Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_020267 Staphylococcus warneri SG1 plasmid clone pvSw5 genomic sequence 0 crisprs NA 0 0 0 0
NC_020274 Staphylococcus warneri SG1 plasmid clone pvSw1 genomic sequence 0 crisprs WYL 0 0 1 0
NC_020164 Staphylococcus warneri SG1, complete genome 2 crisprs csa3,WYL,DEDDh,cas3,DinG 1 0 6 0
NC_020264 Staphylococcus warneri SG1 plasmid clone pvSw2 genomic sequence 0 crisprs NA 0 0 0 0
NC_020266 Staphylococcus warneri SG1 plasmid clone pvSw4 genomic sequence 0 crisprs NA 0 0 0 0
NC_020269 Staphylococcus warneri SG1 plasmid clone pvSw7 genomic sequence 0 crisprs NA 0 0 0 0
NC_020268 Staphylococcus warneri SG1 plasmid clone pvSw6 genomic sequence 0 crisprs NA 0 0 0 0
NC_020265 Staphylococcus warneri SG1 plasmid clone pvSw3 genomic sequence 0 crisprs NA 0 0 0 0
NC_020165 Staphylococcus warneri SG1 plasmid pSZ4, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_020274
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3926 : 13130 12 Streptococcus_phage(66.67%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_020164
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020164_1 544808-544894 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020164_2 2240505-2240597 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_020164_1 1.1|544832|39|NC_020164|CRISPRCasFinder 544832-544870 39 NC_020164.1 550470-550508 2 0.949

1. spacer 1.1|544832|39|NC_020164|CRISPRCasFinder matches to position: 550470-550508, mismatch: 2, identity: 0.949

tacttcttacgcagtagtgaaagctactgtgatccttaa	CRISPR spacer
tacttcttacgcagtagcgcaagctactgtgatccttaa	Protospacer
*****************.* *******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1014235 : 1050697 33 Staphylococcus_phage(96.15%) tRNA NA
DBSCAN-SWA_2 1174948 : 1183972 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_3 1646661 : 1715486 90 Staphylococcus_phage(61.67%) protease,tRNA,tail,capsid,integrase,terminase,head,portal attL 1669093:1669114|attR 1715548:1715569
DBSCAN-SWA_4 1789900 : 1798370 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 2054270 : 2061473 8 Pandoravirus(14.29%) NA NA
DBSCAN-SWA_6 2394582 : 2412953 27 Staphylococcus_phage(66.67%) terminase,integrase attL 2389350:2389365|attR 2405615:2405630
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage