoniae strain E013 plasmid pE013_IMP6, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

742. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019404 (Klebsiella pneumoniae strain E188 plasmid pE188_IMP6, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

743. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

744. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018649 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

745. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021734 (Escherichia coli strain AR_0114 plasmid unitig_2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

746. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026590 (Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

747. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021778 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

748. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to MN937241 (Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

749. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023981 (Klebsiella variicola strain X39 plasmid pX39-4, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

750. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR745047 (Klebsiella pneumoniae isolate Kpn2166 plasmid pCTX-M15_Kpn2166) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

751. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018643 (Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

752. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985259 (Escherichia coli strain 592 plasmid RCS44_p, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

753. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985245 (Escherichia coli strain 523 plasmid RCS42_p, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

754. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985242 (Escherichia coli strain 604 plasmid RCS43_p, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

755. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985251 (Escherichia coli strain 502 plasmid RCS45_p, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

756. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK656937 (Escherichia coli strain T3 plasmid pT3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

757. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK878894 (Escherichia coli strain J53 plasmid pMG334, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

758. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN241904 (Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM62, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

759. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_019888 (Klebsiella pneumoniae strain BK31551 plasmid pBK31551, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

760. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH829594 (Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

761. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH909344 (Enterobacter cloacae strain 12949 plasmid p12949-FIIY, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

762. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH909339 (Klebsiella pneumoniae strain 24632 plasmid p24632-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

763. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH909337 (Klebsiella pneumoniae strain 20389 plasmid p20389-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

764. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH909334 (Klebsiella pneumoniae strain 13-sp plasmid p13SP-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

765. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH909336 (Klebsiella pneumoniae strain 201311334 plasmid p11334-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

766. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH909328 (Klebsiella pneumoniae strain D920 plasmid pD920-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

767. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH917123 (Klebsiella pneumoniae strain Kp735 plasmid pSZN_KPC, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

768. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK036890 (Klebsiella pneumoniae strain D610 plasmid pD610-1IMP, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

769. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

770. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK356561 (Escherichia coli strain J53 plasmid pSa1423TC-59K, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

771. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK862125 (Enterobacter hormaechei strain 1-RC-17-04408-5 plasmid P04408-5-KPC40, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

772. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to MT199177 (Escherichia coli strain 100 plasmid p100_NDM5_IncN, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

773. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG886286 (Escherichia coli strain ECSIC9 plasmid pECSIC9, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

774. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF398271 (Klebsiella pneumoniae subsp. pneumoniae strain 70-2 plasmid pKP70-2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

775. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF474175 (Escherichia coli strain J53/pNIT-HK plasmid pNIT-HK, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

776. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF344559 (Enterobacter hormaechei strain 128379 plasmid p128379-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

777. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH536949 (Citrobacter freundii strain AA535 plasmid pIBACIncN, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

778. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH401970 (Enterobacter hormaechei subsp. steigerwaltii strain MED plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

779. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH399264 (Enterobacter cloacae strain RJ702 plasmid pIMP26, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

780. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH727565 (Citrobacter freundii strain ECL-14-57 plasmid pIMP-ECL14-57, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

781. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG878866 (Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

782. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049047 (Enterobacter hormaechei strain Y233 plasmid pIHI2-233, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

783. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY271413 (Klebsiella pneumoniae strain KL49 plasmid IncN_typeA, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

784. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF344557 (Klebsiella pneumoniae strain 10677 plasmid p10677-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

785. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF953243 (Klebsiella pneumoniae strain C5 plasmid pC5_41608, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

786. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG288677 (Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

787. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY978628 (Cronobacter sakazakii strain 505108 plasmid p505108-MDR, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

788. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG764553 (Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

789. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG904997 (Escherichia coli strain 15OD0495 plasmid p15ODMR, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

790. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NC_023323 (Escherichia coli ACN001 plasmid pACN001-A, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

791. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029442 (Klebsiella quasipneumoniae strain CAV1947 plasmid pKPC_CAV1947-412, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

792. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020059 (Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

793. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017725 (Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 strain SGSC 2518 isolate SARB61 plasmid pSARB26_02, complete sequence) position: , mismatch: 2, identity: 0.938

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
ttaaaaagaacaagcacggctttttacccaac	Protospacer
*************.***** ************

794. spacer 12.1|2847227|31|NC_020260|CRT matches to HQ201308 (Cronobacter phage ENT47670, complete genome) position: , mismatch: 2, identity: 0.935

agagagccgaagctgttgcgcttcatgagct	CRISPR spacer
acagagccgaagctgttgcgcttcatgagtt	Protospacer
* ***************************.*

795. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX711879 (Pseudomonas aeruginosa strain P378 plasmid P378-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

796. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX928750 (Klebsiella pneumoniae strain CRKP-1-KPC plasmid pCRKP-1-KPC, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

797. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF072962 (Citrobacter freundii strain P10159 plasmid pP10159-2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

798. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271415 (Klebsiella pneumoniae strain H151400611 plasmid IncN_typeC, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

799. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271414 (Klebsiella pneumoniae strain H151440672 plasmid IncN_typeB, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

800. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY128483 (Klebsiella oxytoca strain 97_38 plasmid pKm38_N, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

801. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982614 (Escherichia coli strain CRE1504 plasmid pIMP-HK1504, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

802. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982615 (Escherichia coli strain CRE1505 plasmid pIMP-FS1505, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

803. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX711880 (Klebsiella pneumoniae strain 1220 plasmid p1220-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

804. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982618 (Escherichia coli strain CRE1517 plasmid pIMP-GZ1517, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

805. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU295131 (Escherichia coli strain BK28009 plasmid pBK28009, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

806. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY128484 (Klebsiella michiganensis strain 97_58 plasmid pKm38_N, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

807. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051707 (Escherichia coli strain CRE1502 plasmid pIMP-SZ1502, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

808. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982613 (Klebsiella pneumoniae strain CRE 1496 plasmid pIMP1496, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

809. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU886034 (Klebsiella pneumoniae strain Kp1 plasmid pIMP-HZ1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

810. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU862632 (Klebsiella pneumoniae strain CRE1495 plasmid pIMP-KP1495, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

811. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051710 (Citrobacter freundii strain CRE1503 plasmid pIMP-FJ1503, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

812. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT989598 (Enterobacter cloacae strain CRE1506 plasmid pIMP-SH1506, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

813. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KM977631 (Klebsiella pneumoniae strain CRE1495 plasmid pIMP-1495, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

814. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KM660724 (Morganella morganii strain MRSN22709 plasmid pMR3-OXA181, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

815. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051708 (Klebsiella pneumoniae strain CRE1501 plasmid pIMP-SZ1501, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

816. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051709 (Escherichia coli strain CRE1058 plasmid pIMP-GZ1058, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

817. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982616 (Escherichia coli strain CRE1509 plasmid pIMP-HK1509, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

818. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU295134 (Escherichia coli strain BK32602 plasmid pBK32602, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

819. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ440076 (Escherichia coli strain CGMHLK75 plasmid pLK75, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

820. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014231 (Escherichia coli plasmid pKC394, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

821. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014231 (Escherichia coli plasmid pKC394, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

822. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014231 (Escherichia coli plasmid pKC394, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

823. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LT221037 (Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

824. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LT221038 (Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

825. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MK356560 (Salmonella sp. strain Sa1423 plasmid pSa1423-50K, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

826. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MK356560 (Salmonella sp. strain Sa1423 plasmid pSa1423-50K, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

827. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MK356560 (Salmonella sp. strain Sa1423 plasmid pSa1423-50K, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

828. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031259 (Klebsiella quasipneumoniae strain L22 plasmid pL22-2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

829. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP048785 (Serratia liquefaciens strain S1 plasmid pSl1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

830. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP048785 (Serratia liquefaciens strain S1 plasmid pSl1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

831. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP048785 (Serratia liquefaciens strain S1 plasmid pSl1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

832. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021660 (Klebsiella pneumoniae FCF3SP plasmid pKPC_FCF/3SP, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

833. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028486 (Escherichia coli strain E41-1 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

834. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043186 (Escherichia coli O16:H48 strain PG20180171 plasmid pPG20180171.1-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

835. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043186 (Escherichia coli O16:H48 strain PG20180171 plasmid pPG20180171.1-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

836. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043186 (Escherichia coli O16:H48 strain PG20180171 plasmid pPG20180171.1-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

837. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026053 (Salmonella enterica strain FDAARGOS_70 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

838. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026053 (Salmonella enterica strain FDAARGOS_70 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

839. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026053 (Salmonella enterica strain FDAARGOS_70 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

840. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018646 (Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 plasmid pSE79-2359, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

841. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018646 (Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 plasmid pSE79-2359, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

842. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018646 (Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 plasmid pSE79-2359, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

843. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023420 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-4, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

844. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK878892 (Escherichia coli strain J53 plasmid pMG333, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

845. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026277 (Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

846. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033394 (Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

847. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS998788 (Escherichia coli isolate EC-TO75 plasmid 4, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

848. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ440075 (Klebsiella pneumoniae strain CGMHLK78 plasmid pLK78, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

849. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026236 (Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

850. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

851. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

852. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

853. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009881 (Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

854. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026169 (Leclercia sp. LSNIH1 plasmid pKPC-79f0, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

855. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052433 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

856. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT838197 (Escherichia coli isolate WI1 isolate plasmid pWI1-KPC3, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

857. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992177 (Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

858. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992177 (Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

859. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LN610760 (Citrobacter freundii plasmid pCF8698_KPC2, strain CF8698, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

860. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102341 (Uncultured bacterium plasmid pRSB201, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

861. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102341 (Uncultured bacterium plasmid pRSB201, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

862. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102341 (Uncultured bacterium plasmid pRSB201, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

863. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102342 (Uncultured bacterium plasmid pRSB203, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

864. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102342 (Uncultured bacterium plasmid pRSB203, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

865. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102342 (Uncultured bacterium plasmid pRSB203, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

866. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102343 (Uncultured bacterium plasmid pRSB205, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

867. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102343 (Uncultured bacterium plasmid pRSB205, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

868. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102344 (Uncultured bacterium plasmid pRSB206, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

869. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102344 (Uncultured bacterium plasmid pRSB206, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

870. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102344 (Uncultured bacterium plasmid pRSB206, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

871. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028173 (Salmonella enterica strain CFSAN064033 plasmid pGMI17-001_1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

872. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028173 (Salmonella enterica strain CFSAN064033 plasmid pGMI17-001_1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

873. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028173 (Salmonella enterica strain CFSAN064033 plasmid pGMI17-001_1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

874. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021730 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-4, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

875. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021730 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-4, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

876. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021730 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-4, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

877. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036363 (Klebsiella pneumoniae strain WCHKP2080 plasmid p1_095080, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

878. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025019 (Klebsiella pneumoniae subsp. ozaenae plasmid pKo6, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

879. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP009867 (Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

880. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020527 (Enterobacter cloacae strain 109 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

881. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044159 (Shigella flexneri strain AR-0423 plasmid pAR-0423-1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

882. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP042643 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-5, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

883. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP042643 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-5, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

884. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP042643 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-5, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

885. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN891676 (Klebsiella pneumoniae strain 24169 plasmid p24169-KPC, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

886. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052359 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-3, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

887. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052446 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-3, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

888. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040895 (Leclercia adecarboxylata strain Z96-1 plasmid pIMP-Z96-1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

889. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014524 (Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

890. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040178 (Klebsiella pneumoniae strain 2e plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

891. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

892. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_024974 (Escherichia coli plasmid pL2-43, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

893. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_024974 (Escherichia coli plasmid pL2-43, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

894. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_024974 (Escherichia coli plasmid pL2-43, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

895. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044187 (Salmonella enterica subsp. enterica strain AR-0402 plasmid pAR-0402) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

896. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026757 (Klebsiella aerogenes strain AR_0062 plasmid tig00000053_pilon, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

897. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP035387 (Enterobacter hormaechei strain S11_16 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

898. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012143 (Shigella flexneri 4c strain 1205 plasmid 1205p3, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

899. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012143 (Shigella flexneri 4c strain 1205 plasmid 1205p3, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

900. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012143 (Shigella flexneri 4c strain 1205 plasmid 1205p3, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

901. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018963 (Escherichia coli strain Ecol_517 plasmid pEC517_KPC, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

902. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019033 (Escherichia coli plasmid pQNR2078, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

903. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019033 (Escherichia coli plasmid pQNR2078, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

904. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019033 (Escherichia coli plasmid pQNR2078, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

905. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033359 (Salmonella enterica subsp. enterica strain EQAS2016S1 plasmid pEQAS2016S1-1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

906. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033359 (Salmonella enterica subsp. enterica strain EQAS2016S1 plasmid pEQAS2016S1-1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

907. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033359 (Salmonella enterica subsp. enterica strain EQAS2016S1 plasmid pEQAS2016S1-1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

908. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028958 (Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

909. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039821 (Klebsiella pneumoniae strain C2414 plasmid pC2414-3-NDM, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

910. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018758 (Metakosakonia sp. MRY16-398 plasmid pMRY16-398_2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

911. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025183 (Escherichia coli strain ECN580 plasmid pECN580, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

912. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_003292 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R46, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

913. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_003292 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R46, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

914. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_003292 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R46, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

915. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018887 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

916. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018887 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

917. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032203 (Escherichia coli strain AR_0086 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

918. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040859 (Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

919. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

920. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019098 (Escherichia coli strain HHA45 plasmid pHHA45, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

921. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019098 (Escherichia coli strain HHA45 plasmid pHHA45, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

922. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019098 (Escherichia coli strain HHA45 plasmid pHHA45, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

923. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP046118 (Enterobacter cloacae strain CBG15936 plasmid pNDM1-CBG, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

924. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to KF534788 (Escherichia coli plasmid pNDM-BTR, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

925. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009862 (Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

926. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_023909 (Escherichia coli strain EcNDM1 plasmid pEcNDM1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

927. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_023910 (Escherichia coli strain EcNDM0 plasmid pEcNDM0, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

928. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009864 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

929. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009874 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

930. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985266 (Escherichia coli strain 177 plasmid RCS53_p, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

931. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025141 (Escherichia coli plasmid pH1038-142, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

932. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025141 (Escherichia coli plasmid pH1038-142, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

933. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025141 (Escherichia coli plasmid pH1038-142, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

934. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009853 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pKPC-860, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

935. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042533 (Klebsiella aerogenes strain C9 plasmid pC9_003, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

936. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018977 (Escherichia coli strain Ecol_656 plasmid pEC656_KPC, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

937. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011589 (Enterobacter asburiae strain CAV1043 plasmid pKPC_CAV1043, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

938. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026389 (Leclercia sp. LSNIH3 plasmid pKPC-3714, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

939. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP008901 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pKPC-47e, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

940. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019124 (Salmonella enterica subsp. enterica serovar Virchow plasmid pVQS1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

941. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019124 (Salmonella enterica subsp. enterica serovar Virchow plasmid pVQS1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

942. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019124 (Salmonella enterica subsp. enterica serovar Virchow plasmid pVQS1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

943. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025965 (Klebsiella pneumoniae strain WCHKP34 plasmid pNDM1_LL34, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

944. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020066 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_5, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

945. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022157 (Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

946. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022157 (Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

947. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022157 (Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

948. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015389 (Klebsiella pneumoniae strain NY9 plasmid pNY9_4, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

949. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN178639 (Kluyvera cryocrescens strain SCW13 plasmid pSCW13-1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

950. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038278 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

951. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025233 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 plasmid pSNE1-1925, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

952. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025233 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 plasmid pSNE1-1925, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

953. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025233 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 plasmid pSNE1-1925, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

954. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP050160 (Escherichia coli plasmid Carbapenemase(IMP-4)_IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

955. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050859 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-NDM, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

956. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025758 (Citrobacter freundii complex sp. CFNIH12 strain CFNIH2 plasmid pKPC-349c, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

957. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP050159 (Enterobacter cloacae plasmid Carbapenemase(IMP-26)_IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

958. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019087 (Escherichia coli O25b:H4-ST131 str. EC958 plasmid pKC396, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

959. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019087 (Escherichia coli O25b:H4-ST131 str. EC958 plasmid pKC396, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

960. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019087 (Escherichia coli O25b:H4-ST131 str. EC958 plasmid pKC396, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

961. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019087 (Escherichia coli O25b:H4-ST131 str. EC958 plasmid pKC396, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

962. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018945 (Escherichia coli strain Ecol_224 plasmid pEC224_KPC, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

963. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019026 (Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

964. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026211 (Citrobacter sp. CFNIH10 plasmid pCIT-eb1a, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

965. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022367 (Escherichia coli E317 plasmid pE317_IMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

966. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027050 (Klebsiella pneumoniae strain 20_GR_12 plasmid IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

967. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027050 (Klebsiella pneumoniae strain 20_GR_12 plasmid IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

968. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027050 (Klebsiella pneumoniae strain 20_GR_12 plasmid IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

969. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028579 (Klebsiella pneumoniae strain WCHKP36 plasmid p1_020036, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

970. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025710 (Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

971. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026198 (Enterobacteriaceae bacterium ENNIH3 plasmid pKPC-c606, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

972. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030335 (Escherichia coli strain AR_451 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

973. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036368 (Klebsiella pneumoniae strain WCHKP115068 plasmid p1_115068, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

974. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

975. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

976. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

977. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025984 (Enterobacteriaceae bacterium A-F18 plasmid pAF18_2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

978. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031109 (Escherichia coli strain AMSCJX02 plasmid pAMSC4, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

979. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031109 (Escherichia coli strain AMSCJX02 plasmid pAMSC4, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

980. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031109 (Escherichia coli strain AMSCJX02 plasmid pAMSC4, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

981. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033830 (Serratia sp. FDAARGOS_506 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

982. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_011383 (Klebsiella pneumoniae plasmid 9, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

983. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042581 (Enterobacter kobei strain C16 plasmid pC16_003, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

984. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020119 (Escherichia coli strain AR_0104 plasmid unitig_7, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

985. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_022885 (Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

986. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to KC170280 (Uncultured bacterium plasmid pDS2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

987. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043224 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.2-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

988. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043224 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.2-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

989. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043224 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.2-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

990. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026496 (Klebsiella pneumoniae strain 616 plasmid pKp616_1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

991. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022354 (Escherichia coli E033 plasmid pE033_IMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

992. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022355 (Escherichia coli E034 plasmid pE034_IMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

993. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022356 (Escherichia coli E119 plasmid pE119_5kIMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

994. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

995. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022359 (Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

996. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_011617 (Klebsiella pneumoniae plasmid pKP96, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

997. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043184 (Escherichia coli O16:H48 strain PG20180172 plasmid pPG20180172.1-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

998. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043184 (Escherichia coli O16:H48 strain PG20180172 plasmid pPG20180172.1-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

999. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043184 (Escherichia coli O16:H48 strain PG20180172 plasmid pPG20180172.1-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1000. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043188 (Escherichia coli O16:H48 strain PG20180170 plasmid pPG20180170.1-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1001. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043188 (Escherichia coli O16:H48 strain PG20180170 plasmid pPG20180170.1-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1002. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043188 (Escherichia coli O16:H48 strain PG20180170 plasmid pPG20180170.1-IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1003. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022349 (Klebsiella pneumoniae E105 plasmid pKPI-1 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1004. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_022374 (Escherichia coli plasmid pHKU1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1005. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018362 (Escherichia coli strain A56-1S plasmid pA56-1S, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1006. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019550 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1007. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018363 (Escherichia coli strain A56-1R plasmid pA56-1R, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1008. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052394 (Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1009. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019403 (Klebsiella pneumoniae strain E129 plasmid pE129_IMP6, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1010. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019402 (Klebsiella pneumoniae strain E013 plasmid pE013_IMP6, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1011. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019404 (Klebsiella pneumoniae strain E188 plasmid pE188_IMP6, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1012. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1013. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018649 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1014. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018649 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1015. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018649 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1016. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026590 (Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1017. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023981 (Klebsiella variicola strain X39 plasmid pX39-4, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1018. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR745047 (Klebsiella pneumoniae isolate Kpn2166 plasmid pCTX-M15_Kpn2166) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1019. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018643 (Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1020. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018643 (Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1021. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018643 (Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1022. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985259 (Escherichia coli strain 592 plasmid RCS44_p, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1023. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985259 (Escherichia coli strain 592 plasmid RCS44_p, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1024. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985245 (Escherichia coli strain 523 plasmid RCS42_p, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1025. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985245 (Escherichia coli strain 523 plasmid RCS42_p, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1026. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985242 (Escherichia coli strain 604 plasmid RCS43_p, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1027. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985242 (Escherichia coli strain 604 plasmid RCS43_p, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1028. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985242 (Escherichia coli strain 604 plasmid RCS43_p, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1029. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985251 (Escherichia coli strain 502 plasmid RCS45_p, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1030. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985251 (Escherichia coli strain 502 plasmid RCS45_p, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1031. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985251 (Escherichia coli strain 502 plasmid RCS45_p, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1032. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK878894 (Escherichia coli strain J53 plasmid pMG334, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1033. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK416183 (Escherichia coli strain Ec-2Lar plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1034. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MN241904 (Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM62, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1035. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019888 (Klebsiella pneumoniae strain BK31551 plasmid pBK31551, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1036. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909339 (Klebsiella pneumoniae strain 24632 plasmid p24632-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1037. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909337 (Klebsiella pneumoniae strain 20389 plasmid p20389-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1038. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909334 (Klebsiella pneumoniae strain 13-sp plasmid p13SP-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1039. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909336 (Klebsiella pneumoniae strain 201311334 plasmid p11334-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1040. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909328 (Klebsiella pneumoniae strain D920 plasmid pD920-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1041. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH917123 (Klebsiella pneumoniae strain Kp735 plasmid pSZN_KPC, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1042. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK036890 (Klebsiella pneumoniae strain D610 plasmid pD610-1IMP, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1043. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH128095 (Klebsiella pneumoniae strain CZPF1510086 plasmid pTBCZNDM02, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1044. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK862125 (Enterobacter hormaechei strain 1-RC-17-04408-5 plasmid P04408-5-KPC40, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1045. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN657245 (Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1046. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN657245 (Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1047. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN657245 (Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1048. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN657246 (Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1049. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN657246 (Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1050. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN657246 (Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1051. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MT199177 (Escherichia coli strain 100 plasmid p100_NDM5_IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1052. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MT199177 (Escherichia coli strain 100 plasmid p100_NDM5_IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1053. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MT199177 (Escherichia coli strain 100 plasmid p100_NDM5_IncN, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1054. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG886286 (Escherichia coli strain ECSIC9 plasmid pECSIC9, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1055. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF474175 (Escherichia coli strain J53/pNIT-HK plasmid pNIT-HK, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1056. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF474175 (Escherichia coli strain J53/pNIT-HK plasmid pNIT-HK, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1057. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF474175 (Escherichia coli strain J53/pNIT-HK plasmid pNIT-HK, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1058. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF344559 (Enterobacter hormaechei strain 128379 plasmid p128379-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1059. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH727565 (Citrobacter freundii strain ECL-14-57 plasmid pIMP-ECL14-57, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1060. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG878866 (Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1061. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271413 (Klebsiella pneumoniae strain KL49 plasmid IncN_typeA, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1062. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF344557 (Klebsiella pneumoniae strain 10677 plasmid p10677-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1063. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF953243 (Klebsiella pneumoniae strain C5 plasmid pC5_41608, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1064. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF953243 (Klebsiella pneumoniae strain C5 plasmid pC5_41608, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1065. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF953243 (Klebsiella pneumoniae strain C5 plasmid pC5_41608, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1066. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG288677 (Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1067. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG288677 (Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1068. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG288677 (Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1069. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG904997 (Escherichia coli strain 15OD0495 plasmid p15ODMR, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1070. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020059 (Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1071. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017725 (Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 strain SGSC 2518 isolate SARB61 plasmid pSARB26_02, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1072. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017725 (Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 strain SGSC 2518 isolate SARB61 plasmid pSARB26_02, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1073. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017725 (Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 strain SGSC 2518 isolate SARB61 plasmid pSARB26_02, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1074. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014368 (Klebsiella pneumoniae plasmid pNL194, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccgcccgaaaaattgccggtatcggcg	Protospacer
.******************************.

1075. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014368 (Klebsiella pneumoniae plasmid pNL194, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1076. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MT077883 (Escherichia coli plasmid p23, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccgcccgaaaaattgccggtatcggcg	Protospacer
.******************************.

1077. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MT077883 (Escherichia coli plasmid p23, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1078. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_032101 (Enterobacter cloacae plasmid pG6809-2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccgcccgaaaaattgccggtatcggcg	Protospacer
.******************************.

1079. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_032101 (Enterobacter cloacae plasmid pG6809-2, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1080. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX928751 (Klebsiella pneumoniae strain CRKP-5-KPC plasmid pCRKP-5-KPC, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1081. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX928751 (Klebsiella pneumoniae strain CRKP-5-KPC plasmid pCRKP-5-KPC, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1082. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN891680 (Klebsiella pneumoniae strain A1718 plasmid pA1718-KPC, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1083. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN891680 (Klebsiella pneumoniae strain A1718 plasmid pA1718-KPC, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1084. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MT230182 (Escherichia coli strain DH5alpha plasmid pESBL176, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggcg	Protospacer
*******.***********************.

1085. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX881941 (Klebsiella pneumoniae subsp. pneumoniae strain H154180724 plasmid pJF-WMKPCN1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1086. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_020086 (Escherichia coli plasmid pE66An, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1087. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021664 (Klebsiella pneumoniae FCF1305 plasmid pKPC_FCF13/05, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1088. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018442 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-3, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1089. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_EU880929 (Klebsiella pneumoniae strain INS23K plasmid pLJ1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1090. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_EU880929 (Klebsiella pneumoniae strain INS23K plasmid pLJ1, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1091. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018959 (Escherichia coli strain Ecol_422 plasmid pEC422_KPC, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1092. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP045022 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-KPC14, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1093. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021899 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_4_pilon, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1094. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022350 (Escherichia coli E109 plasmid pE109_IMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1095. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH401970 (Enterobacter hormaechei subsp. steigerwaltii strain MED plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1096. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG764553 (Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence) position: , mismatch: 2, identity: 0.938

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccgcccgaacaatcgccggtatcggca	Protospacer
************** ***.*************

1097. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 3, identity: 0.906

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
taaaaaagaacaagcacggctttttacccaac	Protospacer
* ***********.***** ************

1098. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX711879 (Pseudomonas aeruginosa strain P378 plasmid P378-IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1099. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX711879 (Pseudomonas aeruginosa strain P378 plasmid P378-IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1100. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX928750 (Klebsiella pneumoniae strain CRKP-1-KPC plasmid pCRKP-1-KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1101. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX928750 (Klebsiella pneumoniae strain CRKP-1-KPC plasmid pCRKP-1-KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1102. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF072962 (Citrobacter freundii strain P10159 plasmid pP10159-2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1103. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF072962 (Citrobacter freundii strain P10159 plasmid pP10159-2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1104. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271415 (Klebsiella pneumoniae strain H151400611 plasmid IncN_typeC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1105. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271414 (Klebsiella pneumoniae strain H151440672 plasmid IncN_typeB, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1106. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY128483 (Klebsiella oxytoca strain 97_38 plasmid pKm38_N, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1107. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY128483 (Klebsiella oxytoca strain 97_38 plasmid pKm38_N, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1108. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982614 (Escherichia coli strain CRE1504 plasmid pIMP-HK1504, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1109. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982614 (Escherichia coli strain CRE1504 plasmid pIMP-HK1504, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1110. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982615 (Escherichia coli strain CRE1505 plasmid pIMP-FS1505, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1111. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982615 (Escherichia coli strain CRE1505 plasmid pIMP-FS1505, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1112. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX711880 (Klebsiella pneumoniae strain 1220 plasmid p1220-IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1113. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX711880 (Klebsiella pneumoniae strain 1220 plasmid p1220-IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1114. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982618 (Escherichia coli strain CRE1517 plasmid pIMP-GZ1517, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1115. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982618 (Escherichia coli strain CRE1517 plasmid pIMP-GZ1517, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1116. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU295131 (Escherichia coli strain BK28009 plasmid pBK28009, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1117. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU295131 (Escherichia coli strain BK28009 plasmid pBK28009, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1118. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY128484 (Klebsiella michiganensis strain 97_58 plasmid pKm38_N, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1119. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY128484 (Klebsiella michiganensis strain 97_58 plasmid pKm38_N, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1120. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051707 (Escherichia coli strain CRE1502 plasmid pIMP-SZ1502, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1121. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051707 (Escherichia coli strain CRE1502 plasmid pIMP-SZ1502, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1122. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982613 (Klebsiella pneumoniae strain CRE 1496 plasmid pIMP1496, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1123. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982613 (Klebsiella pneumoniae strain CRE 1496 plasmid pIMP1496, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1124. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU886034 (Klebsiella pneumoniae strain Kp1 plasmid pIMP-HZ1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1125. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU886034 (Klebsiella pneumoniae strain Kp1 plasmid pIMP-HZ1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1126. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU862632 (Klebsiella pneumoniae strain CRE1495 plasmid pIMP-KP1495, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1127. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU862632 (Klebsiella pneumoniae strain CRE1495 plasmid pIMP-KP1495, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1128. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051710 (Citrobacter freundii strain CRE1503 plasmid pIMP-FJ1503, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1129. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051710 (Citrobacter freundii strain CRE1503 plasmid pIMP-FJ1503, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1130. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT989598 (Enterobacter cloacae strain CRE1506 plasmid pIMP-SH1506, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1131. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT989598 (Enterobacter cloacae strain CRE1506 plasmid pIMP-SH1506, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1132. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KM977631 (Klebsiella pneumoniae strain CRE1495 plasmid pIMP-1495, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1133. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KM977631 (Klebsiella pneumoniae strain CRE1495 plasmid pIMP-1495, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1134. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KM660724 (Morganella morganii strain MRSN22709 plasmid pMR3-OXA181, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1135. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KM660724 (Morganella morganii strain MRSN22709 plasmid pMR3-OXA181, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1136. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051708 (Klebsiella pneumoniae strain CRE1501 plasmid pIMP-SZ1501, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1137. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051708 (Klebsiella pneumoniae strain CRE1501 plasmid pIMP-SZ1501, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1138. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051709 (Escherichia coli strain CRE1058 plasmid pIMP-GZ1058, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1139. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051709 (Escherichia coli strain CRE1058 plasmid pIMP-GZ1058, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1140. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982616 (Escherichia coli strain CRE1509 plasmid pIMP-HK1509, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1141. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982616 (Escherichia coli strain CRE1509 plasmid pIMP-HK1509, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1142. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU295134 (Escherichia coli strain BK32602 plasmid pBK32602, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1143. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU295134 (Escherichia coli strain BK32602 plasmid pBK32602, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1144. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ440076 (Escherichia coli strain CGMHLK75 plasmid pLK75, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1145. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ440076 (Escherichia coli strain CGMHLK75 plasmid pLK75, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1146. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014231 (Escherichia coli plasmid pKC394, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1147. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LT221037 (Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1148. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LT221037 (Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1149. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LT221038 (Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1150. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MK356560 (Salmonella sp. strain Sa1423 plasmid pSa1423-50K, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1151. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP048785 (Serratia liquefaciens strain S1 plasmid pSl1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1152. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP045256 (Proteus mirabilis strain L90-1 plasmid pL901, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1153. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021660 (Klebsiella pneumoniae FCF3SP plasmid pKPC_FCF/3SP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1154. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028486 (Escherichia coli strain E41-1 plasmid p3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1155. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028486 (Escherichia coli strain E41-1 plasmid p3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1156. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043186 (Escherichia coli O16:H48 strain PG20180171 plasmid pPG20180171.1-IncN, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1157. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026053 (Salmonella enterica strain FDAARGOS_70 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1158. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018646 (Salmonella enterica subsp. enterica serovar Enteritidis strain 79-2359 plasmid pSE79-2359, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1159. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023420 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-4, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1160. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023420 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-4, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1161. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK878892 (Escherichia coli strain J53 plasmid pMG333, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1162. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK878892 (Escherichia coli strain J53 plasmid pMG333, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1163. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026277 (Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1164. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026277 (Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1165. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033394 (Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1166. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033394 (Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1167. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS998788 (Escherichia coli isolate EC-TO75 plasmid 4, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1168. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS998788 (Escherichia coli isolate EC-TO75 plasmid 4, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1169. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ440075 (Klebsiella pneumoniae strain CGMHLK78 plasmid pLK78, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1170. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ440075 (Klebsiella pneumoniae strain CGMHLK78 plasmid pLK78, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1171. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026236 (Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1172. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026236 (Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1173. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1174. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009881 (Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1175. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009881 (Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1176. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026169 (Leclercia sp. LSNIH1 plasmid pKPC-79f0, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1177. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026169 (Leclercia sp. LSNIH1 plasmid pKPC-79f0, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1178. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052433 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1179. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052433 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1180. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT838197 (Escherichia coli isolate WI1 isolate plasmid pWI1-KPC3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1181. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992177 (Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1182. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992177 (Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1183. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992177 (Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1184. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LN610760 (Citrobacter freundii plasmid pCF8698_KPC2, strain CF8698, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1185. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102341 (Uncultured bacterium plasmid pRSB201, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1186. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102342 (Uncultured bacterium plasmid pRSB203, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1187. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102343 (Uncultured bacterium plasmid pRSB205, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1188. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to JN102344 (Uncultured bacterium plasmid pRSB206, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1189. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028173 (Salmonella enterica strain CFSAN064033 plasmid pGMI17-001_1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1190. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021730 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-4, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1191. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036363 (Klebsiella pneumoniae strain WCHKP2080 plasmid p1_095080, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1192. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036363 (Klebsiella pneumoniae strain WCHKP2080 plasmid p1_095080, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1193. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025019 (Klebsiella pneumoniae subsp. ozaenae plasmid pKo6, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1194. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025019 (Klebsiella pneumoniae subsp. ozaenae plasmid pKo6, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1195. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP009867 (Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1196. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP009867 (Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1197. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020527 (Enterobacter cloacae strain 109 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1198. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020527 (Enterobacter cloacae strain 109 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1199. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044159 (Shigella flexneri strain AR-0423 plasmid pAR-0423-1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1200. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044159 (Shigella flexneri strain AR-0423 plasmid pAR-0423-1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1201. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP042643 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-5, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1202. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN891676 (Klebsiella pneumoniae strain 24169 plasmid p24169-KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1203. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN891676 (Klebsiella pneumoniae strain 24169 plasmid p24169-KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1204. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052359 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1205. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052359 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1206. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052446 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1207. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052446 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1208. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040895 (Leclercia adecarboxylata strain Z96-1 plasmid pIMP-Z96-1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1209. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040895 (Leclercia adecarboxylata strain Z96-1 plasmid pIMP-Z96-1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1210. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014524 (Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1211. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014524 (Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1212. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025186 (Klebsiella pneumoniae subsp. pneumoniae strain OW16C2 plasmid pOW16C2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1213. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040178 (Klebsiella pneumoniae strain 2e plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1214. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040178 (Klebsiella pneumoniae strain 2e plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1215. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1216. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1217. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_024974 (Escherichia coli plasmid pL2-43, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1218. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044187 (Salmonella enterica subsp. enterica strain AR-0402 plasmid pAR-0402) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1219. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044187 (Salmonella enterica subsp. enterica strain AR-0402 plasmid pAR-0402) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1220. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026757 (Klebsiella aerogenes strain AR_0062 plasmid tig00000053_pilon, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1221. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026757 (Klebsiella aerogenes strain AR_0062 plasmid tig00000053_pilon, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1222. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP035387 (Enterobacter hormaechei strain S11_16 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1223. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052872 (Enterobacter cloacae strain 3849 plasmid p3846_IncN_VIM-1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1224. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012143 (Shigella flexneri 4c strain 1205 plasmid 1205p3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1225. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018963 (Escherichia coli strain Ecol_517 plasmid pEC517_KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1226. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019033 (Escherichia coli plasmid pQNR2078, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1227. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021622 (Klebsiella pneumoniae plasmid pK45-67VIM complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1228. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033359 (Salmonella enterica subsp. enterica strain EQAS2016S1 plasmid pEQAS2016S1-1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1229. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028958 (Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1230. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028958 (Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1231. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039821 (Klebsiella pneumoniae strain C2414 plasmid pC2414-3-NDM, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1232. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039821 (Klebsiella pneumoniae strain C2414 plasmid pC2414-3-NDM, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1233. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018758 (Metakosakonia sp. MRY16-398 plasmid pMRY16-398_2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1234. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018758 (Metakosakonia sp. MRY16-398 plasmid pMRY16-398_2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1235. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025183 (Escherichia coli strain ECN580 plasmid pECN580, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1236. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025183 (Escherichia coli strain ECN580 plasmid pECN580, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1237. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_003292 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R46, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1238. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018887 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1239. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018887 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1240. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032203 (Escherichia coli strain AR_0086 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1241. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040859 (Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1242. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040859 (Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1243. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_024967 (Escherichia coli strain YD626E plasmid pYD626E, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1244. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_024967 (Escherichia coli strain YD626E plasmid pYD626E, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1245. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_024967 (Escherichia coli strain YD626E plasmid pYD626E, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccgcccgaacaatcgccggtatcggca	Protospacer
.************* ***.*************

1246. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1247. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1248. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019098 (Escherichia coli strain HHA45 plasmid pHHA45, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1249. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP046118 (Enterobacter cloacae strain CBG15936 plasmid pNDM1-CBG, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1250. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP046118 (Enterobacter cloacae strain CBG15936 plasmid pNDM1-CBG, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1251. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017086 (Proteus mirabilis strain T18 plasmid pT18, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1252. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to KF534788 (Escherichia coli plasmid pNDM-BTR, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1253. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to KF534788 (Escherichia coli plasmid pNDM-BTR, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1254. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009862 (Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1255. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009862 (Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1256. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014208 (Klebsiella oxytoca KOX105 plasmid pKOX105, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1257. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_023909 (Escherichia coli strain EcNDM1 plasmid pEcNDM1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1258. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_023909 (Escherichia coli strain EcNDM1 plasmid pEcNDM1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1259. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_023910 (Escherichia coli strain EcNDM0 plasmid pEcNDM0, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1260. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_023910 (Escherichia coli strain EcNDM0 plasmid pEcNDM0, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1261. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009864 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1262. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009864 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1263. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985266 (Escherichia coli strain 177 plasmid RCS53_p, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1264. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985266 (Escherichia coli strain 177 plasmid RCS53_p, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1265. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025141 (Escherichia coli plasmid pH1038-142, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1266. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009853 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pKPC-860, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1267. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009853 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pKPC-860, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1268. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042533 (Klebsiella aerogenes strain C9 plasmid pC9_003, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1269. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018977 (Escherichia coli strain Ecol_656 plasmid pEC656_KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1270. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011589 (Enterobacter asburiae strain CAV1043 plasmid pKPC_CAV1043, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1271. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011589 (Enterobacter asburiae strain CAV1043 plasmid pKPC_CAV1043, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1272. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026389 (Leclercia sp. LSNIH3 plasmid pKPC-3714, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1273. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026389 (Leclercia sp. LSNIH3 plasmid pKPC-3714, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1274. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP008901 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pKPC-47e, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1275. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP008901 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pKPC-47e, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1276. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019124 (Salmonella enterica subsp. enterica serovar Virchow plasmid pVQS1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1277. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025965 (Klebsiella pneumoniae strain WCHKP34 plasmid pNDM1_LL34, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1278. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025965 (Klebsiella pneumoniae strain WCHKP34 plasmid pNDM1_LL34, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1279. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020066 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_5, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1280. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020066 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_5, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1281. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022157 (Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1282. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015389 (Klebsiella pneumoniae strain NY9 plasmid pNY9_4, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1283. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN178639 (Kluyvera cryocrescens strain SCW13 plasmid pSCW13-1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1284. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN178639 (Kluyvera cryocrescens strain SCW13 plasmid pSCW13-1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1285. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038278 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-IncN, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1286. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025233 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 plasmid pSNE1-1925, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1287. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP050160 (Escherichia coli plasmid Carbapenemase(IMP-4)_IncN, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1288. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP050160 (Escherichia coli plasmid Carbapenemase(IMP-4)_IncN, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1289. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050859 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-NDM, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1290. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050859 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-NDM, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1291. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025758 (Citrobacter freundii complex sp. CFNIH12 strain CFNIH2 plasmid pKPC-349c, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1292. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025758 (Citrobacter freundii complex sp. CFNIH12 strain CFNIH2 plasmid pKPC-349c, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1293. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP050159 (Enterobacter cloacae plasmid Carbapenemase(IMP-26)_IncN, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1294. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP050159 (Enterobacter cloacae plasmid Carbapenemase(IMP-26)_IncN, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1295. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018945 (Escherichia coli strain Ecol_224 plasmid pEC224_KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1296. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018945 (Escherichia coli strain Ecol_224 plasmid pEC224_KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1297. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017083 (Proteus mirabilis strain T21 plasmid pT211, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1298. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019026 (Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1299. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019026 (Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1300. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026211 (Citrobacter sp. CFNIH10 plasmid pCIT-eb1a, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1301. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026211 (Citrobacter sp. CFNIH10 plasmid pCIT-eb1a, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1302. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022367 (Escherichia coli E317 plasmid pE317_IMP6 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1303. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022367 (Escherichia coli E317 plasmid pE317_IMP6 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1304. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027050 (Klebsiella pneumoniae strain 20_GR_12 plasmid IncN, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1305. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028579 (Klebsiella pneumoniae strain WCHKP36 plasmid p1_020036, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1306. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028579 (Klebsiella pneumoniae strain WCHKP36 plasmid p1_020036, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1307. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025710 (Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1308. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025710 (Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1309. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026198 (Enterobacteriaceae bacterium ENNIH3 plasmid pKPC-c606, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1310. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026198 (Enterobacteriaceae bacterium ENNIH3 plasmid pKPC-c606, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1311. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030335 (Escherichia coli strain AR_451 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1312. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030335 (Escherichia coli strain AR_451 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1313. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036368 (Klebsiella pneumoniae strain WCHKP115068 plasmid p1_115068, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1314. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036368 (Klebsiella pneumoniae strain WCHKP115068 plasmid p1_115068, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1315. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_009132 (Escherichia coli plasmid pLEW517, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1316. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025984 (Enterobacteriaceae bacterium A-F18 plasmid pAF18_2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1317. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025984 (Enterobacteriaceae bacterium A-F18 plasmid pAF18_2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1318. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031109 (Escherichia coli strain AMSCJX02 plasmid pAMSC4, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1319. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033830 (Serratia sp. FDAARGOS_506 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1320. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_011383 (Klebsiella pneumoniae plasmid 9, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1321. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042581 (Enterobacter kobei strain C16 plasmid pC16_003, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1322. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042581 (Enterobacter kobei strain C16 plasmid pC16_003, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1323. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020119 (Escherichia coli strain AR_0104 plasmid unitig_7, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1324. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020119 (Escherichia coli strain AR_0104 plasmid unitig_7, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1325. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_022885 (Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1326. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_022885 (Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1327. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to KC170280 (Uncultured bacterium plasmid pDS2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1328. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043224 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.2-IncN, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1329. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026496 (Klebsiella pneumoniae strain 616 plasmid pKp616_1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1330. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026496 (Klebsiella pneumoniae strain 616 plasmid pKp616_1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1331. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022354 (Escherichia coli E033 plasmid pE033_IMP6 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1332. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022354 (Escherichia coli E033 plasmid pE033_IMP6 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1333. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022355 (Escherichia coli E034 plasmid pE034_IMP6 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1334. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022355 (Escherichia coli E034 plasmid pE034_IMP6 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1335. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022356 (Escherichia coli E119 plasmid pE119_5kIMP6 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1336. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022356 (Escherichia coli E119 plasmid pE119_5kIMP6 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1337. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1338. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1339. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022359 (Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1340. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022359 (Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1341. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_011617 (Klebsiella pneumoniae plasmid pKP96, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1342. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_011617 (Klebsiella pneumoniae plasmid pKP96, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1343. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043184 (Escherichia coli O16:H48 strain PG20180172 plasmid pPG20180172.1-IncN, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1344. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043188 (Escherichia coli O16:H48 strain PG20180170 plasmid pPG20180170.1-IncN, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1345. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022349 (Klebsiella pneumoniae E105 plasmid pKPI-1 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1346. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022349 (Klebsiella pneumoniae E105 plasmid pKPI-1 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1347. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_022374 (Escherichia coli plasmid pHKU1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1348. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_022374 (Escherichia coli plasmid pHKU1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1349. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018362 (Escherichia coli strain A56-1S plasmid pA56-1S, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1350. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018362 (Escherichia coli strain A56-1S plasmid pA56-1S, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1351. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019550 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1352. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019550 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1353. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018363 (Escherichia coli strain A56-1R plasmid pA56-1R, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1354. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018363 (Escherichia coli strain A56-1R plasmid pA56-1R, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1355. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052394 (Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1356. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052394 (Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1357. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019403 (Klebsiella pneumoniae strain E129 plasmid pE129_IMP6, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1358. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019403 (Klebsiella pneumoniae strain E129 plasmid pE129_IMP6, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1359. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019402 (Klebsiella pneumoniae strain E013 plasmid pE013_IMP6, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1360. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019402 (Klebsiella pneumoniae strain E013 plasmid pE013_IMP6, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1361. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019404 (Klebsiella pneumoniae strain E188 plasmid pE188_IMP6, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1362. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019404 (Klebsiella pneumoniae strain E188 plasmid pE188_IMP6, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1363. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1364. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1365. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018649 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1366. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026590 (Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1367. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026590 (Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1368. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023981 (Klebsiella variicola strain X39 plasmid pX39-4, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1369. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023981 (Klebsiella variicola strain X39 plasmid pX39-4, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1370. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR745047 (Klebsiella pneumoniae isolate Kpn2166 plasmid pCTX-M15_Kpn2166) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1371. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018643 (Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1372. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985259 (Escherichia coli strain 592 plasmid RCS44_p, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1373. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985251 (Escherichia coli strain 502 plasmid RCS45_p, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1374. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK878894 (Escherichia coli strain J53 plasmid pMG334, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1375. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK878894 (Escherichia coli strain J53 plasmid pMG334, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1376. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK416183 (Escherichia coli strain Ec-2Lar plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1377. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK416183 (Escherichia coli strain Ec-2Lar plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1378. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MN241904 (Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM62, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1379. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MN241904 (Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM62, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1380. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019888 (Klebsiella pneumoniae strain BK31551 plasmid pBK31551, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1381. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019888 (Klebsiella pneumoniae strain BK31551 plasmid pBK31551, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1382. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909339 (Klebsiella pneumoniae strain 24632 plasmid p24632-IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1383. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909339 (Klebsiella pneumoniae strain 24632 plasmid p24632-IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1384. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909337 (Klebsiella pneumoniae strain 20389 plasmid p20389-IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1385. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909337 (Klebsiella pneumoniae strain 20389 plasmid p20389-IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1386. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909334 (Klebsiella pneumoniae strain 13-sp plasmid p13SP-IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1387. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909334 (Klebsiella pneumoniae strain 13-sp plasmid p13SP-IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1388. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909336 (Klebsiella pneumoniae strain 201311334 plasmid p11334-IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1389. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909336 (Klebsiella pneumoniae strain 201311334 plasmid p11334-IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1390. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909328 (Klebsiella pneumoniae strain D920 plasmid pD920-IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1391. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH917123 (Klebsiella pneumoniae strain Kp735 plasmid pSZN_KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1392. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH917123 (Klebsiella pneumoniae strain Kp735 plasmid pSZN_KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1393. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK036890 (Klebsiella pneumoniae strain D610 plasmid pD610-1IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1394. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK036890 (Klebsiella pneumoniae strain D610 plasmid pD610-1IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1395. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH128095 (Klebsiella pneumoniae strain CZPF1510086 plasmid pTBCZNDM02, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1396. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH128095 (Klebsiella pneumoniae strain CZPF1510086 plasmid pTBCZNDM02, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1397. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK356561 (Escherichia coli strain J53 plasmid pSa1423TC-59K, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1398. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK862125 (Enterobacter hormaechei strain 1-RC-17-04408-5 plasmid P04408-5-KPC40, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1399. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK862125 (Enterobacter hormaechei strain 1-RC-17-04408-5 plasmid P04408-5-KPC40, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1400. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN657245 (Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1401. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN657246 (Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1402. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MT199177 (Escherichia coli strain 100 plasmid p100_NDM5_IncN, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1403. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG886286 (Escherichia coli strain ECSIC9 plasmid pECSIC9, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1404. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF474175 (Escherichia coli strain J53/pNIT-HK plasmid pNIT-HK, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1405. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF344559 (Enterobacter hormaechei strain 128379 plasmid p128379-IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1406. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF344559 (Enterobacter hormaechei strain 128379 plasmid p128379-IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1407. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH727565 (Citrobacter freundii strain ECL-14-57 plasmid pIMP-ECL14-57, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1408. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH727565 (Citrobacter freundii strain ECL-14-57 plasmid pIMP-ECL14-57, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1409. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG878866 (Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1410. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG878866 (Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1411. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271413 (Klebsiella pneumoniae strain KL49 plasmid IncN_typeA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1412. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271413 (Klebsiella pneumoniae strain KL49 plasmid IncN_typeA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1413. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF344557 (Klebsiella pneumoniae strain 10677 plasmid p10677-IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1414. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF344557 (Klebsiella pneumoniae strain 10677 plasmid p10677-IMP, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1415. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF953243 (Klebsiella pneumoniae strain C5 plasmid pC5_41608, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1416. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG288677 (Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1417. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG904997 (Escherichia coli strain 15OD0495 plasmid p15ODMR, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1418. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020059 (Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1419. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020059 (Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1420. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017725 (Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 strain SGSC 2518 isolate SARB61 plasmid pSARB26_02, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1421. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014368 (Klebsiella pneumoniae plasmid pNL194, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1422. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014368 (Klebsiella pneumoniae plasmid pNL194, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1423. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MT077883 (Escherichia coli plasmid p23, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1424. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_032101 (Enterobacter cloacae plasmid pG6809-2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1425. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_032101 (Enterobacter cloacae plasmid pG6809-2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1426. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX928751 (Klebsiella pneumoniae strain CRKP-5-KPC plasmid pCRKP-5-KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1427. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX928751 (Klebsiella pneumoniae strain CRKP-5-KPC plasmid pCRKP-5-KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1428. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN891680 (Klebsiella pneumoniae strain A1718 plasmid pA1718-KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1429. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN891680 (Klebsiella pneumoniae strain A1718 plasmid pA1718-KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccgcccgcaaaattgccggtatcggcg	Protospacer
.*********** ******************.

1430. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX881941 (Klebsiella pneumoniae subsp. pneumoniae strain H154180724 plasmid pJF-WMKPCN1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1431. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_020088 (Klebsiella pneumoniae plasmid pK18An, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1432. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_020086 (Escherichia coli plasmid pE66An, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1433. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_020086 (Escherichia coli plasmid pE66An, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1434. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021664 (Klebsiella pneumoniae FCF1305 plasmid pKPC_FCF13/05, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1435. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018442 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1436. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018442 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1437. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_009980 (Salmonella enterica subsp. enterica serovar Dublin plasmid pMAK2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1438. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR130556 (Escherichia coli strain MS14385 isolate MS14385 plasmid 2) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1439. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_EU880929 (Klebsiella pneumoniae strain INS23K plasmid pLJ1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1440. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_EU880929 (Klebsiella pneumoniae strain INS23K plasmid pLJ1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
cactgccgcccgaaaaattgccggtatcggcg	Protospacer
.**.***************************.

1441. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_EU880929 (Klebsiella pneumoniae strain INS23K plasmid pLJ1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1442. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_EU880929 (Klebsiella pneumoniae strain INS23K plasmid pLJ1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
cactgccgcccgaaaaattgccggtatcggcg	Protospacer
.**.***************************.

1443. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019247 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1444. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_015599 (Escherichia coli IncN plasmid N3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1445. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN891686 (Klebsiella pneumoniae strain ZZ58 plasmid pZZ58-KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1446. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019006 (Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_2, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1447. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP008824 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKEC-39c, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1448. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP007732 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKEC-dc3, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1449. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018959 (Escherichia coli strain Ecol_422 plasmid pEC422_KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1450. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018959 (Escherichia coli strain Ecol_422 plasmid pEC422_KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1451. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP045022 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-KPC14, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1452. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP045022 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-KPC14, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1453. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021899 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_4_pilon, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1454. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021899 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_4_pilon, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1455. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029368 (Escherichia coli strain WCHEC035148 plasmid pQnrS1_035148, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1456. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP007558 (Citrobacter freundii CFNIH1 plasmid pKEC-a3c, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1457. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_011385 (Klebsiella pneumoniae plasmid 12, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1458. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022350 (Escherichia coli E109 plasmid pE109_IMP6 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1459. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022350 (Escherichia coli E109 plasmid pE109_IMP6 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1460. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050770 (Salmonella enterica subsp. enterica serovar Indiana strain SI108 plasmid pSI108-1, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1461. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025402 (Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1462. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MN328348 (Salmonella enterica subsp. enterica serovar Enteritidis strain S14 plasmid pTS14, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1463. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH401970 (Enterobacter hormaechei subsp. steigerwaltii strain MED plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1464. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH401970 (Enterobacter hormaechei subsp. steigerwaltii strain MED plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1465. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG764553 (Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccggtatcggcg	Protospacer
.******.***********************.

1466. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG764553 (Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence) position: , mismatch: 3, identity: 0.906

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcggat	Protospacer
*******.**********************  

1467. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX711879 (Pseudomonas aeruginosa strain P378 plasmid P378-IMP, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1468. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX928750 (Klebsiella pneumoniae strain CRKP-1-KPC plasmid pCRKP-1-KPC, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1469. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF072962 (Citrobacter freundii strain P10159 plasmid pP10159-2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1470. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271415 (Klebsiella pneumoniae strain H151400611 plasmid IncN_typeC, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1471. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271415 (Klebsiella pneumoniae strain H151400611 plasmid IncN_typeC, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1472. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271414 (Klebsiella pneumoniae strain H151440672 plasmid IncN_typeB, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1473. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271414 (Klebsiella pneumoniae strain H151440672 plasmid IncN_typeB, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1474. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY128483 (Klebsiella oxytoca strain 97_38 plasmid pKm38_N, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1475. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982614 (Escherichia coli strain CRE1504 plasmid pIMP-HK1504, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1476. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982615 (Escherichia coli strain CRE1505 plasmid pIMP-FS1505, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1477. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX711880 (Klebsiella pneumoniae strain 1220 plasmid p1220-IMP, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1478. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982618 (Escherichia coli strain CRE1517 plasmid pIMP-GZ1517, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1479. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU295131 (Escherichia coli strain BK28009 plasmid pBK28009, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1480. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY128484 (Klebsiella michiganensis strain 97_58 plasmid pKm38_N, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1481. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051707 (Escherichia coli strain CRE1502 plasmid pIMP-SZ1502, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1482. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982613 (Klebsiella pneumoniae strain CRE 1496 plasmid pIMP1496, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1483. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU886034 (Klebsiella pneumoniae strain Kp1 plasmid pIMP-HZ1, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1484. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU862632 (Klebsiella pneumoniae strain CRE1495 plasmid pIMP-KP1495, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1485. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051710 (Citrobacter freundii strain CRE1503 plasmid pIMP-FJ1503, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1486. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT989598 (Enterobacter cloacae strain CRE1506 plasmid pIMP-SH1506, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1487. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KM977631 (Klebsiella pneumoniae strain CRE1495 plasmid pIMP-1495, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1488. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KM660724 (Morganella morganii strain MRSN22709 plasmid pMR3-OXA181, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1489. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051708 (Klebsiella pneumoniae strain CRE1501 plasmid pIMP-SZ1501, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1490. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051709 (Escherichia coli strain CRE1058 plasmid pIMP-GZ1058, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1491. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982616 (Escherichia coli strain CRE1509 plasmid pIMP-HK1509, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1492. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU295134 (Escherichia coli strain BK32602 plasmid pBK32602, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1493. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ440076 (Escherichia coli strain CGMHLK75 plasmid pLK75, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1494. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LT221037 (Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1495. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LT221038 (Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1496. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LT221038 (Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1497. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031259 (Klebsiella quasipneumoniae strain L22 plasmid pL22-2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1498. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031259 (Klebsiella quasipneumoniae strain L22 plasmid pL22-2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1499. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021660 (Klebsiella pneumoniae FCF3SP plasmid pKPC_FCF/3SP, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1500. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021660 (Klebsiella pneumoniae FCF3SP plasmid pKPC_FCF/3SP, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1501. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028486 (Escherichia coli strain E41-1 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1502. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023420 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-4, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1503. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK878892 (Escherichia coli strain J53 plasmid pMG333, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1504. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026277 (Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1505. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033394 (Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1506. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ440075 (Klebsiella pneumoniae strain CGMHLK78 plasmid pLK78, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1507. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026236 (Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1508. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009881 (Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1509. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026169 (Leclercia sp. LSNIH1 plasmid pKPC-79f0, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1510. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052433 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1511. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT838197 (Escherichia coli isolate WI1 isolate plasmid pWI1-KPC3, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1512. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT838197 (Escherichia coli isolate WI1 isolate plasmid pWI1-KPC3, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1513. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992177 (Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1514. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LN610760 (Citrobacter freundii plasmid pCF8698_KPC2, strain CF8698, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1515. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LN610760 (Citrobacter freundii plasmid pCF8698_KPC2, strain CF8698, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1516. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036363 (Klebsiella pneumoniae strain WCHKP2080 plasmid p1_095080, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1517. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025019 (Klebsiella pneumoniae subsp. ozaenae plasmid pKo6, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1518. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP009867 (Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1519. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020527 (Enterobacter cloacae strain 109 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1520. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044159 (Shigella flexneri strain AR-0423 plasmid pAR-0423-1, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1521. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN891676 (Klebsiella pneumoniae strain 24169 plasmid p24169-KPC, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1522. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052359 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-3, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1523. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052446 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-3, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1524. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040895 (Leclercia adecarboxylata strain Z96-1 plasmid pIMP-Z96-1, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1525. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014524 (Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1526. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040178 (Klebsiella pneumoniae strain 2e plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1527. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1528. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044187 (Salmonella enterica subsp. enterica strain AR-0402 plasmid pAR-0402) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1529. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026757 (Klebsiella aerogenes strain AR_0062 plasmid tig00000053_pilon, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1530. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP035387 (Enterobacter hormaechei strain S11_16 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1531. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP035387 (Enterobacter hormaechei strain S11_16 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1532. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018963 (Escherichia coli strain Ecol_517 plasmid pEC517_KPC, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1533. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018963 (Escherichia coli strain Ecol_517 plasmid pEC517_KPC, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1534. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028958 (Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1535. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039821 (Klebsiella pneumoniae strain C2414 plasmid pC2414-3-NDM, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1536. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018758 (Metakosakonia sp. MRY16-398 plasmid pMRY16-398_2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1537. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025183 (Escherichia coli strain ECN580 plasmid pECN580, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1538. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018887 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1539. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018887 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1540. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018887 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1541. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018887 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1542. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032203 (Escherichia coli strain AR_0086 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1543. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032203 (Escherichia coli strain AR_0086 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1544. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040859 (Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1545. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_024967 (Escherichia coli strain YD626E plasmid pYD626E, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1546. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1547. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP046118 (Enterobacter cloacae strain CBG15936 plasmid pNDM1-CBG, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1548. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to KF534788 (Escherichia coli plasmid pNDM-BTR, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1549. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009862 (Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1550. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_023909 (Escherichia coli strain EcNDM1 plasmid pEcNDM1, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1551. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_023910 (Escherichia coli strain EcNDM0 plasmid pEcNDM0, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1552. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009864 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1553. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009874 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1554. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009874 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1555. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985266 (Escherichia coli strain 177 plasmid RCS53_p, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1556. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009853 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pKPC-860, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1557. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042533 (Klebsiella aerogenes strain C9 plasmid pC9_003, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1558. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042533 (Klebsiella aerogenes strain C9 plasmid pC9_003, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1559. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018977 (Escherichia coli strain Ecol_656 plasmid pEC656_KPC, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1560. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018977 (Escherichia coli strain Ecol_656 plasmid pEC656_KPC, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1561. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011589 (Enterobacter asburiae strain CAV1043 plasmid pKPC_CAV1043, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1562. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026389 (Leclercia sp. LSNIH3 plasmid pKPC-3714, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1563. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP008901 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pKPC-47e, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1564. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025965 (Klebsiella pneumoniae strain WCHKP34 plasmid pNDM1_LL34, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1565. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020066 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_5, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1566. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015389 (Klebsiella pneumoniae strain NY9 plasmid pNY9_4, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1567. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015389 (Klebsiella pneumoniae strain NY9 plasmid pNY9_4, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1568. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN178639 (Kluyvera cryocrescens strain SCW13 plasmid pSCW13-1, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1569. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038278 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-IncN, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1570. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038278 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-IncN, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1571. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP050160 (Escherichia coli plasmid Carbapenemase(IMP-4)_IncN, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1572. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050859 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-NDM, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1573. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025758 (Citrobacter freundii complex sp. CFNIH12 strain CFNIH2 plasmid pKPC-349c, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1574. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP050159 (Enterobacter cloacae plasmid Carbapenemase(IMP-26)_IncN, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1575. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018945 (Escherichia coli strain Ecol_224 plasmid pEC224_KPC, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1576. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019026 (Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1577. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026211 (Citrobacter sp. CFNIH10 plasmid pCIT-eb1a, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1578. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022367 (Escherichia coli E317 plasmid pE317_IMP6 DNA, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1579. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028579 (Klebsiella pneumoniae strain WCHKP36 plasmid p1_020036, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1580. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025710 (Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1581. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026198 (Enterobacteriaceae bacterium ENNIH3 plasmid pKPC-c606, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1582. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030335 (Escherichia coli strain AR_451 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1583. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036368 (Klebsiella pneumoniae strain WCHKP115068 plasmid p1_115068, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1584. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025984 (Enterobacteriaceae bacterium A-F18 plasmid pAF18_2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1585. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033830 (Serratia sp. FDAARGOS_506 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1586. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033830 (Serratia sp. FDAARGOS_506 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1587. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_011383 (Klebsiella pneumoniae plasmid 9, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1588. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_011383 (Klebsiella pneumoniae plasmid 9, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1589. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042581 (Enterobacter kobei strain C16 plasmid pC16_003, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1590. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020119 (Escherichia coli strain AR_0104 plasmid unitig_7, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1591. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_022885 (Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1592. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to KC170280 (Uncultured bacterium plasmid pDS2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1593. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to KC170280 (Uncultured bacterium plasmid pDS2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1594. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026496 (Klebsiella pneumoniae strain 616 plasmid pKp616_1, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1595. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022354 (Escherichia coli E033 plasmid pE033_IMP6 DNA, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1596. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022355 (Escherichia coli E034 plasmid pE034_IMP6 DNA, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1597. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022356 (Escherichia coli E119 plasmid pE119_5kIMP6 DNA, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1598. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1599. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022359 (Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1600. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_011617 (Klebsiella pneumoniae plasmid pKP96, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1601. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043184 (Escherichia coli O16:H48 strain PG20180172 plasmid pPG20180172.1-IncN, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggta-tcggca	CRISPR spacer
taccgccacccgaaaaattgccggtagactgc-	Protospacer
*******.******************  * ** 

1602. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022349 (Klebsiella pneumoniae E105 plasmid pKPI-1 DNA, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1603. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_022374 (Escherichia coli plasmid pHKU1, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1604. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018362 (Escherichia coli strain A56-1S plasmid pA56-1S, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1605. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019550 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1606. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018363 (Escherichia coli strain A56-1R plasmid pA56-1R, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1607. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052394 (Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1608. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019403 (Klebsiella pneumoniae strain E129 plasmid pE129_IMP6, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1609. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019402 (Klebsiella pneumoniae strain E013 plasmid pE013_IMP6, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1610. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019404 (Klebsiella pneumoniae strain E188 plasmid pE188_IMP6, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1611. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1612. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026590 (Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1613. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023981 (Klebsiella variicola strain X39 plasmid pX39-4, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1614. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR745047 (Klebsiella pneumoniae isolate Kpn2166 plasmid pCTX-M15_Kpn2166) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1615. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR745047 (Klebsiella pneumoniae isolate Kpn2166 plasmid pCTX-M15_Kpn2166) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1616. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985259 (Escherichia coli strain 592 plasmid RCS44_p, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcgcgc	Protospacer
*******.*********************   

1617. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985245 (Escherichia coli strain 523 plasmid RCS42_p, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
taccgccacccgaaaaattgccggtatcgcgc	Protospacer
*******.*********************   

1618. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK878894 (Escherichia coli strain J53 plasmid pMG334, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1619. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK416183 (Escherichia coli strain Ec-2Lar plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1620. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MN241904 (Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM62, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1621. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019888 (Klebsiella pneumoniae strain BK31551 plasmid pBK31551, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1622. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909339 (Klebsiella pneumoniae strain 24632 plasmid p24632-IMP, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1623. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909337 (Klebsiella pneumoniae strain 20389 plasmid p20389-IMP, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1624. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909334 (Klebsiella pneumoniae strain 13-sp plasmid p13SP-IMP, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1625. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909336 (Klebsiella pneumoniae strain 201311334 plasmid p11334-IMP, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1626. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909328 (Klebsiella pneumoniae strain D920 plasmid pD920-IMP, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1627. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH917123 (Klebsiella pneumoniae strain Kp735 plasmid pSZN_KPC, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1628. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK036890 (Klebsiella pneumoniae strain D610 plasmid pD610-1IMP, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1629. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH128095 (Klebsiella pneumoniae strain CZPF1510086 plasmid pTBCZNDM02, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1630. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK862125 (Enterobacter hormaechei strain 1-RC-17-04408-5 plasmid P04408-5-KPC40, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1631. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG886286 (Escherichia coli strain ECSIC9 plasmid pECSIC9, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1632. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG886286 (Escherichia coli strain ECSIC9 plasmid pECSIC9, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1633. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF344559 (Enterobacter hormaechei strain 128379 plasmid p128379-IMP, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1634. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH727565 (Citrobacter freundii strain ECL-14-57 plasmid pIMP-ECL14-57, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1635. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG878866 (Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1636. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271413 (Klebsiella pneumoniae strain KL49 plasmid IncN_typeA, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1637. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF344557 (Klebsiella pneumoniae strain 10677 plasmid p10677-IMP, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1638. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020059 (Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1639. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014368 (Klebsiella pneumoniae plasmid pNL194, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1640. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MT077883 (Escherichia coli plasmid p23, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1641. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MT077883 (Escherichia coli plasmid p23, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1642. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_032101 (Enterobacter cloacae plasmid pG6809-2, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1643. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX928751 (Klebsiella pneumoniae strain CRKP-5-KPC plasmid pCRKP-5-KPC, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1644. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX881941 (Klebsiella pneumoniae subsp. pneumoniae strain H154180724 plasmid pJF-WMKPCN1, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1645. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX881941 (Klebsiella pneumoniae subsp. pneumoniae strain H154180724 plasmid pJF-WMKPCN1, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1646. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021664 (Klebsiella pneumoniae FCF1305 plasmid pKPC_FCF13/05, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1647. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021664 (Klebsiella pneumoniae FCF1305 plasmid pKPC_FCF13/05, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1648. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018442 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-3, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1649. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018959 (Escherichia coli strain Ecol_422 plasmid pEC422_KPC, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1650. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP045022 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-KPC14, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1651. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021899 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_4_pilon, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1652. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022350 (Escherichia coli E109 plasmid pE109_IMP6 DNA, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1653. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH401970 (Enterobacter hormaechei subsp. steigerwaltii strain MED plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1654. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG764553 (Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgtcgcccgcaaaattgccggtatcggcg	Protospacer
.****.****** ******************.

1655. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014385 (Escherichia coli plasmid pEC_L46, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1656. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH536949 (Citrobacter freundii strain AA535 plasmid pIBACIncN, complete sequence) position: , mismatch: 4, identity: 0.875

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
caccgccacccgaaaaattgccgatatcggct	Protospacer
.******.***************.******* 

1657. spacer 20.1|4309905|30|NC_020260|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 4, identity: 0.867

gctgcgcttatccaccctacgaactgacgt	CRISPR spacer
actgcgcttgtccagcctacgaactgacgc	Protospacer
.********.**** **************.

1658. spacer 5.1|1706330|27|NC_020260|CRISPRCasFinder matches to NZ_CP019638 (Nostocales cyanobacterium HT-58-2 plasmid pHT582-2, complete sequence) position: , mismatch: 5, identity: 0.815

gggctggcgctggatttgtgaatggtg	CRISPR spacer
ctgctggcgctggatttgtcaatagag	Protospacer
  ***************** ***.* *

1659. spacer 9.1|2538705|28|NC_020260|CRISPRCasFinder matches to NZ_CP024907 (Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence) position: , mismatch: 5, identity: 0.821

ccagcgcacccgccatgcaaaaccggac	CRISPR spacer
ccagcgcacccgccgttcaaaaccccgc	Protospacer
**************.* *******  .*

1660. spacer 10.2|2714261|30|NC_020260|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 5, identity: 0.833

cggcgtatccgtcggcgtatcggtcggcgt	CRISPR spacer
cgcccggaccgtcggcgtatcggtcggcgt	Protospacer
** *  . **********************

1661. spacer 10.2|2714261|30|NC_020260|CRT matches to NZ_LT703506 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2) position: , mismatch: 6, identity: 0.8

cggcgtatccgtcggcgtatcggtcggcgt	CRISPR spacer
ggtggtattcgtcggcgtaccggtcggcga	Protospacer
 *  ****.**********.********* 

1662. spacer 10.2|2714261|30|NC_020260|CRT matches to MK224592 (UNVERIFIED: Mycobacterium phage Henu3, complete genome) position: , mismatch: 6, identity: 0.8

cggcgtatccgtcggcgtatcggtcggcgt	CRISPR spacer
cggcgtatctgtcgtcgtatcggtacgagg	Protospacer
*********.**** *********  * * 

1663. spacer 10.3|2714309|30|NC_020260|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 6, identity: 0.8

cggcgtatccgtcggcgtatccgtcggcgt	CRISPR spacer
cgcccggaccgtcggcgtatcggtcggcgt	Protospacer
** *  . ************* ********

1664. spacer 11.5|2820617|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033075 (Buttiauxella sp. 3AFRM03 plasmid pBTX_57, complete sequence) position: , mismatch: 6, identity: 0.812

ttaaaaagaacaaacacggatttttacccaac	CRISPR spacer
agaaaaagaacaaacacggctttttgcctgac	Protospacer
  ***************** *****.**..**

1665. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX711879 (Pseudomonas aeruginosa strain P378 plasmid P378-IMP, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1666. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX928750 (Klebsiella pneumoniae strain CRKP-1-KPC plasmid pCRKP-1-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1667. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX881941 (Klebsiella pneumoniae subsp. pneumoniae strain H154180724 plasmid pJF-WMKPCN1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1668. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX928751 (Klebsiella pneumoniae strain CRKP-5-KPC plasmid pCRKP-5-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1669. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF072962 (Citrobacter freundii strain P10159 plasmid pP10159-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1670. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271415 (Klebsiella pneumoniae strain H151400611 plasmid IncN_typeC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1671. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271414 (Klebsiella pneumoniae strain H151440672 plasmid IncN_typeB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1672. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY128483 (Klebsiella oxytoca strain 97_38 plasmid pKm38_N, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1673. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982614 (Escherichia coli strain CRE1504 plasmid pIMP-HK1504, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1674. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982615 (Escherichia coli strain CRE1505 plasmid pIMP-FS1505, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1675. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX711880 (Klebsiella pneumoniae strain 1220 plasmid p1220-IMP, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1676. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982618 (Escherichia coli strain CRE1517 plasmid pIMP-GZ1517, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1677. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU295131 (Escherichia coli strain BK28009 plasmid pBK28009, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1678. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY128484 (Klebsiella michiganensis strain 97_58 plasmid pKm38_N, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1679. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051707 (Escherichia coli strain CRE1502 plasmid pIMP-SZ1502, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1680. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982613 (Klebsiella pneumoniae strain CRE 1496 plasmid pIMP1496, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1681. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU886034 (Klebsiella pneumoniae strain Kp1 plasmid pIMP-HZ1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1682. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU862632 (Klebsiella pneumoniae strain CRE1495 plasmid pIMP-KP1495, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1683. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051710 (Citrobacter freundii strain CRE1503 plasmid pIMP-FJ1503, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1684. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT989598 (Enterobacter cloacae strain CRE1506 plasmid pIMP-SH1506, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1685. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KM977631 (Klebsiella pneumoniae strain CRE1495 plasmid pIMP-1495, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1686. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KM660724 (Morganella morganii strain MRSN22709 plasmid pMR3-OXA181, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1687. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051708 (Klebsiella pneumoniae strain CRE1501 plasmid pIMP-SZ1501, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1688. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU051709 (Escherichia coli strain CRE1058 plasmid pIMP-GZ1058, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1689. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT982616 (Escherichia coli strain CRE1509 plasmid pIMP-HK1509, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1690. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU295134 (Escherichia coli strain BK32602 plasmid pBK32602, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1691. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ440076 (Escherichia coli strain CGMHLK75 plasmid pLK75, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1692. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014368 (Klebsiella pneumoniae plasmid pNL194, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1693. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_020086 (Escherichia coli plasmid pE66An, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1694. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LT221037 (Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1695. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LT221038 (Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1696. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031259 (Klebsiella quasipneumoniae strain L22 plasmid pL22-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1697. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021660 (Klebsiella pneumoniae FCF3SP plasmid pKPC_FCF/3SP, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1698. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021664 (Klebsiella pneumoniae FCF1305 plasmid pKPC_FCF13/05, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1699. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028486 (Escherichia coli strain E41-1 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1700. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023420 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-4, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1701. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK878892 (Escherichia coli strain J53 plasmid pMG333, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1702. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026277 (Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1703. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033394 (Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1704. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS998787 (Escherichia coli isolate EC-TO75 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1705. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ440075 (Klebsiella pneumoniae strain CGMHLK78 plasmid pLK78, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1706. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009881 (Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1707. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MT077883 (Escherichia coli plasmid p23, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1708. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026169 (Leclercia sp. LSNIH1 plasmid pKPC-79f0, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1709. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052433 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1710. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT838197 (Escherichia coli isolate WI1 isolate plasmid pWI1-KPC3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1711. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992177 (Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1712. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to LN610760 (Citrobacter freundii plasmid pCF8698_KPC2, strain CF8698, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1713. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036363 (Klebsiella pneumoniae strain WCHKP2080 plasmid p1_095080, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1714. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025019 (Klebsiella pneumoniae subsp. ozaenae plasmid pKo6, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1715. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP009867 (Pantoea sp. PSNIH2 plasmid pKPC-56a, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1716. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044159 (Shigella flexneri strain AR-0423 plasmid pAR-0423-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1717. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_015599 (Escherichia coli IncN plasmid N3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1718. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021238 (Klebsiella pneumoniae strain Kpn-1433 plasmid pKP1433, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1719. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN891676 (Klebsiella pneumoniae strain 24169 plasmid p24169-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1720. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN891682 (Klebsiella pneumoniae strain 116753 plasmid p116753-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1721. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052359 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1722. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052446 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1723. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040895 (Leclercia adecarboxylata strain Z96-1 plasmid pIMP-Z96-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1724. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014524 (Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1725. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025186 (Klebsiella pneumoniae subsp. pneumoniae strain OW16C2 plasmid pOW16C2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1726. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040178 (Klebsiella pneumoniae strain 2e plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1727. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019006 (Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1728. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1729. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044187 (Salmonella enterica subsp. enterica strain AR-0402 plasmid pAR-0402) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1730. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026757 (Klebsiella aerogenes strain AR_0062 plasmid tig00000053_pilon, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1731. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP035387 (Enterobacter hormaechei strain S11_16 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1732. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052872 (Enterobacter cloacae strain 3849 plasmid p3846_IncN_VIM-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1733. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018963 (Escherichia coli strain Ecol_517 plasmid pEC517_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1734. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_021622 (Klebsiella pneumoniae plasmid pK45-67VIM complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1735. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018884 (Klebsiella pneumoniae subsp. pneumoniae strain BR7 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1736. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028958 (Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1737. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039821 (Klebsiella pneumoniae strain C2414 plasmid pC2414-3-NDM, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1738. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_025183 (Escherichia coli strain ECN580 plasmid pECN580, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1739. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018887 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1740. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032203 (Escherichia coli strain AR_0086 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1741. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040859 (Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1742. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_024967 (Escherichia coli strain YD626E plasmid pYD626E, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1743. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_019082 (Escherichia coli plasmid pZS50, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1744. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP046118 (Enterobacter cloacae strain CBG15936 plasmid pNDM1-CBG, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1745. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to KF534788 (Escherichia coli plasmid pNDM-BTR, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1746. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009862 (Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1747. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014208 (Klebsiella oxytoca KOX105 plasmid pKOX105, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1748. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_023909 (Escherichia coli strain EcNDM1 plasmid pEcNDM1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1749. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_023910 (Escherichia coli strain EcNDM0 plasmid pEcNDM0, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1750. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009864 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1751. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009874 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1752. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985266 (Escherichia coli strain 177 plasmid RCS53_p, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1753. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009853 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pKPC-860, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1754. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042533 (Klebsiella aerogenes strain C9 plasmid pC9_003, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1755. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018977 (Escherichia coli strain Ecol_656 plasmid pEC656_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1756. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011589 (Enterobacter asburiae strain CAV1043 plasmid pKPC_CAV1043, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1757. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026389 (Leclercia sp. LSNIH3 plasmid pKPC-3714, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1758. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP008901 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pKPC-47e, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1759. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_032101 (Enterobacter cloacae plasmid pG6809-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1760. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025965 (Klebsiella pneumoniae strain WCHKP34 plasmid pNDM1_LL34, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1761. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020066 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_5, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1762. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN178639 (Kluyvera cryocrescens strain SCW13 plasmid pSCW13-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1763. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038278 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-IncN, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1764. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP050160 (Escherichia coli plasmid Carbapenemase(IMP-4)_IncN, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1765. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050859 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-NDM, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1766. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_014385 (Escherichia coli plasmid pEC_L46, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1767. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025758 (Citrobacter freundii complex sp. CFNIH12 strain CFNIH2 plasmid pKPC-349c, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1768. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP050159 (Enterobacter cloacae plasmid Carbapenemase(IMP-26)_IncN, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1769. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018945 (Escherichia coli strain Ecol_224 plasmid pEC224_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1770. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018959 (Escherichia coli strain Ecol_422 plasmid pEC422_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1771. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019026 (Escherichia coli strain Ecol_881 plasmid pEC881_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1772. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026213 (Citrobacter sp. CFNIH10 plasmid pKPC-933d, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1773. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP045022 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-KPC14, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1774. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022367 (Escherichia coli E317 plasmid pE317_IMP6 DNA, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1775. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022370 (Klebsiella pneumoniae E328 plasmid pE328_IMP6 DNA, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1776. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1777. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025710 (Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1778. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030335 (Escherichia coli strain AR_451 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1779. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036368 (Klebsiella pneumoniae strain WCHKP115068 plasmid p1_115068, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1780. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033830 (Serratia sp. FDAARGOS_506 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1781. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_011383 (Klebsiella pneumoniae plasmid 9, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1782. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_011385 (Klebsiella pneumoniae plasmid 12, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1783. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to KC170280 (Uncultured bacterium plasmid pDS2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1784. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026496 (Klebsiella pneumoniae strain 616 plasmid pKp616_1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1785. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022354 (Escherichia coli E033 plasmid pE033_IMP6 DNA, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1786. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022355 (Escherichia coli E034 plasmid pE034_IMP6 DNA, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1787. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022356 (Escherichia coli E119 plasmid pE119_5kIMP6 DNA, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1788. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1789. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022359 (Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1790. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_011617 (Klebsiella pneumoniae plasmid pKP96, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1791. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP022349 (Klebsiella pneumoniae E105 plasmid pKPI-1 DNA, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1792. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_022374 (Escherichia coli plasmid pHKU1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1793. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018362 (Escherichia coli strain A56-1S plasmid pA56-1S, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1794. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019550 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1795. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018363 (Escherichia coli strain A56-1R plasmid pA56-1R, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1796. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to CP052394 (Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1797. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019403 (Klebsiella pneumoniae strain E129 plasmid pE129_IMP6, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1798. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019402 (Klebsiella pneumoniae strain E013 plasmid pE013_IMP6, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1799. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019404 (Klebsiella pneumoniae strain E188 plasmid pE188_IMP6, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1800. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1801. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021734 (Escherichia coli strain AR_0114 plasmid unitig_2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1802. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026590 (Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1803. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023981 (Klebsiella variicola strain X39 plasmid pX39-4, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1804. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR745047 (Klebsiella pneumoniae isolate Kpn2166 plasmid pCTX-M15_Kpn2166) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1805. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK878894 (Escherichia coli strain J53 plasmid pMG334, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1806. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK416183 (Escherichia coli strain Ec-2Lar plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1807. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MN241904 (Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM62, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1808. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909344 (Enterobacter cloacae strain 12949 plasmid p12949-FIIY, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1809. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909339 (Klebsiella pneumoniae strain 24632 plasmid p24632-IMP, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1810. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909337 (Klebsiella pneumoniae strain 20389 plasmid p20389-IMP, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1811. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909334 (Klebsiella pneumoniae strain 13-sp plasmid p13SP-IMP, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1812. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909336 (Klebsiella pneumoniae strain 201311334 plasmid p11334-IMP, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1813. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH909328 (Klebsiella pneumoniae strain D920 plasmid pD920-IMP, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1814. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH917123 (Klebsiella pneumoniae strain Kp735 plasmid pSZN_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1815. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK036890 (Klebsiella pneumoniae strain D610 plasmid pD610-1IMP, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1816. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK862125 (Enterobacter hormaechei strain 1-RC-17-04408-5 plasmid P04408-5-KPC40, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1817. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG886286 (Escherichia coli strain ECSIC9 plasmid pECSIC9, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1818. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH536949 (Citrobacter freundii strain AA535 plasmid pIBACIncN, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1819. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH401970 (Enterobacter hormaechei subsp. steigerwaltii strain MED plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1820. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH727565 (Citrobacter freundii strain ECL-14-57 plasmid pIMP-ECL14-57, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1821. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG878866 (Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1822. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY271413 (Klebsiella pneumoniae strain KL49 plasmid IncN_typeA, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1823. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF344557 (Klebsiella pneumoniae strain 10677 plasmid p10677-IMP, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1824. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG764553 (Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1825. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020059 (Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctggccgccgccactgttaccgcctctgaacg	Protospacer
.** . .**.**********************

1826. spacer 18.1|3798132|27|NC_020260|CRISPRCasFinder matches to NZ_CP041974 (Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

aaaacgccgccccatttcccgcagggt	CRISPR spacer
taaactccgccccatttcccgcacatc	Protospacer
 **** ***************** . .

1827. spacer 20.1|4309905|30|NC_020260|CRISPRCasFinder matches to NZ_CP010421 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence) position: , mismatch: 6, identity: 0.8

gctgcgcttatccaccctacgaactgacgt	CRISPR spacer
gctgcgctaacccaccctacgaacggcccc	Protospacer
******** *.************* * * .

1828. spacer 2.1|146459|29|NC_020260|CRISPRCasFinder matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 7, identity: 0.759

atgttagacaaggtttaatgcgtcttgta	CRISPR spacer
ttgttagacaaggttttatccgtcactga	Protospacer
 *************** ** **** .  *

1829. spacer 10.3|2714309|30|NC_020260|CRT matches to NZ_CP020811 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

cggcgtatccgtcggcgtatccgtcggcgt-	CRISPR spacer
cggcgtatccatcggcgtatgcg-aaacatg	Protospacer
**********.********* **  ..*.* 

1830. spacer 10.3|2714309|30|NC_020260|CRT matches to NZ_CP038032 (Rhodococcus ruber strain R1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

cggcgtatccgtcggcgtatccgtcggcgt	CRISPR spacer
ccttgactacgtcggcgtatccgtcgtcgt	Protospacer
*  .*  * ***************** ***

1831. spacer 12.6|2847531|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 7, identity: 0.781

aagtcttt----cgaagccttccggcgctgggccac	CRISPR spacer
----ccttggaacgaagcgttccggcgccgggccac	Protospacer
    *.**    ****** *********.*******

1832. spacer 12.6|2847531|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.781

aagtcttt----cgaagccttccggcgctgggccac	CRISPR spacer
----ccttggaacgaagcgttccggcgccgggccac	Protospacer
    *.**    ****** *********.*******

1833. spacer 12.6|2847531|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.781

aagtcttt----cgaagccttccggcgctgggccac	CRISPR spacer
----ccttggaacgaagcgttccggcgccgggccac	Protospacer
    *.**    ****** *********.*******

1834. spacer 12.15|2848080|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MT701595 (Streptomyces phage Shaeky, complete genome) position: , mismatch: 7, identity: 0.781

tacct-gcatttttcgacagccgcgccaacgaa	CRISPR spacer
-acgtagagtttggcgacagccgcgccaacgac	Protospacer
 ** * * .***  ****************** 

1835. spacer 12.17|2848202|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013345 (Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

taccgccgcccgaaaaattgccggtatcggca	CRISPR spacer
cgccgccgcccgcaaaattgccggtcccgtcg	Protospacer
..********** ************ .** *.

1836. spacer 20.1|4309905|30|NC_020260|CRISPRCasFinder matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 7, identity: 0.767

gctgcgcttatccaccctacgaactgacgt	CRISPR spacer
gctgcgcttgtccaccctacgacaccgcgg	Protospacer
*********.************  . .** 

1837. spacer 10.2|2714261|30|NC_020260|CRT matches to NZ_CP014599 (Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733

cggcgtatccgtcggcgtatcggtcggcgt	CRISPR spacer
ttggggatcagtcggcgtatcggtcggacg	Protospacer
. * * *** *****************   

1838. spacer 10.3|2714309|30|NC_020260|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

cggcgtatccgtcggcgtatccgtcggcgt	CRISPR spacer
gttggcatccgtcggcgtatccggcggcag	Protospacer
    *.***************** ****. 

1839. spacer 10.3|2714309|30|NC_020260|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.733

cggcgtatccgtcggcgtatccgtcggcgt	CRISPR spacer
gttggcatccgtcggcgtatccggcggcag	Protospacer
    *.***************** ****. 

1840. spacer 10.3|2714309|30|NC_020260|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

cggcgtatccgtcggcgtatccgtcggcgt	CRISPR spacer
gttggcatccgtcggcgtatccggcggcag	Protospacer
    *.***************** ****. 

1841. spacer 10.3|2714309|30|NC_020260|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

cggcgtatccgtcggcgtatccgtcggcgt	CRISPR spacer
gttggcatccgtcggcgtatccggcggcag	Protospacer
    *.***************** ****. 

1842. spacer 10.3|2714309|30|NC_020260|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.733

cggcgtatccgtcggcgtatccgtcggcgt	CRISPR spacer
gttggcatccgtcggcgtatccggcggcag	Protospacer
    *.***************** ****. 

1843. spacer 10.3|2714309|30|NC_020260|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

cggcgtatccgtcggcgtatccgtcggcgt	CRISPR spacer
gttggcatccgtcggcgtatccggcggcag	Protospacer
    *.***************** ****. 

1844. spacer 10.3|2714309|30|NC_020260|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

cggcgtatccgtcggcgtatccgtcggcgt	CRISPR spacer
gttggcatccgtcggcgtatccggcggcag	Protospacer
    *.***************** ****. 

1845. spacer 10.3|2714309|30|NC_020260|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

cggcgtatccgtcggcgtatccgtcggcgt	CRISPR spacer
gttggcatccgtcggcgtatccggcggcag	Protospacer
    *.***************** ****. 

1846. spacer 10.3|2714309|30|NC_020260|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

cggcgtatccgtcggcgtatccgtcggcgt	CRISPR spacer
gttggcatccgtcggcgtatccggcggcag	Protospacer
    *.***************** ****. 

1847. spacer 10.3|2714309|30|NC_020260|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

cggcgtatccgtcggcgtatccgtcggcgt	CRISPR spacer
gttggcatccgtcggcgtatccggcggcag	Protospacer
    *.***************** ****. 

1848. spacer 10.3|2714309|30|NC_020260|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

cggcgtatccgtcggcgtatccgtcggcgt	CRISPR spacer
gttggcatccgtcggcgtatccggcggcag	Protospacer
    *.***************** ****. 

1849. spacer 10.3|2714309|30|NC_020260|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

cggcgtatccgtcggcgtatccgtcggcgt	CRISPR spacer
gttggcatccgtcggcgtatccggcggcag	Protospacer
    *.***************** ****. 

1850. spacer 10.3|2714309|30|NC_020260|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

cggcgtatccgtcggcgtatccgtcggcgt	CRISPR spacer
gttggcatccgtcggcgtatccggcggcag	Protospacer
    *.***************** ****. 

1851. spacer 11.7|2820739|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgccggtctggaaaatattcccgccctcctg	CRISPR spacer
gcgccgctctggaaaattttcccgactgcagc	Protospacer
****** ********** ****** *. *   

1852. spacer 12.13|2847958|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.75

gtagcgctggcccttctgtttcggcgcgctgg	CRISPR spacer
ggcgcgctgccccttctgcttcggcgagaccg	Protospacer
*  ****** ********.******* * . *

1853. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MK448234 (Klebsiella phage ST11-VIM1phi8.2, complete genome) position: , mismatch: 8, identity: 0.75

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
tcgctgaccaccattgtttccgccttccgccg	Protospacer
*.***********.**** ******.. . **

1854. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MK416013 (Klebsiella phage ST16-OXA48phi5.1, complete genome) position: , mismatch: 8, identity: 0.75

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
tcgctgaccaccattgtttccgccttccgccg	Protospacer
*.***********.**** ******.. . **

1855. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to KX758539 (Mycobacterium phage Jaan, complete genome) position: , mismatch: 8, identity: 0.75

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctgctgaccgccaccgttaccgccgccgttgg	Protospacer
.********.****.********* *.*   *

1856. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to EU744250 (Mycobacterium virus Pukovnik, complete genome) position: , mismatch: 8, identity: 0.75

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctgctgaccgccaccgttaccgccgccgttgg	Protospacer
.********.****.********* *.*   *

1857. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MK448237 (Klebsiella phage ST974-OXA48phi18.2, complete genome) position: , mismatch: 8, identity: 0.75

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
tcgctgaccaccattgtttccgccttccgccg	Protospacer
*.***********.**** ******.. . **

1858. spacer 12.19|2848324|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_031279 (Mycobacterium phage Bactobuster, complete genome) position: , mismatch: 8, identity: 0.75

ttgctgaccaccactgttaccgcctctgaacg	CRISPR spacer
ctgctgaccgccaccgttaccgccgccgttgg	Protospacer
.********.****.********* *.*   *

1859. spacer 11.2|2820434|32|NC_020260|PILER-CR,CRISPRCasFinder,CRT matches to MN694637 (Marine virus AFVG_250M580, complete genome) position: , mismatch: 9, identity: 0.719

accgccaaattatggctattctctggtcttcg	CRISPR spacer
ctggtcctgttctggctattgtctggtcttcg	Protospacer
 . *.*  .** ******** ***********

1860. spacer 12.1|2847227|31|NC_020260|CRT matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 9, identity: 0.71

agagagccgaagctgttgcgcttcatgagct	CRISPR spacer
gccttgccgcagctgttgcgcttcaagatcg	Protospacer
.    **** *************** ** * 

1861. spacer 12.10|2847775|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 9, identity: 0.719

gatcgcctcatcaaaatcggcggtcgcaggtg	CRISPR spacer
gatcgcctcggcaaaatcggcggttcttgccc	Protospacer
*********. *************. . * . 

1862. spacer 12.10|2847775|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP014011 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C79-MedDCM-OCT-S38-C32, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719

gatcgcctcatcaaaatcggcggtcgcaggtg	CRISPR spacer
ctgctgctgatcaaaatcggcggttgcaggaa	Protospacer
   *  ** ***************.***** .

1863. spacer 12.10|2847775|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to AP013546 (Uncultured phage_MedDCM-OCT-S37-C6 DNA, complete genome, group G9, isolate: uvMED-CGR-C79-MedDCM-OCT-S37-C6) position: , mismatch: 9, identity: 0.719

gatcgcctcatcaaaatcggcggtcgcaggtg	CRISPR spacer
ctgctgctgatcaaaatcggcggttgcaggaa	Protospacer
   *  ** ***************.***** .

1864. spacer 12.12|2847897|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_024385 (Leuconostoc phage phiLN12, complete genome) position: , mismatch: 9, identity: 0.719

ggccagtgcgttgataatagactctgtggcgt	CRISPR spacer
acctagtgcgttgataatactctctgtattct	Protospacer
. *.***************  ******. . *

1865. spacer 12.12|2847897|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to KC013023 (Leuconostoc phage phiLN04, complete genome) position: , mismatch: 9, identity: 0.719

ggccagtgcgttgataatagactctgtggcgt	CRISPR spacer
acctagtgcgttgataatactctctgtattct	Protospacer
. *.***************  ******. . *

1866. spacer 12.18|2848263|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031163 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence) position: , mismatch: 9, identity: 0.719

gaatgctctactccaccattgacgttgttgtg	CRISPR spacer
gttttgccttctccaccactgacgttgttgaa	Protospacer
*  *  .** ********.*********** .

1867. spacer 12.20|2848385|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgcaaatgtaaaacgcgacgtgggcgcact------	CRISPR spacer
gtcgcagatgtaatacgcgacgt------accttatgc	Protospacer
******.****** *********      **.      

1868. spacer 12.21|2848446|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP049813 (Monaibacterium sp. ALG8 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gattcgccaacggtgacgccggcgttcgtatg	CRISPR spacer
acatcgccatcggtgacgcgggcgttctgact	Protospacer
.  ****** ********* *******  *. 

1869. spacer 12.2|2847287|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP045276 (Bacillus megaterium strain FDU301 plasmid pFDU301D, complete sequence) position: , mismatch: 10, identity: 0.688

cagttgtatcaaatttccaaatccaaaccgcc	CRISPR spacer
agaaggtatcaaactttcaaatccaaactcac	Protospacer
 ..  ********.**.***********.  *

1870. spacer 12.2|2847287|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_016034 (Lactobacillus buchneri subsp. silagei CD034 plasmid pCD034-2, complete sequence) position: , mismatch: 10, identity: 0.688

cagttgtatcaaatttccaaatccaaaccgcc	CRISPR spacer
aaagcaagacaattttccaaatcaaaaccgcc	Protospacer
 *. .. . *** ********** ********

1871. spacer 12.5|2847470|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688

gcaaaaaataccgccgcgacgcgaagtggatg	CRISPR spacer
tgccgacgtaccgcagcgacgcgaagtcgatc	Protospacer
    .* .****** ************ *** 

1872. spacer 12.5|2847470|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

gcaaaaaataccgccgcgacgcgaagtggatg	CRISPR spacer
ccaaaaaatactgccgcgactcgaccacatag	Protospacer
 **********.******** ***    .  *

1873. spacer 12.21|2848446|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

gattcgccaacggtgacgccggcgttcgtatg	CRISPR spacer
gattcgccgatggtgacgccggccgcctcggc	Protospacer
********.*.************  .* ..  

1874. spacer 20.1|4309905|30|NC_020260|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 10, identity: 0.667

gctgcgcttatccaccctacgaactgacgt	CRISPR spacer
gctgcgcttgtccaccctacggcgctgtcc	Protospacer
*********.***********.  . .. .

1875. spacer 12.2|2847287|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN693792 (Marine virus AFVG_250M943, complete genome) position: , mismatch: 11, identity: 0.656

cagttgtatcaaatttccaaatccaaaccgcc	CRISPR spacer
ggcttgtttcaaatttccatatccaactacat	Protospacer
 . **** *********** ****** .   .

1876. spacer 12.2|2847287|32|NC_020260|CRT,PILER-CR,CRISPRCasFinder matches to MN694234 (Marine virus AFVG_250M972, complete genome) position: , mismatch: 11, identity: 0.656

cagttgtatcaaatttccaaatccaaaccgcc	CRISPR spacer
ggcttgtttcaaatttccatatccaactacat	Protospacer
 . **** *********** ****** .   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 299233 : 358078 72 Salmonella_phage(75.56%) tRNA,portal,integrase,head,terminase,lysis,plate,capsid,tail attL 298870:298887|attR 347625:347642
DBSCAN-SWA_2 1188240 : 1194568 6 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_3 1241209 : 1250198 9 Burkholderia_phage(33.33%) NA NA
DBSCAN-SWA_4 1264320 : 1303035 49 Enterobacteria_phage(31.71%) portal,holin,head,terminase,protease,lysis,capsid,tail NA
DBSCAN-SWA_5 1619922 : 1681742 70 Salmonella_phage(40.48%) tRNA,portal,holin,terminase,protease,plate,capsid,head,tail NA
DBSCAN-SWA_6 2094391 : 2104589 12 Bacillus_phage(14.29%) tRNA NA
DBSCAN-SWA_7 2471983 : 2502383 38 Cronobacter_phage(83.87%) holin,portal,integrase,terminase,plate,capsid,head,tail attL 2492903:2492918|attR 2510001:2510016
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage