Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_019731 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.03, complete sequence 2 crisprs RT,c2c9_V-U4 1 2 1 0
NC_019729 Oscillatoria nigro-viridis PCC 7112, complete sequence 67 crisprs Cas14c_CAS-V-F,cas14k,RT,cas14j,PD-DExK,DEDDh,c2c9_V-U4,WYL,cas10,cmr4gr7,cmr5gr11,csx1,Cas9_archaeal,Cas14u_CAS-V,csm3gr7,csx19,csx10gr5,csa3,cas6,2OG_CAS,csx21,csm6,csm2gr11,DinG,cas3,cas10d,csc2gr7,csc1gr5,cas4,cas1,cas2,csx3 12 34 9 1
NC_019730 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.02, complete sequence 0 crisprs c2c9_V-U4,PD-DExK,cas3,RT,Cas9_archaeal,cas14k,cas14j 0 0 3 0
NC_019732 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.05, complete sequence 0 crisprs NA 0 0 0 0
NC_019764 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.04, complete sequence 2 crisprs NA 1 2 0 0
NC_019763 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.01, complete sequence 2 crisprs csa3,cas14j,Cas14u_CAS-V,PD-DExK,cas3 0 2 1 0

Results visualization

1. NC_019731
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019731_1 8878-8974 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019731_2 97369-97461 TypeV-U4 NA
1 spacers
c2c9_V-U4

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_019731_1 1.1|8902|49|NC_019731|CRISPRCasFinder 8902-8950 49 NC_019731.1 98707-98755 0 1.0

1. spacer 1.1|8902|49|NC_019731|CRISPRCasFinder matches to position: 98707-98755, mismatch: 0, identity: 1.0

attcaactgttccgataaatgccatcgatgctatgttagcccagtgtgc	CRISPR spacer
attcaactgttccgataaatgccatcgatgctatgttagcccagtgtgc	Protospacer
*************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_019731_1 1.1|8902|49|NC_019731|CRISPRCasFinder 8902-8950 49 NC_019731 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.03, complete sequence 8902-8950 0 1.0
NC_019731_1 1.1|8902|49|NC_019731|CRISPRCasFinder 8902-8950 49 NC_019731 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.03, complete sequence 98707-98755 0 1.0
NC_019731_2 2.1|97399|33|NC_019731|CRISPRCasFinder 97399-97431 33 NC_019731 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.03, complete sequence 97399-97431 0 1.0
NC_019731_2 2.1|97399|33|NC_019731|CRISPRCasFinder 97399-97431 33 NC_019763 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.01, complete sequence 120489-120521 4 0.879
NC_019731_2 2.1|97399|33|NC_019731|CRISPRCasFinder 97399-97431 33 NZ_CP035565 Lactobacillus paracasei strain SRCM103299 plasmid unnamed2 23235-23267 7 0.788
NC_019731_2 2.1|97399|33|NC_019731|CRISPRCasFinder 97399-97431 33 NZ_AP018394 Lactobacillus paracasei strain IJH-SONE68 plasmid pLPS-2 28674-28706 7 0.788
NC_019731_2 2.1|97399|33|NC_019731|CRISPRCasFinder 97399-97431 33 NZ_CP039708 Lactobacillus paracasei strain Lp02 plasmid pLp02-1, complete sequence 31343-31375 7 0.788
NC_019731_2 2.1|97399|33|NC_019731|CRISPRCasFinder 97399-97431 33 NZ_CP014987 Lactobacillus paracasei strain IIA plasmid unnamed2, complete sequence 40876-40908 7 0.788

1. spacer 1.1|8902|49|NC_019731|CRISPRCasFinder matches to NC_019731 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.03, complete sequence) position: , mismatch: 0, identity: 1.0

attcaactgttccgataaatgccatcgatgctatgttagcccagtgtgc	CRISPR spacer
attcaactgttccgataaatgccatcgatgctatgttagcccagtgtgc	Protospacer
*************************************************

2. spacer 1.1|8902|49|NC_019731|CRISPRCasFinder matches to NC_019731 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.03, complete sequence) position: , mismatch: 0, identity: 1.0

attcaactgttccgataaatgccatcgatgctatgttagcccagtgtgc	CRISPR spacer
attcaactgttccgataaatgccatcgatgctatgttagcccagtgtgc	Protospacer
*************************************************

3. spacer 2.1|97399|33|NC_019731|CRISPRCasFinder matches to NC_019731 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.03, complete sequence) position: , mismatch: 0, identity: 1.0

tagataacggctactgtgttgccaattttctca	CRISPR spacer
tagataacggctactgtgttgccaattttctca	Protospacer
*********************************

4. spacer 2.1|97399|33|NC_019731|CRISPRCasFinder matches to NC_019763 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.01, complete sequence) position: , mismatch: 4, identity: 0.879

tagataacggctactgtgttgccaattttctca	CRISPR spacer
gacataacggctgctgtggtgccaattttctca	Protospacer
 * *********.***** **************

5. spacer 2.1|97399|33|NC_019731|CRISPRCasFinder matches to NZ_CP035565 (Lactobacillus paracasei strain SRCM103299 plasmid unnamed2) position: , mismatch: 7, identity: 0.788

tagataacggctactgtgttgccaattttctca	CRISPR spacer
tggataacggctacgatgttgccaattacttcg	Protospacer
*.************ .*********** ..**.

6. spacer 2.1|97399|33|NC_019731|CRISPRCasFinder matches to NZ_AP018394 (Lactobacillus paracasei strain IJH-SONE68 plasmid pLPS-2) position: , mismatch: 7, identity: 0.788

tagataacggctactgtgttgccaattttctca	CRISPR spacer
tggataacggctacgatgttgccaattacttcg	Protospacer
*.************ .*********** ..**.

7. spacer 2.1|97399|33|NC_019731|CRISPRCasFinder matches to NZ_CP039708 (Lactobacillus paracasei strain Lp02 plasmid pLp02-1, complete sequence) position: , mismatch: 7, identity: 0.788

tagataacggctactgtgttgccaattttctca	CRISPR spacer
tggataacggctacgatgttgccaattacttcg	Protospacer
*.************ .*********** ..**.

8. spacer 2.1|97399|33|NC_019731|CRISPRCasFinder matches to NZ_CP014987 (Lactobacillus paracasei strain IIA plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788

tagataacggctactgtgttgccaattttctca	CRISPR spacer
tggataacggctacgatgttgccaattacttcg	Protospacer
*.************ .*********** ..**.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 48182 : 95865 40 Brevibacillus_phage(33.33%) transposase,integrase attL 46526:46541|attR 107109:107124
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_019729
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_1 33638-33733 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_4 378303-378464 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_2 377580-377742 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_3 377910-378204 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_5 533394-533474 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_6 542295-542380 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_7 603426-604860 TypeIII NA
19 spacers
csx1,cmr5gr11,cmr4gr7,cas10,WYL,c2c9_V-U4,RT,Cas9_archaeal

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_8 648662-650342 Orphan NA
22 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_9 685940-686041 TypeV-U4 NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_10 874065-874136 Unclear NA
1 spacers
Cas14u_CAS-V

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_11 908224-908400 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_12 984953-985044 TypeIII-D NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_13 1071872-1072165 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_14 1087305-1087416 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_16 1286929-1287037 Orphan I-D,II-B
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_15 1286014-1286840 Orphan I-D,II-B
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_17 1416380-1416485 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_18 1422148-1422262 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_19 1581001-1581083 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_20 1600478-1600645 TypeV,TypeI-A NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_21 2103445-2103566 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_22 2165469-2165598 TypeV NA
1 spacers
Cas14c_CAS-V-F,cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_23 2190714-2190808 TypeV NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_24 2390640-2390768 TypeV NA
1 spacers
c2c9_V-U4,Cas14c_CAS-V-F

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_25 2496251-2496370 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_26 2853086-2853177 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_27 2904685-2904786 TypeV NA
1 spacers
Cas14c_CAS-V-F

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_28 3028538-3028647 Orphan NA
1 spacers
2OG_CAS

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_29 3071965-3072033 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_30 3078640-3078734 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_31 3146932-3147063 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_32 3371394-3371473 TypeIII-A,TypeIII-D? NA
1 spacers
PD-DExK

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_33 3538828-3538923 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_34 3626128-3626262 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_35 3971113-3971243 TypeV-U4 NA
1 spacers
c2c9_V-U4

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_36 4041098-4041181 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_37 4153091-4153171 TypeV NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_38 4168609-4168802 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_39 4217750-4217833 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_40 4644663-4645729 Orphan NA
14 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_41 4700659-4700758 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_42 4759614-4759719 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_43 4853294-4853410 TypeI-A,TypeV-U4? NA
1 spacers
c2c9_V-U4,csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_44 4873443-4876460 Orphan I-D,II-B
41 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_45 4923176-4923255 TypeV NA
1 spacers
Cas14c_CAS-V-F

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_46 4977856-4984951 Orphan I-D,II-B
95 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_47 4990863-4991025 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_48 5142695-5142796 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_49 5412016-5412096 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_50 5463123-5463238 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_51 5747468-5747594 TypeV NA
1 spacers
Cas14c_CAS-V-F,cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_52 5775450-5775595 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_53 5824369-5824479 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_54 5833416-5833506 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_55 5851097-5851196 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_56 5969579-5969734 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_57 6082551-6082648 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_58 6125700-6130855 TypeV I-D,II-B
70 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_59 6543961-6544108 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_60 6575143-6575238 TypeI-D NA
1 spacers
cas3,csc1gr5,csc2gr7,cas10d,WYL,cas4,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_61 6575290-6575472 TypeI-D NA
2 spacers
cas6,cas3,csc1gr5,csc2gr7,cas10d,WYL,cas4,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_62 6577718-6579210 TypeI-D I-D,II-B
20 spacers
cas2,cas1,cas4,cas6,cas3,csc1gr5,csc2gr7,cas10d

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_63 6943851-6944038 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_64 6967218-6967673 TypeV NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_65 7311290-7311389 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_66 7410696-7410797 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019729_67 7425997-7426156 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_019729_10 10.1|874089|24|NC_019729|CRISPRCasFinder 874089-874112 24 NC_019729.1 4961135-4961158 2 0.917
NC_019729_13 13.3|1072038|25|NC_019729|CRT 1072038-1072062 25 NC_019729.1 2069095-2069119 0 1.0
NC_019729_13 13.3|1072038|25|NC_019729|CRT 1072038-1072062 25 NC_019729.1 2069130-2069154 0 1.0
NC_019729_13 13.3|1072038|25|NC_019729|CRT 1072038-1072062 25 NC_019729.1 1072166-1072190 0 1.0
NC_019729_13 13.3|1072038|25|NC_019729|CRT 1072038-1072062 25 NC_019729.1 5794919-5794943 1 0.96
NC_019729_13 13.3|1072038|25|NC_019729|CRT 1072038-1072062 25 NC_019729.1 6540616-6540640 2 0.92
NC_019729_13 13.3|1072038|25|NC_019729|CRT 1072038-1072062 25 NC_019729.1 1619865-1619889 2 0.92
NC_019729_13 13.4|1072105|19|NC_019729|CRT 1072105-1072123 19 NC_019729.1 7158302-7158320 2 0.895
NC_019729_26 26.1|2853118|28|NC_019729|CRISPRCasFinder 2853118-2853145 28 NC_019729.1 4273128-4273155 1 0.964
NC_019729_26 26.1|2853118|28|NC_019729|CRISPRCasFinder 2853118-2853145 28 NC_019729.1 4882083-4882110 1 0.964
NC_019729_26 26.1|2853118|28|NC_019729|CRISPRCasFinder 2853118-2853145 28 NC_019729.1 2917017-2917044 1 0.964
NC_019729_26 26.1|2853118|28|NC_019729|CRISPRCasFinder 2853118-2853145 28 NC_019729.1 2949589-2949616 2 0.929
NC_019729_26 26.1|2853118|28|NC_019729|CRISPRCasFinder 2853118-2853145 28 NC_019729.1 7191874-7191901 2 0.929
NC_019729_26 26.1|2853118|28|NC_019729|CRISPRCasFinder 2853118-2853145 28 NC_019729.1 1437436-1437463 2 0.929
NC_019729_26 26.1|2853118|28|NC_019729|CRISPRCasFinder 2853118-2853145 28 NC_019729.1 5786579-5786606 2 0.929
NC_019729_26 26.1|2853118|28|NC_019729|CRISPRCasFinder 2853118-2853145 28 NC_019729.1 7049610-7049637 2 0.929
NC_019729_39 39.1|4217777|30|NC_019729|CRISPRCasFinder 4217777-4217806 30 NC_019729.1 5786476-5786505 0 1.0
NC_019729_39 39.1|4217777|30|NC_019729|CRISPRCasFinder 4217777-4217806 30 NC_019729.1 5786635-5786664 0 1.0
NC_019729_39 39.1|4217777|30|NC_019729|CRISPRCasFinder 4217777-4217806 30 NC_019729.1 6048458-6048487 0 1.0
NC_019729_39 39.1|4217777|30|NC_019729|CRISPRCasFinder 4217777-4217806 30 NC_019729.1 1646908-1646937 0 1.0
NC_019729_39 39.1|4217777|30|NC_019729|CRISPRCasFinder 4217777-4217806 30 NC_019729.1 4852089-4852118 0 1.0
NC_019729_41 41.1|4700691|36|NC_019729|CRISPRCasFinder 4700691-4700726 36 NC_019729.1 962593-962628 2 0.944
NC_019729_49 49.1|5412040|33|NC_019729|CRISPRCasFinder 5412040-5412072 33 NC_019729.1 1646907-1646939 0 1.0
NC_019729_49 49.1|5412040|33|NC_019729|CRISPRCasFinder 5412040-5412072 33 NC_019729.1 4852088-4852120 0 1.0
NC_019729_49 49.1|5412040|33|NC_019729|CRISPRCasFinder 5412040-5412072 33 NC_019729.1 5786474-5786506 0 1.0
NC_019729_49 49.1|5412040|33|NC_019729|CRISPRCasFinder 5412040-5412072 33 NC_019729.1 5786633-5786665 0 1.0
NC_019729_49 49.1|5412040|33|NC_019729|CRISPRCasFinder 5412040-5412072 33 NC_019729.1 6048456-6048488 0 1.0
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NC_019729.1 5824341-5824369 0 1.0
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NC_019729.1 1094383-1094411 1 0.966
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NC_019729.1 1094427-1094455 1 0.966
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NC_019729.1 3238073-3238101 1 0.966
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NC_019729.1 3727399-3727427 1 0.966
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NC_019729.1 1449733-1449761 2 0.931
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NC_019729.1 1449821-1449849 2 0.931
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NC_019729.1 1648762-1648790 2 0.931
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NC_019729.1 1848275-1848303 2 0.931
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NC_019729.1 2216249-2216277 2 0.931
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NC_019729.1 2440241-2440269 2 0.931
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NC_019729.1 3921755-3921783 2 0.931
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NC_019729.1 4990862-4990890 2 0.931
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NC_019729.1 5476388-5476416 2 0.931
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NC_019729.1 7198670-7198698 2 0.931
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NC_019729.1 7239027-7239055 2 0.931
NC_019729_54 54.1|5833441|41|NC_019729|CRISPRCasFinder 5833441-5833481 41 NC_019729.1 3753297-3753337 2 0.951
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_019729.1 1041207-1041230 1 0.958
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_019729.1 1041240-1041263 1 0.958
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_019729.1 5363291-5363314 1 0.958
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_019729.1 1027015-1027038 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_019729.1 1027027-1027050 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_019729.1 1041144-1041167 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_019729.1 5015420-5015443 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_019729.1 5015426-5015449 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_019729.1 5015432-5015455 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_019729.1 5357338-5357361 2 0.917
NC_019729_64 64.4|6967464|18|NC_019729|CRT 6967464-6967481 18 NC_019729.1 1746764-1746781 1 0.944
NC_019729_64 64.4|6967464|18|NC_019729|CRT 6967464-6967481 18 NC_019729.1 5015384-5015401 1 0.944
NC_019729_64 64.4|6967464|18|NC_019729|CRT 6967464-6967481 18 NC_019729.1 5015408-5015425 1 0.944
NC_019729_64 64.4|6967464|18|NC_019729|CRT 6967464-6967481 18 NC_019729.1 5015444-5015461 1 0.944
NC_019729_64 64.4|6967464|18|NC_019729|CRT 6967464-6967481 18 NC_019729.1 6804746-6804763 1 0.944
NC_019729_64 64.4|6967464|18|NC_019729|CRT 6967464-6967481 18 NC_019729.1 6804782-6804799 1 0.944
NC_019729_67 67.3|7426112|20|NC_019729|CRISPRCasFinder 7426112-7426131 20 NC_019729.1 911438-911457 2 0.9

1. spacer 10.1|874089|24|NC_019729|CRISPRCasFinder matches to position: 4961135-4961158, mismatch: 2, identity: 0.917

gcgcaatcgattgactgtgggctg	CRISPR spacer
gcgcaatcgattgactgttgactg	Protospacer
****************** *.***

2. spacer 13.3|1072038|25|NC_019729|CRT matches to position: 2069095-2069119, mismatch: 0, identity: 1.0

taattcttgtggggtgggcttctag	CRISPR spacer
taattcttgtggggtgggcttctag	Protospacer
*************************

3. spacer 13.3|1072038|25|NC_019729|CRT matches to position: 2069130-2069154, mismatch: 0, identity: 1.0

taattcttgtggggtgggcttctag	CRISPR spacer
taattcttgtggggtgggcttctag	Protospacer
*************************

4. spacer 13.3|1072038|25|NC_019729|CRT matches to position: 1072166-1072190, mismatch: 0, identity: 1.0

taattcttgtggggtgggcttctag	CRISPR spacer
taattcttgtggggtgggcttctag	Protospacer
*************************

5. spacer 13.3|1072038|25|NC_019729|CRT matches to position: 5794919-5794943, mismatch: 1, identity: 0.96

taattcttgtggggtgggcttctag	CRISPR spacer
taactcttgtggggtgggcttctag	Protospacer
***.*********************

6. spacer 13.3|1072038|25|NC_019729|CRT matches to position: 6540616-6540640, mismatch: 2, identity: 0.92

taattcttgtggggtgggcttctag	CRISPR spacer
taatttttgtgggatgggcttctag	Protospacer
*****.*******.***********

7. spacer 13.3|1072038|25|NC_019729|CRT matches to position: 1619865-1619889, mismatch: 2, identity: 0.92

taattcttgtggggtgggcttctag	CRISPR spacer
taaatattgtggggtgggcttctag	Protospacer
*** * *******************

8. spacer 13.4|1072105|19|NC_019729|CRT matches to position: 7158302-7158320, mismatch: 2, identity: 0.895

gatttcacaggcaagatgc	CRISPR spacer
gattttacaggcaagctgc	Protospacer
*****.********* ***

9. spacer 26.1|2853118|28|NC_019729|CRISPRCasFinder matches to position: 4273128-4273155, mismatch: 1, identity: 0.964

caaatctaaaatctcaaatcgactgacc	CRISPR spacer
caaatctaaaatctaaaatcgactgacc	Protospacer
************** *************

10. spacer 26.1|2853118|28|NC_019729|CRISPRCasFinder matches to position: 4882083-4882110, mismatch: 1, identity: 0.964

caaatctaaaatctcaaatcgactgacc	CRISPR spacer
caaatctcaaatctcaaatcgactgacc	Protospacer
******* ********************

11. spacer 26.1|2853118|28|NC_019729|CRISPRCasFinder matches to position: 2917017-2917044, mismatch: 1, identity: 0.964

caaatctaaaatctcaaatcgactgacc	CRISPR spacer
caaatctcaaatctcaaatcgactgacc	Protospacer
******* ********************

12. spacer 26.1|2853118|28|NC_019729|CRISPRCasFinder matches to position: 2949589-2949616, mismatch: 2, identity: 0.929

caaatctaaaatctcaaatcgactgacc	CRISPR spacer
caaatcaaaaatctcaaatcgattgacc	Protospacer
****** ***************.*****

13. spacer 26.1|2853118|28|NC_019729|CRISPRCasFinder matches to position: 7191874-7191901, mismatch: 2, identity: 0.929

caaatctaaaatctcaaatcgactgacc	CRISPR spacer
caaatctcaaatctcaaatcgattgacc	Protospacer
******* **************.*****

14. spacer 26.1|2853118|28|NC_019729|CRISPRCasFinder matches to position: 1437436-1437463, mismatch: 2, identity: 0.929

caaatctaaaatctcaaatcgactgacc	CRISPR spacer
caaatctcaaatctcaaatcgattgacc	Protospacer
******* **************.*****

15. spacer 26.1|2853118|28|NC_019729|CRISPRCasFinder matches to position: 5786579-5786606, mismatch: 2, identity: 0.929

caaatctaaaatctcaaatcgactgacc	CRISPR spacer
caaatctcaaatctcaaatcgaatgacc	Protospacer
******* ************** *****

16. spacer 26.1|2853118|28|NC_019729|CRISPRCasFinder matches to position: 7049610-7049637, mismatch: 2, identity: 0.929

caaatctaaaatctcaaatcgactgacc	CRISPR spacer
caaatctcaaatctcaaatcgattgacc	Protospacer
******* **************.*****

17. spacer 39.1|4217777|30|NC_019729|CRISPRCasFinder matches to position: 5786476-5786505, mismatch: 0, identity: 1.0

cttgcatcccccgaatttatctcgcgcaag	CRISPR spacer
cttgcatcccccgaatttatctcgcgcaag	Protospacer
******************************

18. spacer 39.1|4217777|30|NC_019729|CRISPRCasFinder matches to position: 5786635-5786664, mismatch: 0, identity: 1.0

cttgcatcccccgaatttatctcgcgcaag	CRISPR spacer
cttgcatcccccgaatttatctcgcgcaag	Protospacer
******************************

19. spacer 39.1|4217777|30|NC_019729|CRISPRCasFinder matches to position: 6048458-6048487, mismatch: 0, identity: 1.0

cttgcatcccccgaatttatctcgcgcaag	CRISPR spacer
cttgcatcccccgaatttatctcgcgcaag	Protospacer
******************************

20. spacer 39.1|4217777|30|NC_019729|CRISPRCasFinder matches to position: 1646908-1646937, mismatch: 0, identity: 1.0

cttgcatcccccgaatttatctcgcgcaag	CRISPR spacer
cttgcatcccccgaatttatctcgcgcaag	Protospacer
******************************

21. spacer 39.1|4217777|30|NC_019729|CRISPRCasFinder matches to position: 4852089-4852118, mismatch: 0, identity: 1.0

cttgcatcccccgaatttatctcgcgcaag	CRISPR spacer
cttgcatcccccgaatttatctcgcgcaag	Protospacer
******************************

22. spacer 41.1|4700691|36|NC_019729|CRISPRCasFinder matches to position: 962593-962628, mismatch: 2, identity: 0.944

tttagattttagattttagatttattcccgtcagct	CRISPR spacer
tttagattttagattttagatttactcccgtctgct	Protospacer
************************.******* ***

23. spacer 49.1|5412040|33|NC_019729|CRISPRCasFinder matches to position: 1646907-1646939, mismatch: 0, identity: 1.0

ccttgcatcccccgaatttatctcgcgcaagtc	CRISPR spacer
ccttgcatcccccgaatttatctcgcgcaagtc	Protospacer
*********************************

24. spacer 49.1|5412040|33|NC_019729|CRISPRCasFinder matches to position: 4852088-4852120, mismatch: 0, identity: 1.0

ccttgcatcccccgaatttatctcgcgcaagtc	CRISPR spacer
ccttgcatcccccgaatttatctcgcgcaagtc	Protospacer
*********************************

25. spacer 49.1|5412040|33|NC_019729|CRISPRCasFinder matches to position: 5786474-5786506, mismatch: 0, identity: 1.0

ccttgcatcccccgaatttatctcgcgcaagtc	CRISPR spacer
ccttgcatcccccgaatttatctcgcgcaagtc	Protospacer
*********************************

26. spacer 49.1|5412040|33|NC_019729|CRISPRCasFinder matches to position: 5786633-5786665, mismatch: 0, identity: 1.0

ccttgcatcccccgaatttatctcgcgcaagtc	CRISPR spacer
ccttgcatcccccgaatttatctcgcgcaagtc	Protospacer
*********************************

27. spacer 49.1|5412040|33|NC_019729|CRISPRCasFinder matches to position: 6048456-6048488, mismatch: 0, identity: 1.0

ccttgcatcccccgaatttatctcgcgcaagtc	CRISPR spacer
ccttgcatcccccgaatttatctcgcgcaagtc	Protospacer
*********************************

28. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to position: 5824341-5824369, mismatch: 0, identity: 1.0

caggaacaggctttccgggctgttccaca	CRISPR spacer
caggaacaggctttccgggctgttccaca	Protospacer
*****************************

29. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to position: 1094383-1094411, mismatch: 1, identity: 0.966

caggaacaggctttccgggctgttccaca	CRISPR spacer
cagcaacaggctttccgggctgttccaca	Protospacer
*** *************************

30. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to position: 1094427-1094455, mismatch: 1, identity: 0.966

caggaacaggctttccgggctgttccaca	CRISPR spacer
caagaacaggctttccgggctgttccaca	Protospacer
**.**************************

31. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to position: 3238073-3238101, mismatch: 1, identity: 0.966

caggaacaggctttccgggctgttccaca	CRISPR spacer
caggaacaggctttccggtctgttccaca	Protospacer
****************** **********

32. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to position: 3727399-3727427, mismatch: 1, identity: 0.966

caggaacaggctttccgggctgttccaca	CRISPR spacer
catgaacaggctttccgggctgttccaca	Protospacer
** **************************

33. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to position: 1449733-1449761, mismatch: 2, identity: 0.931

caggaacaggctttccgggctgttccaca	CRISPR spacer
catgaacaggctttcggggctgttccaca	Protospacer
** ************ *************

34. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to position: 1449821-1449849, mismatch: 2, identity: 0.931

caggaacaggctttccgggctgttccaca	CRISPR spacer
catgaacaggctttcggggctgttccaca	Protospacer
** ************ *************

35. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to position: 1648762-1648790, mismatch: 2, identity: 0.931

caggaacaggctttccgggctgttccaca	CRISPR spacer
caagaacaggcttttcgggctgttccaca	Protospacer
**.***********.**************

36. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to position: 1848275-1848303, mismatch: 2, identity: 0.931

caggaacaggctttccgggctgttccaca	CRISPR spacer
caagaacaggctttccggcctgttccaca	Protospacer
**.*************** **********

37. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to position: 2216249-2216277, mismatch: 2, identity: 0.931

caggaacaggctttccgggctgttccaca	CRISPR spacer
caagaacaggctttccggcctgttccaca	Protospacer
**.*************** **********

38. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to position: 2440241-2440269, mismatch: 2, identity: 0.931

caggaacaggctttccgggctgttccaca	CRISPR spacer
caagaacaggctttccggcctgttccaca	Protospacer
**.*************** **********

39. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to position: 3921755-3921783, mismatch: 2, identity: 0.931

caggaacaggctttccgggctgttccaca	CRISPR spacer
catgaacaggctttccggcctgttccaca	Protospacer
** *************** **********

40. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to position: 4990862-4990890, mismatch: 2, identity: 0.931

caggaacaggctttccgggctgttccaca	CRISPR spacer
caagaacaggctttccggcctgttccaca	Protospacer
**.*************** **********

41. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to position: 5476388-5476416, mismatch: 2, identity: 0.931

caggaacaggctttccgggctgttccaca	CRISPR spacer
cagcaacaggctttccggcctgttccaca	Protospacer
*** ************** **********

42. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to position: 7198670-7198698, mismatch: 2, identity: 0.931

caggaacaggctttccgggctgttccaca	CRISPR spacer
caagaacaggctttccggcctgttccaca	Protospacer
**.*************** **********

43. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to position: 7239027-7239055, mismatch: 2, identity: 0.931

caggaacaggctttccgggctgttccaca	CRISPR spacer
caagaacaggctttccggcctgttccaca	Protospacer
**.*************** **********

44. spacer 54.1|5833441|41|NC_019729|CRISPRCasFinder matches to position: 3753297-3753337, mismatch: 2, identity: 0.951

gcaagatgcctgttccacaaagatttaattttattgtggaa	CRISPR spacer
gcaagatgcctgttccacaaagagtaaattttattgtggaa	Protospacer
*********************** * ***************

45. spacer 64.1|6967260|24|NC_019729|CRT matches to position: 1041207-1041230, mismatch: 1, identity: 0.958

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacgccaacaccaacgcc	Protospacer
*********.**************

46. spacer 64.1|6967260|24|NC_019729|CRT matches to position: 1041240-1041263, mismatch: 1, identity: 0.958

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccgacgcc	Protospacer
******************.*****

47. spacer 64.1|6967260|24|NC_019729|CRT matches to position: 5363291-5363314, mismatch: 1, identity: 0.958

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
*********************.**

48. spacer 64.1|6967260|24|NC_019729|CRT matches to position: 1027015-1027038, mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaaccccaacaccaacccc	Protospacer
********* *********** **

49. spacer 64.1|6967260|24|NC_019729|CRT matches to position: 1027027-1027050, mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaaccccaacaccaacccc	Protospacer
********* *********** **

50. spacer 64.1|6967260|24|NC_019729|CRT matches to position: 1041144-1041167, mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccgacacc	Protospacer
******************.**.**

51. spacer 64.1|6967260|24|NC_019729|CRT matches to position: 5015420-5015443, mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccagcccc	Protospacer
*******************.* **

52. spacer 64.1|6967260|24|NC_019729|CRT matches to position: 5015426-5015449, mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
aactccaacaccaacaccaacacc	Protospacer
*** *****************.**

53. spacer 64.1|6967260|24|NC_019729|CRT matches to position: 5015432-5015455, mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaactccaacaccaacacc	Protospacer
********* ***********.**

54. spacer 64.1|6967260|24|NC_019729|CRT matches to position: 5357338-5357361, mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
aactccaactccaacaccaacgcc	Protospacer
*** ***** **************

55. spacer 64.4|6967464|18|NC_019729|CRT matches to position: 1746764-1746781, mismatch: 1, identity: 0.944

agcgccaacaccaacacc	CRISPR spacer
agcgccaactccaacacc	Protospacer
********* ********

56. spacer 64.4|6967464|18|NC_019729|CRT matches to position: 5015384-5015401, mismatch: 1, identity: 0.944

agcgccaacaccaacacc	CRISPR spacer
agccccaacaccaacacc	Protospacer
*** **************

57. spacer 64.4|6967464|18|NC_019729|CRT matches to position: 5015408-5015425, mismatch: 1, identity: 0.944

agcgccaacaccaacacc	CRISPR spacer
agccccaacaccaacacc	Protospacer
*** **************

58. spacer 64.4|6967464|18|NC_019729|CRT matches to position: 5015444-5015461, mismatch: 1, identity: 0.944

agcgccaacaccaacacc	CRISPR spacer
agcgccaacaccaactcc	Protospacer
*************** **

59. spacer 64.4|6967464|18|NC_019729|CRT matches to position: 6804746-6804763, mismatch: 1, identity: 0.944

agcgccaacaccaacacc	CRISPR spacer
agcgcctacaccaacacc	Protospacer
****** ***********

60. spacer 64.4|6967464|18|NC_019729|CRT matches to position: 6804782-6804799, mismatch: 1, identity: 0.944

agcgccaacaccaacacc	CRISPR spacer
agcgcctacaccaacacc	Protospacer
****** ***********

61. spacer 67.3|7426112|20|NC_019729|CRISPRCasFinder matches to position: 911438-911457, mismatch: 2, identity: 0.9

cagcccccgtgaggttggct	CRISPR spacer
cagctcccgtcaggttggct	Protospacer
****.***** *********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP024609 Massilia violaceinigra strain B2 plasmid unnamed, complete sequence 2596-2619 1 0.958
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 849309-849332 1 0.958
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1295251-1295274 1 0.958
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1295257-1295280 1 0.958
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1295263-1295286 1 0.958
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP009639 Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence 37010-37033 1 0.958
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP009639 Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence 37016-37039 1 0.958
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP053963 Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence 78543-78566 1 0.958
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP053963 Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence 78549-78572 1 0.958
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 KF437907 Phormidium phage MIS-PhV1A, complete genome 19480-19503 1 0.958
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 KF437907 Phormidium phage MIS-PhV1A, complete genome 19486-19509 1 0.958
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 KF437907 Phormidium phage MIS-PhV1A, complete genome 19492-19515 1 0.958
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 KF437907 Phormidium phage MIS-PhV1A, complete genome 19498-19521 1 0.958
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP050315 Shewanella aestuarii strain PN3F2 plasmid pPN3F2_2, complete sequence 204779-204802 1 0.958
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 MN047793 Xanthomonas phage Xoo-sp13, complete genome 136825-136848 1 0.958
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 MN047793 Xanthomonas phage Xoo-sp13, complete genome 136825-136848 1 0.958
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 849303-849326 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1295245-1295268 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP050315 Shewanella aestuarii strain PN3F2 plasmid pPN3F2_2, complete sequence 204773-204796 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_AP018256 Calothrix sp. NIES-4071 plasmid plasmid1 DNA, complete genome 176077-176100 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_028998 Phormidium phage MIS-PhV1B, complete genome 18368-18391 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 979909-979932 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 MN694040 Marine virus AFVG_250M411, complete genome 33674-33697 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 KU160661 Arthrobacter phage Pumancara, complete genome 39319-39342 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 67319-67342 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_030925 Bacillus phage Shbh1, complete genome 126126-126149 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 DQ535032 Lactococcus lactis phage KSY1, complete genome 47372-47395 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_009817 Lactococcus phage KSY1, complete genome 47372-47395 2 0.917
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP037434 Lactobacillus plantarum strain EM plasmid pEM5, complete sequence 51096-51119 2 0.917
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP035132 Lactobacillus plantarum strain SRCM103311 plasmid unnamed1 43138-43161 2 0.917
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP035115 Lactobacillus plantarum strain SRCM103295 plasmid unnamed2 3137-3160 2 0.917
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP035115 Lactobacillus plantarum strain SRCM103295 plasmid unnamed2 64077-64100 2 0.917
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP020097 Lactobacillus plantarum strain K25 plasmid unnamed4, complete sequence 43804-43827 2 0.917
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP035567 Lactobacillus plantarum strain SRCM103300 plasmid unnamed1 34869-34892 2 0.917
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP046663 Lactobacillus plantarum strain 83-18 plasmid p83-18.3, complete sequence 29759-29782 2 0.917
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1748542-1748565 2 0.917
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP049906 Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence 111183-111206 2 0.917
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 248092-248115 2 0.917
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP037434 Lactobacillus plantarum strain EM plasmid pEM5, complete sequence 51096-51119 2 0.917
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP035132 Lactobacillus plantarum strain SRCM103311 plasmid unnamed1 43138-43161 2 0.917
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP035115 Lactobacillus plantarum strain SRCM103295 plasmid unnamed2 3137-3160 2 0.917
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP035115 Lactobacillus plantarum strain SRCM103295 plasmid unnamed2 64077-64100 2 0.917
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP020097 Lactobacillus plantarum strain K25 plasmid unnamed4, complete sequence 43804-43827 2 0.917
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP035567 Lactobacillus plantarum strain SRCM103300 plasmid unnamed1 34869-34892 2 0.917
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP046663 Lactobacillus plantarum strain 83-18 plasmid p83-18.3, complete sequence 29759-29782 2 0.917
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1748542-1748565 2 0.917
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP049906 Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence 111183-111206 2 0.917
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 248092-248115 2 0.917
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP024609 Massilia violaceinigra strain B2 plasmid unnamed, complete sequence 2578-2601 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP024609 Massilia violaceinigra strain B2 plasmid unnamed, complete sequence 2602-2625 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP024609 Massilia violaceinigra strain B2 plasmid unnamed, complete sequence 2705-2728 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 849315-849338 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP009639 Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence 37004-37027 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP053963 Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence 78537-78560 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_LT703506 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2 170203-170226 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 821729-821752 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 821729-821752 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_010363 Lactococcus phage asccphi28, complete genome 13559-13582 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 187214-187237 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 879901-879924 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1019244-1019267 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP011457 Anabaena sp. WA102 plasmid, complete sequence 76049-76072 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 95717-95740 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 MN047793 Xanthomonas phage Xoo-sp13, complete genome 136825-136848 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 AP018399 Xanthomonas phage XacN1 DNA, complete genome 127624-127647 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_010811 Ralstonia phage RSL1, complete genome 36487-36510 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 AP014368 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S41-C87, *** SEQUENCING IN PROGRESS *** 11185-11208 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 AB366653 Ralstonia phage RSL1 DNA, complete genome 36487-36510 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 MT276994 Aeromonas phage AhyVDH1, complete genome 9015-9038 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 241461-241484 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1513486-1513509 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 20480-20503 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 MG592515 Vibrio phage 1.144.O._10N.286.45.B3, partial genome 1306-1329 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 JX976549 Acinetobacter phage IME-AB2, complete genome 15259-15282 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 AP014367 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S41-C79, *** SEQUENCING IN PROGRESS *** 21330-21353 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1042555-1042578 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 670410-670433 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 1043554-1043577 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_LT703506 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2 170203-170226 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 283415-283438 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP050315 Shewanella aestuarii strain PN3F2 plasmid pPN3F2_2, complete sequence 204773-204796 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP050315 Shewanella aestuarii strain PN3F2 plasmid pPN3F2_2, complete sequence 204779-204802 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP022424 Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence 245217-245240 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 4304-4327 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 5283-5306 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 849309-849332 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 95687-95710 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1295251-1295274 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1295257-1295280 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1295263-1295286 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP009639 Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence 37010-37033 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP009639 Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence 37016-37039 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP033025 Agrobacterium fabrum strain 1D132 plasmid pAt1D132b, complete sequence 106703-106726 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP013153 Lactobacillus plantarum strain MF1298 plasmid pMF1298-3, complete sequence 21338-21361 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP053963 Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence 78543-78566 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NZ_CP053963 Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence 78549-78572 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 MT310869 Microbacterium phage Truong, complete genome 49094-49117 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 MN693048 Marine virus AFVG_25M535, complete genome 31396-31419 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 MH412654 Synechococcus phage S-T4, complete genome 31602-31625 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 NC_048761 Microbacterium phage Akoni, complete genome 49092-49115 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 KF437907 Phormidium phage MIS-PhV1A, complete genome 19480-19503 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 KF437907 Phormidium phage MIS-PhV1A, complete genome 19486-19509 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 KF437907 Phormidium phage MIS-PhV1A, complete genome 19492-19515 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 KF437907 Phormidium phage MIS-PhV1A, complete genome 19498-19521 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 MG592560 Vibrio phage 1.190.O._10N.286.51.F12, partial genome 3999-4022 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 AP018399 Xanthomonas phage XacN1 DNA, complete genome 127624-127647 3 0.875
NC_019729_64 64.2|6967326|24|NC_019729|CRT 6967326-6967349 24 AP018399 Xanthomonas phage XacN1 DNA, complete genome 129825-129848 3 0.875
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 469704-469733 3 0.9
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 241461-241484 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1513486-1513509 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 20480-20503 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 MG592515 Vibrio phage 1.144.O._10N.286.45.B3, partial genome 1306-1329 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 JX976549 Acinetobacter phage IME-AB2, complete genome 15259-15282 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 AP014367 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S41-C79, *** SEQUENCING IN PROGRESS *** 21330-21353 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1042555-1042578 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 670410-670433 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 1043554-1043577 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_LT703506 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2 170203-170226 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 283415-283438 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP050315 Shewanella aestuarii strain PN3F2 plasmid pPN3F2_2, complete sequence 204773-204796 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP050315 Shewanella aestuarii strain PN3F2 plasmid pPN3F2_2, complete sequence 204779-204802 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP022424 Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence 245217-245240 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 4304-4327 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 5283-5306 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 849309-849332 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 95687-95710 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1295251-1295274 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1295257-1295280 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1295263-1295286 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP009639 Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence 37010-37033 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP009639 Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence 37016-37039 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP033025 Agrobacterium fabrum strain 1D132 plasmid pAt1D132b, complete sequence 106703-106726 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP013153 Lactobacillus plantarum strain MF1298 plasmid pMF1298-3, complete sequence 21338-21361 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP053963 Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence 78543-78566 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NZ_CP053963 Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence 78549-78572 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 MT310869 Microbacterium phage Truong, complete genome 49094-49117 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 MN693048 Marine virus AFVG_25M535, complete genome 31396-31419 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 MH412654 Synechococcus phage S-T4, complete genome 31602-31625 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 NC_048761 Microbacterium phage Akoni, complete genome 49092-49115 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 KF437907 Phormidium phage MIS-PhV1A, complete genome 19480-19503 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 KF437907 Phormidium phage MIS-PhV1A, complete genome 19486-19509 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 KF437907 Phormidium phage MIS-PhV1A, complete genome 19492-19515 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 KF437907 Phormidium phage MIS-PhV1A, complete genome 19498-19521 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 MG592560 Vibrio phage 1.190.O._10N.286.51.F12, partial genome 3999-4022 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 AP018399 Xanthomonas phage XacN1 DNA, complete genome 127624-127647 3 0.875
NC_019729_64 64.6|6967608|24|NC_019729|CRT 6967608-6967631 24 AP018399 Xanthomonas phage XacN1 DNA, complete genome 129825-129848 3 0.875
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP009639 Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence 37022-37045 4 0.833
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP053963 Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence 78555-78578 4 0.833
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 KF437907 Phormidium phage MIS-PhV1A, complete genome 19474-19497 4 0.833
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_010849 Streptomyces sp. 44030 plasmid pRL1, complete sequence 31606-31629 4 0.833
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NC_010849 Streptomyces sp. 44030 plasmid pRL1, complete sequence 1131-1154 4 0.833
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 MH319749 Marine virus AG-345-F15 Ga0172271_11 genomic sequence 85030-85053 4 0.833
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 MN693269 Marine virus AFVG_25M487, complete genome 41033-41056 4 0.833
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 110338-110361 4 0.833
NC_019729_13 13.3|1072038|25|NC_019729|CRT 1072038-1072062 25 NC_007412 Trichormus variabilis ATCC 29413 plasmid C, complete sequence 127874-127898 5 0.8
NC_019729_13 13.3|1072038|25|NC_019729|CRT 1072038-1072062 25 NZ_CP047244 Trichormus variabilis 0441 plasmid unnamed2, complete sequence 111650-111674 5 0.8
NC_019729_63 63.1|6943877|28|NC_019729|CRISPRCasFinder 6943877-6943904 28 NZ_CP011383 Calothrix sp. 336/3 plasmid unnamed1 22623-22650 5 0.821
NC_019729_64 64.1|6967260|24|NC_019729|CRT 6967260-6967283 24 MN830252 Lactobacillus phage JNU_P1, complete genome 24093-24116 5 0.792
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP021367 Acidovorax carolinensis strain P4 plasmid pACP4.1, complete sequence 41047-41076 5 0.833
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP021363 Acidovorax carolinensis strain P3 plasmid pACP3.1, complete sequence 27098-27127 5 0.833
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NC_018832 Providencia phage Redjac, complete genome 53573-53602 5 0.833
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP021360 Acidovorax carolinensis strain NA2 plasmid pACNA2.1, complete sequence 37102-37131 5 0.833
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP011543 Corynebacterium mustelae strain DSM 45274 plasmid pCmus45274, complete sequence 17501-17530 5 0.833
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NC_009806 Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence 1630-1659 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP028383 Escherichia coli strain RM10466 plasmid pRM10466-2, complete sequence 2766-2795 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP012498 Escherichia coli strain 06-00048 plasmid pCFSAN004178P_02, complete sequence 122343-122372 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP012501 Escherichia coli strain 08-00022 plasmid pCFSAN004179G, complete sequence 226330-226359 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 KR827394 Uncultured bacterium plasmid pKAZ5, complete sequence 221713-221742 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 CP027641 Escherichia coli strain 2014C-4705 plasmid unnamed, complete sequence 119777-119806 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 CP027580 Escherichia coli strain 2013C-4282 plasmid unnamed1 20803-20832 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 CP027581 Escherichia coli strain 2013C-4282 plasmid unnamed2, complete sequence 107233-107262 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 CP027674 Escherichia coli strain 2014C-3003 plasmid unnamed2, complete sequence 96121-96150 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP028610 Escherichia coli strain 142 plasmid pTA142-3, complete sequence 52009-52038 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP027375 Escherichia coli strain 05-3629 plasmid unnamed2, complete sequence 113059-113088 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP012500 Escherichia coli strain 09-00049 plasmid pCFSAN004180G, complete sequence 54569-54598 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP042297 Escherichia coli strain RM9088 plasmid p2RM9088, complete sequence 56213-56242 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP027458 Escherichia coli strain 88-3493 plasmid unnamed, complete sequence 93618-93647 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP027367 Escherichia coli strain 89-3156 plasmid unnamed, complete sequence 71222-71251 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP012499 Escherichia coli strain GB089 plasmid pCFSAN004181P, complete sequence 154293-154322 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 151535-151564 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP027239 Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence 131183-131212 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_LT703506 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2 170203-170232 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 36900-36929 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 AP018399 Xanthomonas phage XacN1 DNA, complete genome 129837-129866 6 0.8
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 147650-147679 6 0.8
NC_019729_3 3.1|377940|36|NC_019729|CRISPRCasFinder 377940-377975 36 MK250016 Prevotella phage Lak-A1, complete genome 263932-263967 7 0.806
NC_019729_3 3.1|377940|36|NC_019729|CRISPRCasFinder 377940-377975 36 MK250019 Prevotella phage Lak-A2, complete genome 185066-185101 7 0.806
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NZ_CP018798 Lactobacillus parabuchneri strain FAM21731 plasmid pFAM21731.2, complete sequence 54979-55011 7 0.788
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NZ_CP040375 Lactobacillus plantarum subsp. plantarum strain BNH17 plasmid unnamed1, complete sequence 24005-24037 7 0.788
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NZ_CP028231 Lactobacillus plantarum strain SRCM101222 plasmid unnamed2, complete sequence 48179-48211 7 0.788
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NZ_CP050807 Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP511, complete sequence 17050-17082 7 0.788
NC_019729_46 46.12|4978698|32|NC_019729|CRISPRCasFinder,CRT,PILER-CR 4978698-4978729 32 NZ_CP016451 Sinorhizobium sp. RAC02 plasmid pBSY16_2, complete sequence 25066-25097 7 0.781
NC_019729_46 46.91|4984593|35|NC_019729|CRISPRCasFinder,CRT,PILER-CR 4984593-4984627 35 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 30963-30997 7 0.8
NC_019729_46 46.91|4984593|35|NC_019729|CRISPRCasFinder,CRT,PILER-CR 4984593-4984627 35 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 161097-161131 7 0.8
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NC_019731 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.03, complete sequence 137678-137706 7 0.759
NC_019729_58 58.21|6127187|37|NC_019729|CRISPRCasFinder,CRT,PILER-CR 6127187-6127223 37 NC_009930 Acaryochloris marina MBIC11017 plasmid pREB5, complete sequence 143116-143152 7 0.811
NC_019729_63 63.2|6943931|28|NC_019729|CRISPRCasFinder 6943931-6943958 28 MN693656 Marine virus AFVG_250M403, complete genome 47043-47070 7 0.75
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1295263-1295292 7 0.767
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 MN047793 Xanthomonas phage Xoo-sp13, complete genome 269025-269054 7 0.767
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP034431 Bradyrhizobium sp. LCT2 plasmid pLCT2, complete sequence 22756-22785 7 0.767
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 615560-615589 7 0.767
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 615569-615598 7 0.767
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 508384-508413 7 0.767
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP024249 Escherichia coli O182:H21 strain D181 plasmid unnamed1, complete sequence 31323-31352 7 0.767
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 637756-637785 7 0.767
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NC_017627 Escherichia coli 042 plasmid pAA, complete sequence 62683-62712 7 0.767
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 111722-111751 7 0.767
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1305152-1305181 7 0.767
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NC_019037 Escherichia coli plasmid pChi7122-2, complete sequence 16710-16739 7 0.767
NC_019729_5 5.1|533418|33|NC_019729|CRISPRCasFinder 533418-533450 33 MT773554 Myoviridae sp. isolate BML_2 genomic sequence 105582-105614 8 0.758
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NZ_CP052067 Lactobacillus paracasei strain 347-16 plasmid unnamed2, complete sequence 48058-48090 8 0.758
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NZ_CP048005 Lactobacillus paracasei strain CACC 566 plasmid p2CACC566, complete sequence 36905-36937 8 0.758
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NZ_CP028237 Lactobacillus plantarum strain SRCM101511 plasmid unnamed2, complete sequence 41053-41085 8 0.758
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NZ_CP024414 Lactobacillus plantarum strain ATCC 8014 plasmid pLP49, complete sequence 9321-9353 8 0.758
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NZ_CP021459 Lactobacillus brevis strain ZLB004 plasmid p3, complete sequence 10027-10059 8 0.758
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NZ_CP021461 Lactobacillus brevis strain ZLB004 plasmid p5, complete sequence 40417-40449 8 0.758
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NC_015603 Lactobacillus kefiranofaciens ZW3 plasmid pWW2, complete sequence 17288-17320 8 0.758
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NZ_CP017264 Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.23, complete sequence 25418-25450 8 0.758
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NZ_CP035157 Lactobacillus plantarum strain SRCM103362 plasmid unnamed1 26508-26540 8 0.758
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NZ_CP017410 Lactobacillus plantarum strain RI-113 plasmid pRI113_4, complete sequence 17106-17138 8 0.758
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NC_013200 Lactobacillus rhamnosus Lc 705 plasmid pLC1, complete sequence 26353-26385 8 0.758
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NZ_CP040377 Lactobacillus plantarum subsp. plantarum strain BNH17 plasmid unnamed3, complete sequence 8031-8063 8 0.758
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NZ_CP028225 Lactobacillus plantarum strain SRCM101105 plasmid unnamed3, complete sequence 16023-16055 8 0.758
NC_019729_46 46.13|4978767|33|NC_019729|CRISPRCasFinder,CRT,PILER-CR 4978767-4978799 33 NZ_CP032676 Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence 220468-220500 8 0.758
NC_019729_53 53.1|5824410|29|NC_019729|CRISPRCasFinder 5824410-5824438 29 NZ_CP051549 Phytobacter diazotrophicus strain UAEU22 plasmid unnamed1 95505-95533 8 0.724
NC_019729_58 58.24|6127405|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR 6127405-6127438 34 CP002963 Emticicia oligotrophica DSM 17448 plasmid pEMTOL02, complete sequence 32337-32370 8 0.765
NC_019729_62 62.4|6577966|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 6577966-6577998 33 NC_011775 Bacillus cereus G9842 plasmid pG9842_209, complete sequence 78458-78490 8 0.758
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_KY349138 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence 89483-89512 8 0.733
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 KT898134 Aeromonas phage phiARM81mr, complete genome 56161-56190 8 0.733
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP015279 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence 36686-36715 8 0.733
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP016381 Aeromonas hydrophila strain AHNIH1 plasmid pASP-135, complete sequence 24470-24499 8 0.733
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 258279-258308 8 0.733
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 MK448982 Streptococcus phage Javan554, complete genome 36147-36176 8 0.733
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP015268 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 1, complete sequence 44267-44296 8 0.733
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 MH593832 Phage sp. isolate ctcj9, complete genome 29649-29678 8 0.733
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NZ_CP037436 Lactobacillus plantarum strain EM plasmid pEM7, complete sequence 12222-12254 9 0.727
NC_019729_15 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 1286051-1286083 33 NZ_CP037436 Lactobacillus plantarum strain EM plasmid pEM7, complete sequence 23612-23644 9 0.727
NC_019729_19 19.1|1581027|31|NC_019729|CRISPRCasFinder 1581027-1581057 31 NC_017311 Desulfovibrio vulgaris RCH1 plasmid pDEVAL01, complete sequence 113031-113061 9 0.71
NC_019729_19 19.1|1581027|31|NC_019729|CRISPRCasFinder 1581027-1581057 31 NC_005863 Desulfovibrio vulgaris str. Hildenborough plasmid pDV, complete sequence 118474-118504 9 0.71
NC_019729_44 44.7|4873922|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 4873922-4873954 33 MN693987 Marine virus AFVG_250M285, complete genome 5206-5238 9 0.727
NC_019729_44 44.12|4874276|34|NC_019729|PILER-CR,CRISPRCasFinder,CRT 4874276-4874309 34 NZ_CP023822 Escherichia coli strain 7/2 plasmid p7_2.2, complete sequence 36367-36400 9 0.735
NC_019729_44 44.41|4876390|34|NC_019729|CRISPRCasFinder,CRT 4876390-4876423 34 MK291442 Paracoccus phage vB_PkoS_Pkon1, complete genome 44552-44585 9 0.735
NC_019729_46 46.8|4978411|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR 4978411-4978444 34 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 6404-6437 9 0.735
NC_019729_46 46.8|4978411|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR 4978411-4978444 34 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 273201-273234 9 0.735
NC_019729_58 58.6|6126094|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR 6126094-6126127 34 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1536852-1536885 9 0.735
NC_019729_58 58.6|6126094|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR 6126094-6126127 34 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 322407-322440 9 0.735
NC_019729_58 58.6|6126094|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR 6126094-6126127 34 NZ_CP007231 Yersinia similis strain Y_sim_228 plasmid unnamed, complete sequence 6391-6424 9 0.735
NC_019729_58 58.6|6126094|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR 6126094-6126127 34 MN694101 Marine virus AFVG_250M707, complete genome 15533-15566 9 0.735
NC_019729_58 58.24|6127405|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR 6127405-6127438 34 AF440571 Sulfolobus islandicus filamentous virus, partial genome 33476-33509 9 0.735
NC_019729_58 58.26|6127551|36|NC_019729|CRISPRCasFinder,CRT,PILER-CR 6127551-6127586 36 MN693849 Marine virus AFVG_250M1030, complete genome 16467-16502 9 0.75
NC_019729_58 58.53|6129544|37|NC_019729|CRISPRCasFinder,CRT,PILER-CR 6129544-6129580 37 MN694774 Marine virus AFVG_250M941, complete genome 15009-15045 9 0.757
NC_019729_62 62.4|6577966|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 6577966-6577998 33 NC_017483 Lactococcus lactis subsp. lactis CV56 plasmid pCV56A, complete sequence 32548-32580 9 0.727
NC_019729_62 62.4|6577966|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT 6577966-6577998 33 NC_019308 Lactococcus lactis subsp. lactis plasmid pIL6, complete sequence 16196-16228 9 0.727
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 MN813693 Mycobacterium phage Imvubu, complete genome 41069-41098 9 0.7
NC_019729_3 3.1|377940|36|NC_019729|CRISPRCasFinder 377940-377975 36 MK250029 Prevotella phage Lak-C1, complete genome 227759-227794 10 0.722
NC_019729_37 37.1|4153115|33|NC_019729|CRISPRCasFinder 4153115-4153147 33 NC_049930 Enterococcus phage vB_EfaP_Zip, complete genome 13109-13141 10 0.697
NC_019729_44 44.28|4875437|34|NC_019729|PILER-CR,CRISPRCasFinder,CRT 4875437-4875470 34 KY883658 Vibrio phage JSF27, complete genome 19371-19404 10 0.706
NC_019729_44 44.28|4875437|34|NC_019729|PILER-CR,CRISPRCasFinder,CRT 4875437-4875470 34 KY883657 Vibrio phage JSF23, complete genome 46923-46956 10 0.706
NC_019729_44 44.28|4875437|34|NC_019729|PILER-CR,CRISPRCasFinder,CRT 4875437-4875470 34 MT066160 Vibrio phage Saratov-12, complete genome 11589-11622 10 0.706
NC_019729_44 44.28|4875437|34|NC_019729|PILER-CR,CRISPRCasFinder,CRT 4875437-4875470 34 NC_015158 Vibrio phage ICP2, complete genome 18162-18195 10 0.706
NC_019729_44 44.28|4875437|34|NC_019729|PILER-CR,CRISPRCasFinder,CRT 4875437-4875470 34 KM224878 Vibrio phage ICP2_2011_A, complete genome 18160-18193 10 0.706
NC_019729_44 44.28|4875437|34|NC_019729|PILER-CR,CRISPRCasFinder,CRT 4875437-4875470 34 HQ641346 Vibrio phage ICP2_2006_A, complete genome 18135-18168 10 0.706
NC_019729_44 44.28|4875437|34|NC_019729|PILER-CR,CRISPRCasFinder,CRT 4875437-4875470 34 MT767883 Vibrio phage Saratov-15, complete genome 17899-17932 10 0.706
NC_019729_62 62.17|6578914|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR 6578914-6578947 34 NZ_CP007231 Yersinia similis strain Y_sim_228 plasmid unnamed, complete sequence 16996-17029 10 0.706
NC_019729_62 62.17|6578914|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR 6578914-6578947 34 NZ_CP028488 Yersinia massiliensis strain GTA plasmid unnamed1, complete sequence 44022-44055 10 0.706
NC_019729_64 64.3|6967392|30|NC_019729|CRT 6967392-6967421 30 NZ_CP050315 Shewanella aestuarii strain PN3F2 plasmid pPN3F2_2, complete sequence 204767-204796 10 0.667
NC_019729_3 3.2|378006|36|NC_019729|CRISPRCasFinder 378006-378041 36 CP015514 Vibrio vulnificus strain FORC_036 plasmid unnamed, complete sequence 304791-304826 11 0.694
NC_019729_5 5.1|533418|33|NC_019729|CRISPRCasFinder 533418-533450 33 NZ_CP035463 Photobacterium damselae subsp. damselae strain KC-Na-NB1 plasmid pFPPDNB1-5, complete sequence 5564-5596 11 0.667
NC_019729_32 32.1|3371418|32|NC_019729|CRISPRCasFinder 3371418-3371449 32 MN694547 Marine virus AFVG_250M388, complete genome 1882-1913 11 0.656
NC_019729_40 40.5|4644999|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR 4644999-4645032 34 MH976516 Corynebacterium phage PeteyPab, complete genome 40255-40288 11 0.676
NC_019729_40 40.5|4644999|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR 4644999-4645032 34 MG198778 Corynebacterium phage PotatoChip, complete genome 40257-40290 11 0.676
NC_019729_40 40.5|4644999|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR 4644999-4645032 34 MG198780 Corynebacterium phage Zion, complete genome 40255-40288 11 0.676
NC_019729_40 40.5|4644999|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR 4644999-4645032 34 MH926056 Corynebacterium phage Cruella, complete genome 39410-39443 11 0.676
NC_019729_40 40.5|4644999|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR 4644999-4645032 34 MG198776 Corynebacterium phage C3PO, complete genome 39410-39443 11 0.676
NC_019729_40 40.5|4644999|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR 4644999-4645032 34 MK977700 Corynebacterium phage Stickynote, complete genome 39677-39710 11 0.676
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KX581091 Vibrio phage Cla, complete genome 44110-44142 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KX581096 Vibrio phage pVa-5, complete genome 44111-44143 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 MK672804 Vibrio phage Va_178/90_p41, complete genome 52481-52513 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KY658673 Vibrio phage H2 PGK-2017, complete genome 37033-37065 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KX581093 Vibrio phage Pel, complete genome 44111-44143 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KX581097 Vibrio phage pVa-6, complete genome 44111-44143 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KY658677 Vibrio phage P3, complete genome 44126-44158 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KX581098 Vibrio phage VaK, complete genome 44100-44132 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KY658674 Vibrio phage H8, complete genome 37041-37073 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KY658676 Vibrio phage P2, complete genome 37033-37065 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KX581090 Vibrio phage Her, complete genome 44110-44142 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KY658678 Vibrio phage pVa-3, complete genome 45228-45260 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KY658679 Vibrio phage pVa-4, complete genome 45179-45211 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 MK672800 Vibrio phage Va_90-11-287_p41_Ba35, complete genome 27156-27188 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 MK672799 Vibrio phage Va_90-11-287_p41, complete genome 27156-27188 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KX581092 Vibrio phage Len, complete genome 44110-44142 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KX581094 Vibrio phage pVa-2, complete genome 44110-44142 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 MK672803 Vibrio phage Va_91-7-154_p41, complete genome 8601-8633 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KY658680 Vibrio phage pVa-8, complete genome 44111-44143 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KY658675 Vibrio phage H20, complete genome 44108-44140 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KX581095 Vibrio phage pVa-1, complete genome 44111-44143 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KX581099 Vibrio phage Strym, complete genome 44110-44142 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 MK672801 Vibrio phage Va_90-11-287_p41_T265, complete genome 27156-27188 11 0.667
NC_019729_62 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT 6578193-6578225 33 KX581100 Vibrio phage pVa-7, complete genome 45152-45184 11 0.667
NC_019729_7 7.10|604111|35|NC_019729|CRISPRCasFinder,CRT 604111-604145 35 NZ_CP014068 Enterococcus gallinarum strain FDAARGOS_163 plasmid unnamed, complete sequence 55976-56010 12 0.657
NC_019729_44 44.3|4873622|37|NC_019729|PILER-CR,CRISPRCasFinder,CRT 4873622-4873658 37 NC_010579 Xylella fastidiosa M23 plasmid pXFAS01, complete sequence 9552-9588 12 0.676

1. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP024609 (Massilia violaceinigra strain B2 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.958

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacacccacgcc	Protospacer
****************** *****

2. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 1, identity: 0.958

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
*********************.**

3. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.958

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
*********************.**

4. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.958

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
*********************.**

5. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.958

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
*********************.**

6. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP009639 (Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence) position: , mismatch: 1, identity: 0.958

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
*********************.**

7. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP009639 (Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence) position: , mismatch: 1, identity: 0.958

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
*********************.**

8. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP053963 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.958

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
*********************.**

9. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP053963 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.958

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
*********************.**

10. spacer 64.1|6967260|24|NC_019729|CRT matches to KF437907 (Phormidium phage MIS-PhV1A, complete genome) position: , mismatch: 1, identity: 0.958

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
*********************.**

11. spacer 64.1|6967260|24|NC_019729|CRT matches to KF437907 (Phormidium phage MIS-PhV1A, complete genome) position: , mismatch: 1, identity: 0.958

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
*********************.**

12. spacer 64.1|6967260|24|NC_019729|CRT matches to KF437907 (Phormidium phage MIS-PhV1A, complete genome) position: , mismatch: 1, identity: 0.958

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
*********************.**

13. spacer 64.1|6967260|24|NC_019729|CRT matches to KF437907 (Phormidium phage MIS-PhV1A, complete genome) position: , mismatch: 1, identity: 0.958

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
*********************.**

14. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP050315 (Shewanella aestuarii strain PN3F2 plasmid pPN3F2_2, complete sequence) position: , mismatch: 1, identity: 0.958

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
*********************.**

15. spacer 64.2|6967326|24|NC_019729|CRT matches to MN047793 (Xanthomonas phage Xoo-sp13, complete genome) position: , mismatch: 1, identity: 0.958

gacaccaacaccggcaccaacacc	CRISPR spacer
gacaccaacaccgacaccaacacc	Protospacer
*************.**********

16. spacer 64.6|6967608|24|NC_019729|CRT matches to MN047793 (Xanthomonas phage Xoo-sp13, complete genome) position: , mismatch: 1, identity: 0.958

gacaccaacaccggcaccaacacc	CRISPR spacer
gacaccaacaccgacaccaacacc	Protospacer
*************.**********

17. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccagcgct	Protospacer
*******************.***.

18. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaacagc	Protospacer
*********************. *

19. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP050315 (Shewanella aestuarii strain PN3F2 plasmid pPN3F2_2, complete sequence) position: , mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
cacaccaacaccaacaccaacacc	Protospacer
 ********************.**

20. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_AP018256 (Calothrix sp. NIES-4071 plasmid plasmid1 DNA, complete genome) position: , mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
gacaccaacaccaacactaacgcc	Protospacer
.****************.******

21. spacer 64.1|6967260|24|NC_019729|CRT matches to NC_028998 (Phormidium phage MIS-PhV1B, complete genome) position: , mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaacatc	Protospacer
*********************..*

22. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
accaccaacaccaacaccaactcc	Protospacer
* ******************* **

23. spacer 64.1|6967260|24|NC_019729|CRT matches to MN694040 (Marine virus AFVG_250M411, complete genome) position: , mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacgcctacaccaacgcc	Protospacer
*********.** ***********

24. spacer 64.1|6967260|24|NC_019729|CRT matches to KU160661 (Arthrobacter phage Pumancara, complete genome) position: , mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaccaccaaggcc	Protospacer
************* ****** ***

25. spacer 64.1|6967260|24|NC_019729|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
accaccaacaccaacaccaactcc	Protospacer
* ******************* **

26. spacer 64.1|6967260|24|NC_019729|CRT matches to NC_030925 (Bacillus phage Shbh1, complete genome) position: , mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacgccaacaccagcaccaacgcc	Protospacer
***.*********.**********

27. spacer 64.1|6967260|24|NC_019729|CRT matches to DQ535032 (Lactococcus lactis phage KSY1, complete genome) position: , mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaactccaacaccaactcc	Protospacer
********* *********** **

28. spacer 64.1|6967260|24|NC_019729|CRT matches to NC_009817 (Lactococcus phage KSY1, complete genome) position: , mismatch: 2, identity: 0.917

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaactccaacaccaactcc	Protospacer
********* *********** **

29. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP037434 (Lactobacillus plantarum strain EM plasmid pEM5, complete sequence) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
aacagcaacaccggcaccaacacc	Protospacer
.*** *******************

30. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP035132 (Lactobacillus plantarum strain SRCM103311 plasmid unnamed1) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
aacagcaacaccggcaccaacacc	Protospacer
.*** *******************

31. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP035115 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed2) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
aacagcaacaccggcaccaacacc	Protospacer
.*** *******************

32. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP035115 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed2) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
aacagcaacaccggcaccaacacc	Protospacer
.*** *******************

33. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP020097 (Lactobacillus plantarum strain K25 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
aacagcaacaccggcaccaacacc	Protospacer
.*** *******************

34. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP035567 (Lactobacillus plantarum strain SRCM103300 plasmid unnamed1) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
aacagcaacaccggcaccaacacc	Protospacer
.*** *******************

35. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP046663 (Lactobacillus plantarum strain 83-18 plasmid p83-18.3, complete sequence) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
aacagcaacaccggcaccaacacc	Protospacer
.*** *******************

36. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
gacacccacaccggcaccagcacc	Protospacer
****** ************.****

37. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP049906 (Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
gacaccaacacgagcaccaacacc	Protospacer
*********** .***********

38. spacer 64.2|6967326|24|NC_019729|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
gacaccgacaccggcaccgacacc	Protospacer
******.***********.*****

39. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP037434 (Lactobacillus plantarum strain EM plasmid pEM5, complete sequence) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
aacagcaacaccggcaccaacacc	Protospacer
.*** *******************

40. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP035132 (Lactobacillus plantarum strain SRCM103311 plasmid unnamed1) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
aacagcaacaccggcaccaacacc	Protospacer
.*** *******************

41. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP035115 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed2) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
aacagcaacaccggcaccaacacc	Protospacer
.*** *******************

42. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP035115 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed2) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
aacagcaacaccggcaccaacacc	Protospacer
.*** *******************

43. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP020097 (Lactobacillus plantarum strain K25 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
aacagcaacaccggcaccaacacc	Protospacer
.*** *******************

44. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP035567 (Lactobacillus plantarum strain SRCM103300 plasmid unnamed1) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
aacagcaacaccggcaccaacacc	Protospacer
.*** *******************

45. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP046663 (Lactobacillus plantarum strain 83-18 plasmid p83-18.3, complete sequence) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
aacagcaacaccggcaccaacacc	Protospacer
.*** *******************

46. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
gacacccacaccggcaccagcacc	Protospacer
****** ************.****

47. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP049906 (Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
gacaccaacacgagcaccaacacc	Protospacer
*********** .***********

48. spacer 64.6|6967608|24|NC_019729|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 2, identity: 0.917

gacaccaacaccggcaccaacacc	CRISPR spacer
gacaccgacaccggcaccgacacc	Protospacer
******.***********.*****

49. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP024609 (Massilia violaceinigra strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
cacgccaacaccaacacccacgcc	Protospacer
 **.************** *****

50. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP024609 (Massilia violaceinigra strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
cacgccaacaccaacaccaacacc	Protospacer
 **.*****************.**

51. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP024609 (Massilia violaceinigra strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
cacgccaacaccaacacccacgcc	Protospacer
 **.************** *****

52. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
ctcaccaacaccaacaccaacacc	Protospacer
  *******************.**

53. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP009639 (Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaaatca	Protospacer
********************  * 

54. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP053963 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccaaatca	Protospacer
********************  * 

55. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_LT703506 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
gacaccaacaccaacaccaacaca	Protospacer
.********************.* 

56. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaaaaccaacgtt	Protospacer
************** *******..

57. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaaaaccaacgtt	Protospacer
************** *******..

58. spacer 64.1|6967260|24|NC_019729|CRT matches to NC_010363 (Lactococcus phage asccphi28, complete genome) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
tgcaccaacaccaacaccaacacc	Protospacer
 .*******************.**

59. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
tgcaccaacaccaacaccagcgcc	Protospacer
 .*****************.****

60. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaaaaccaacgtt	Protospacer
************** *******..

61. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
gacaccgacaccgacaccaacgcc	Protospacer
.*****.*****.***********

62. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP011457 (Anabaena sp. WA102 plasmid, complete sequence) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
accgacaacaccaacaccaacgcc	Protospacer
* *. *******************

63. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
cacaccaacgccaacacctacgcc	Protospacer
 ********.******** *****

64. spacer 64.1|6967260|24|NC_019729|CRT matches to MN047793 (Xanthomonas phage Xoo-sp13, complete genome) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
gacaccaacaccgacaccaacacc	Protospacer
.***********.********.**

65. spacer 64.1|6967260|24|NC_019729|CRT matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
gacaccaacaccgacaccaacggc	Protospacer
.***********.********* *

66. spacer 64.1|6967260|24|NC_019729|CRT matches to NC_010811 (Ralstonia phage RSL1, complete genome) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacagcaatgcg	Protospacer
**************** ***.** 

67. spacer 64.1|6967260|24|NC_019729|CRT matches to AP014368 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S41-C87, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaccaccaactac	Protospacer
************* *******  *

68. spacer 64.1|6967260|24|NC_019729|CRT matches to AB366653 (Ralstonia phage RSL1 DNA, complete genome) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacagcaatgcg	Protospacer
**************** ***.** 

69. spacer 64.1|6967260|24|NC_019729|CRT matches to MT276994 (Aeromonas phage AhyVDH1, complete genome) position: , mismatch: 3, identity: 0.875

aacaccaacaccaacaccaacgcc	CRISPR spacer
actatcaacaccaacaccaacgcc	Protospacer
* .*.*******************

70. spacer 64.2|6967326|24|NC_019729|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccatcaccggcaccaaaacc	Protospacer
.****** ************ ***

71. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
ctcaccaacaccggcaccatcacc	Protospacer
  ***************** ****

72. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tacgccaacaccggcaccaacacg	Protospacer
 **.******************* 

73. spacer 64.2|6967326|24|NC_019729|CRT matches to MG592515 (Vibrio phage 1.144.O._10N.286.45.B3, partial genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tgcaccaacacccgcaccaacacc	Protospacer
 .********** ***********

74. spacer 64.2|6967326|24|NC_019729|CRT matches to JX976549 (Acinetobacter phage IME-AB2, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tgcaccaacaccagcaccaacacc	Protospacer
 .**********.***********

75. spacer 64.2|6967326|24|NC_019729|CRT matches to AP014367 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S41-C79, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tgcaccaacacctgcaccaacacc	Protospacer
 .********** ***********

76. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tacaccaacaccgtctccaacacc	Protospacer
 ************ * ********

77. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
gacacgatcaccggcaccaacacg	Protospacer
***** * *************** 

78. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tacaccaacaccgtctccaacacc	Protospacer
 ************ * ********

79. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_LT703506 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
gacaccaacaccaacaccaacaca	Protospacer
************..********* 

80. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tacaccaacaccggacccaacacc	Protospacer
 *************  ********

81. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP050315 (Shewanella aestuarii strain PN3F2 plasmid pPN3F2_2, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
cacaccaacaccaacaccaacacc	Protospacer
 ***********..**********

82. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP050315 (Shewanella aestuarii strain PN3F2 plasmid pPN3F2_2, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

83. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacgccgacaccaacacc	Protospacer
.********.***.**********

84. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacacctacaccggcaccaccacc	Protospacer
.***** ************ ****

85. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tacaccaacaccggcaccggcacc	Protospacer
 *****************..****

86. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

87. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccagcaccggcaccagcacc	Protospacer
.******.***********.****

88. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

89. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

90. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

91. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP009639 (Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

92. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP009639 (Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

93. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP033025 (Agrobacterium fabrum strain 1D132 plasmid pAt1D132b, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
gacacgatcaccggcaccaacacg	Protospacer
***** * *************** 

94. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP013153 (Lactobacillus plantarum strain MF1298 plasmid pMF1298-3, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacagcaacaccagcaccaacacc	Protospacer
.*** *******.***********

95. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP053963 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

96. spacer 64.2|6967326|24|NC_019729|CRT matches to NZ_CP053963 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

97. spacer 64.2|6967326|24|NC_019729|CRT matches to MT310869 (Microbacterium phage Truong, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tacatcaacaccggcaccaagacc	Protospacer
 ***.*************** ***

98. spacer 64.2|6967326|24|NC_019729|CRT matches to MN693048 (Marine virus AFVG_25M535, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccgacacccgcaccaacacc	Protospacer
.*****.***** ***********

99. spacer 64.2|6967326|24|NC_019729|CRT matches to MH412654 (Synechococcus phage S-T4, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
cactccaacacctgcaccaacacc	Protospacer
 ** ******** ***********

100. spacer 64.2|6967326|24|NC_019729|CRT matches to NC_048761 (Microbacterium phage Akoni, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tacatcaacaccggcaccaagacc	Protospacer
 ***.*************** ***

101. spacer 64.2|6967326|24|NC_019729|CRT matches to KF437907 (Phormidium phage MIS-PhV1A, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

102. spacer 64.2|6967326|24|NC_019729|CRT matches to KF437907 (Phormidium phage MIS-PhV1A, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

103. spacer 64.2|6967326|24|NC_019729|CRT matches to KF437907 (Phormidium phage MIS-PhV1A, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

104. spacer 64.2|6967326|24|NC_019729|CRT matches to KF437907 (Phormidium phage MIS-PhV1A, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

105. spacer 64.2|6967326|24|NC_019729|CRT matches to MG592560 (Vibrio phage 1.190.O._10N.286.51.F12, partial genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
cacaccaacaccgccagcaacacc	Protospacer
 ************ ** *******

106. spacer 64.2|6967326|24|NC_019729|CRT matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
gacaccaacaccgacaccaacggc	Protospacer
*************.*******. *

107. spacer 64.2|6967326|24|NC_019729|CRT matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccttcaccaacacc	Protospacer
.***********  **********

108. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 3, identity: 0.9

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
aacgccgacaccagcggcaaccccaacacc	Protospacer
 *************** **** ********

109. spacer 64.6|6967608|24|NC_019729|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccatcaccggcaccaaaacc	Protospacer
.****** ************ ***

110. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
ctcaccaacaccggcaccatcacc	Protospacer
  ***************** ****

111. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tacgccaacaccggcaccaacacg	Protospacer
 **.******************* 

112. spacer 64.6|6967608|24|NC_019729|CRT matches to MG592515 (Vibrio phage 1.144.O._10N.286.45.B3, partial genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tgcaccaacacccgcaccaacacc	Protospacer
 .********** ***********

113. spacer 64.6|6967608|24|NC_019729|CRT matches to JX976549 (Acinetobacter phage IME-AB2, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tgcaccaacaccagcaccaacacc	Protospacer
 .**********.***********

114. spacer 64.6|6967608|24|NC_019729|CRT matches to AP014367 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S41-C79, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tgcaccaacacctgcaccaacacc	Protospacer
 .********** ***********

115. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tacaccaacaccgtctccaacacc	Protospacer
 ************ * ********

116. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
gacacgatcaccggcaccaacacg	Protospacer
***** * *************** 

117. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tacaccaacaccgtctccaacacc	Protospacer
 ************ * ********

118. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_LT703506 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
gacaccaacaccaacaccaacaca	Protospacer
************..********* 

119. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tacaccaacaccggacccaacacc	Protospacer
 *************  ********

120. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP050315 (Shewanella aestuarii strain PN3F2 plasmid pPN3F2_2, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
cacaccaacaccaacaccaacacc	Protospacer
 ***********..**********

121. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP050315 (Shewanella aestuarii strain PN3F2 plasmid pPN3F2_2, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

122. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacgccgacaccaacacc	Protospacer
.********.***.**********

123. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacacctacaccggcaccaccacc	Protospacer
.***** ************ ****

124. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tacaccaacaccggcaccggcacc	Protospacer
 *****************..****

125. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

126. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccagcaccggcaccagcacc	Protospacer
.******.***********.****

127. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

128. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

129. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

130. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP009639 (Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

131. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP009639 (Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

132. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP033025 (Agrobacterium fabrum strain 1D132 plasmid pAt1D132b, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
gacacgatcaccggcaccaacacg	Protospacer
***** * *************** 

133. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP013153 (Lactobacillus plantarum strain MF1298 plasmid pMF1298-3, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacagcaacaccagcaccaacacc	Protospacer
.*** *******.***********

134. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP053963 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

135. spacer 64.6|6967608|24|NC_019729|CRT matches to NZ_CP053963 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

136. spacer 64.6|6967608|24|NC_019729|CRT matches to MT310869 (Microbacterium phage Truong, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tacatcaacaccggcaccaagacc	Protospacer
 ***.*************** ***

137. spacer 64.6|6967608|24|NC_019729|CRT matches to MN693048 (Marine virus AFVG_25M535, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccgacacccgcaccaacacc	Protospacer
.*****.***** ***********

138. spacer 64.6|6967608|24|NC_019729|CRT matches to MH412654 (Synechococcus phage S-T4, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
cactccaacacctgcaccaacacc	Protospacer
 ** ******** ***********

139. spacer 64.6|6967608|24|NC_019729|CRT matches to NC_048761 (Microbacterium phage Akoni, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
tacatcaacaccggcaccaagacc	Protospacer
 ***.*************** ***

140. spacer 64.6|6967608|24|NC_019729|CRT matches to KF437907 (Phormidium phage MIS-PhV1A, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

141. spacer 64.6|6967608|24|NC_019729|CRT matches to KF437907 (Phormidium phage MIS-PhV1A, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

142. spacer 64.6|6967608|24|NC_019729|CRT matches to KF437907 (Phormidium phage MIS-PhV1A, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

143. spacer 64.6|6967608|24|NC_019729|CRT matches to KF437907 (Phormidium phage MIS-PhV1A, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccaacaccaacacc	Protospacer
.***********..**********

144. spacer 64.6|6967608|24|NC_019729|CRT matches to MG592560 (Vibrio phage 1.190.O._10N.286.51.F12, partial genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
cacaccaacaccgccagcaacacc	Protospacer
 ************ ** *******

145. spacer 64.6|6967608|24|NC_019729|CRT matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
gacaccaacaccgacaccaacggc	Protospacer
*************.*******. *

146. spacer 64.6|6967608|24|NC_019729|CRT matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 3, identity: 0.875

gacaccaacaccggcaccaacacc	CRISPR spacer
aacaccaacaccttcaccaacacc	Protospacer
.***********  **********

147. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP009639 (Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence) position: , mismatch: 4, identity: 0.833

aacaccaacaccaacaccaacgcc	CRISPR spacer
tcaaccaacaccaacaccaacacc	Protospacer
   ******************.**

148. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP053963 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.833

aacaccaacaccaacaccaacgcc	CRISPR spacer
tcaaccaacaccaacaccaacacc	Protospacer
   ******************.**

149. spacer 64.1|6967260|24|NC_019729|CRT matches to KF437907 (Phormidium phage MIS-PhV1A, complete genome) position: , mismatch: 4, identity: 0.833

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccagaatc	Protospacer
*******************. ..*

150. spacer 64.1|6967260|24|NC_019729|CRT matches to NC_010849 (Streptomyces sp. 44030 plasmid pRL1, complete sequence) position: , mismatch: 4, identity: 0.833

aacaccaacaccaacaccaacgcc	CRISPR spacer
ctgaccagcaccaacaccaacgcc	Protospacer
   ****.****************

151. spacer 64.1|6967260|24|NC_019729|CRT matches to NC_010849 (Streptomyces sp. 44030 plasmid pRL1, complete sequence) position: , mismatch: 4, identity: 0.833

aacaccaacaccaacaccaacgcc	CRISPR spacer
ctgaccagcaccaacaccaacgcc	Protospacer
   ****.****************

152. spacer 64.1|6967260|24|NC_019729|CRT matches to MH319749 (Marine virus AG-345-F15 Ga0172271_11 genomic sequence) position: , mismatch: 4, identity: 0.833

aacaccaacaccaacaccaacgcc	CRISPR spacer
aataccaacaccaacaccaacagg	Protospacer
**.******************.  

153. spacer 64.1|6967260|24|NC_019729|CRT matches to MN693269 (Marine virus AFVG_25M487, complete genome) position: , mismatch: 4, identity: 0.833

aacaccaacaccaacaccaacgcc	CRISPR spacer
gtgaccaacatcaacaccaacgcc	Protospacer
.  *******.*************

154. spacer 64.1|6967260|24|NC_019729|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 4, identity: 0.833

aacaccaacaccaacaccaacgcc	CRISPR spacer
aacaccaacaccaacaccagcaag	Protospacer
*******************.*.  

155. spacer 13.3|1072038|25|NC_019729|CRT matches to NC_007412 (Trichormus variabilis ATCC 29413 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.8

taattcttgtggggtgggcttctag	CRISPR spacer
actctcttgtgggatgggcttctag	Protospacer
   .*********.***********

156. spacer 13.3|1072038|25|NC_019729|CRT matches to NZ_CP047244 (Trichormus variabilis 0441 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.8

taattcttgtggggtgggcttctag	CRISPR spacer
actctcttgtgggatgggcttctag	Protospacer
   .*********.***********

157. spacer 63.1|6943877|28|NC_019729|CRISPRCasFinder matches to NZ_CP011383 (Calothrix sp. 336/3 plasmid unnamed1) position: , mismatch: 5, identity: 0.821

tggccagtttctgctttttgtttgagta	CRISPR spacer
gagctagttactgctttttgtttgagtg	Protospacer
 .**.**** *****************.

158. spacer 64.1|6967260|24|NC_019729|CRT matches to MN830252 (Lactobacillus phage JNU_P1, complete genome) position: , mismatch: 5, identity: 0.792

aacaccaacaccaacaccaacgcc	CRISPR spacer
ttcaccaacaccaacaccaaccaa	Protospacer
  *******************   

159. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP021367 (Acidovorax carolinensis strain P4 plasmid pACP4.1, complete sequence) position: , mismatch: 5, identity: 0.833

cacgccgacaccagcgccaacacc-aacacc	CRISPR spacer
aacaccgacaccagcgccaccaccgaacaa-	Protospacer
 **.*************** **** ****  

160. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP021363 (Acidovorax carolinensis strain P3 plasmid pACP3.1, complete sequence) position: , mismatch: 5, identity: 0.833

cacgccgacaccagcgccaacacc-aacacc	CRISPR spacer
aacaccgacaccagcgccaccaccgaacaa-	Protospacer
 **.*************** **** ****  

161. spacer 64.3|6967392|30|NC_019729|CRT matches to NC_018832 (Providencia phage Redjac, complete genome) position: , mismatch: 5, identity: 0.833

cacgccgacaccagcgccaacaccaacacc-	CRISPR spacer
tacgcggacgccagcgccaacacc-tcaccg	Protospacer
.**** ***.**************  **** 

162. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP021360 (Acidovorax carolinensis strain NA2 plasmid pACNA2.1, complete sequence) position: , mismatch: 5, identity: 0.833

cacgccgacaccagcgccaacacc-aacacc	CRISPR spacer
aacaccgacaccagcgccaccaccgaacaa-	Protospacer
 **.*************** **** ****  

163. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP011543 (Corynebacterium mustelae strain DSM 45274 plasmid pCmus45274, complete sequence) position: , mismatch: 5, identity: 0.833

cacgccgacaccagcgccaacaccaacacc-	CRISPR spacer
cgcgccgacaccatccccaacacc-acacta	Protospacer
*.*********** * ******** ****. 

164. spacer 64.3|6967392|30|NC_019729|CRT matches to NC_009806 (Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
agcgccgacaccagcgccgacaccagcgct	Protospacer
 .****************.******.*.*.

165. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP028383 (Escherichia coli strain RM10466 plasmid pRM10466-2, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
acctctgacacctgcgccaccaccaacacc	Protospacer
  * *.****** ****** **********

166. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP012498 (Escherichia coli strain 06-00048 plasmid pCFSAN004178P_02, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
acctctgacacctgcgccaccaccaacacc	Protospacer
  * *.****** ****** **********

167. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP012501 (Escherichia coli strain 08-00022 plasmid pCFSAN004179G, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
acctctgacacctgcgccaccaccaacacc	Protospacer
  * *.****** ****** **********

168. spacer 64.3|6967392|30|NC_019729|CRT matches to KR827394 (Uncultured bacterium plasmid pKAZ5, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
cccgccgacaccagcgccatcatcaagtca	Protospacer
* ***************** **.***  * 

169. spacer 64.3|6967392|30|NC_019729|CRT matches to CP027641 (Escherichia coli strain 2014C-4705 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
acctctgacacctgcgccaccaccaacacc	Protospacer
  * *.****** ****** **********

170. spacer 64.3|6967392|30|NC_019729|CRT matches to CP027580 (Escherichia coli strain 2013C-4282 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
acctctgacacctgcgccaccaccaacacc	Protospacer
  * *.****** ****** **********

171. spacer 64.3|6967392|30|NC_019729|CRT matches to CP027581 (Escherichia coli strain 2013C-4282 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
acctctgacacctgcgccaccaccaacacc	Protospacer
  * *.****** ****** **********

172. spacer 64.3|6967392|30|NC_019729|CRT matches to CP027674 (Escherichia coli strain 2014C-3003 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
acctctgacacctgcgccaccaccaacacc	Protospacer
  * *.****** ****** **********

173. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP028610 (Escherichia coli strain 142 plasmid pTA142-3, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
acctctgacacctgcgccaccaccaacacc	Protospacer
  * *.****** ****** **********

174. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP027375 (Escherichia coli strain 05-3629 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
acctctgacacctgcgccaccaccaacacc	Protospacer
  * *.****** ****** **********

175. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP012500 (Escherichia coli strain 09-00049 plasmid pCFSAN004180G, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
acctctgacacctgcgccaccaccaacacc	Protospacer
  * *.****** ****** **********

176. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP042297 (Escherichia coli strain RM9088 plasmid p2RM9088, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
acctctgacacctgcgccaccaccaacacc	Protospacer
  * *.****** ****** **********

177. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP027458 (Escherichia coli strain 88-3493 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
acctctgacacctgcgccaccaccaacacc	Protospacer
  * *.****** ****** **********

178. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP027367 (Escherichia coli strain 89-3156 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
acctctgacacctgcgccaccaccaacacc	Protospacer
  * *.****** ****** **********

179. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP012499 (Escherichia coli strain GB089 plasmid pCFSAN004181P, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
acctctgacacctgcgccaccaccaacacc	Protospacer
  * *.****** ****** **********

180. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
cagatcgcgaccagcgccaacaccaacccc	Protospacer
** ..**  ****************** **

181. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
cgcgccgccaccagcgccgacaccacccgc	Protospacer
*.***** **********.****** *  *

182. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_LT703506 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
catccagacaccaacaccaacaccaacaca	Protospacer
**. * *******.*.************* 

183. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
cagatcgcgaccagcgccaacaccaacccc	Protospacer
** ..**  ****************** **

184. spacer 64.3|6967392|30|NC_019729|CRT matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 6, identity: 0.8

--cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
accaaacc--taccagcaccaacaccaacacc	Protospacer
  ** .**  .******.**************

185. spacer 64.3|6967392|30|NC_019729|CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 6, identity: 0.8

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
cagatcgcgaccagcgccaacaccaacccc	Protospacer
** ..**  ****************** **

186. spacer 3.1|377940|36|NC_019729|CRISPRCasFinder matches to MK250016 (Prevotella phage Lak-A1, complete genome) position: , mismatch: 7, identity: 0.806

tatctaaatcaattaactgaattaggaatta-gcaga	CRISPR spacer
aattgaaatcaattaacagaattaagaattatacag-	Protospacer
 **. ************ ******.****** .*** 

187. spacer 3.1|377940|36|NC_019729|CRISPRCasFinder matches to MK250019 (Prevotella phage Lak-A2, complete genome) position: , mismatch: 7, identity: 0.806

tatctaaatcaattaactgaattaggaatta-gcaga	CRISPR spacer
aattgaaatcaattaacagaattaagaattatacag-	Protospacer
 **. ************ ******.****** .*** 

188. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018798 (Lactobacillus parabuchneri strain FAM21731 plasmid pFAM21731.2, complete sequence) position: , mismatch: 7, identity: 0.788

tccaacc--ttaaattcctgagctgatcgcttttc	CRISPR spacer
--cgactgattaagttcctgggctgatcgcttttt	Protospacer
  *.**.  ****.******.*************.

189. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040375 (Lactobacillus plantarum subsp. plantarum strain BNH17 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

tccaacc--ttaaattcctgagctgatcgcttttc	CRISPR spacer
--cgactgattaagttcctgggctgatcgcttttt	Protospacer
  *.**.  ****.******.*************.

190. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028231 (Lactobacillus plantarum strain SRCM101222 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788

tccaacc--ttaaattcctgagctgatcgcttttc	CRISPR spacer
--cgactgattaagttcctgggctgatcgcttttt	Protospacer
  *.**.  ****.******.*************.

191. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050807 (Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP511, complete sequence) position: , mismatch: 7, identity: 0.788

tccaacc--ttaaattcctgagctgatcgcttttc	CRISPR spacer
--cgacttattaagttcctgagctgatagcttttt	Protospacer
  *.**.  ****.************* ******.

192. spacer 46.12|4978698|32|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016451 (Sinorhizobium sp. RAC02 plasmid pBSY16_2, complete sequence) position: , mismatch: 7, identity: 0.781

tctagggtgaaaagcttgaattcttccgagag	CRISPR spacer
gatgcggtgaaaagcttgaattctgacgagcg	Protospacer
  *. *******************  **** *

193. spacer 46.91|4984593|35|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 7, identity: 0.8

tatcgtccg---cgcggtcagcgaccgcacatcggcaa	CRISPR spacer
---cgaccggtatgcggtcagcgaccgcaattcggcaa	Protospacer
   ** ***   .****************  *******

194. spacer 46.91|4984593|35|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 7, identity: 0.8

tatcgtccg---cgcggtcagcgaccgcacatcggcaa	CRISPR spacer
---cgaccggtatgcggtcagcgaccgcaattcggcaa	Protospacer
   ** ***   .****************  *******

195. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to NC_019731 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.03, complete sequence) position: , mismatch: 7, identity: 0.759

caggaacaggctttccgggctgttccaca	CRISPR spacer
aaggtacaggctttcggggctgtttgaac	Protospacer
 *** ********** ********. *  

196. spacer 58.21|6127187|37|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to NC_009930 (Acaryochloris marina MBIC11017 plasmid pREB5, complete sequence) position: , mismatch: 7, identity: 0.811

gttgcttatcaacccattcaacaacagccaaaggttc--	CRISPR spacer
gttgattatcaacccattccacaacaa--gatggttccc	Protospacer
**** ************** ******.  .* *****  

197. spacer 63.2|6943931|28|NC_019729|CRISPRCasFinder matches to MN693656 (Marine virus AFVG_250M403, complete genome) position: , mismatch: 7, identity: 0.75

cgtcctgtttctatcttttggtttaagg	CRISPR spacer
tgaagtgtttctatctcttggtttaata	Protospacer
.*   ***********.********* .

198. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
agcatcaacaccaacaccaacaccaacacc	Protospacer
 .*..*.******.*.**************

199. spacer 64.3|6967392|30|NC_019729|CRT matches to MN047793 (Xanthomonas phage Xoo-sp13, complete genome) position: , mismatch: 7, identity: 0.767

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
atcacagacaccaacgccaacaccgacact	Protospacer
  *.* *******.**********.****.

200. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP034431 (Bradyrhizobium sp. LCT2 plasmid pLCT2, complete sequence) position: , mismatch: 7, identity: 0.767

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
gtcgacgaaaccagcgccaacaccaaaatg	Protospacer
  ** *** ***************** *. 

201. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
ggcaacaacaccagcgccaccaccatcacc	Protospacer
 .*. *.************ ***** ****

202. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
ggcaacaacaccagcgccaccaccatcacc	Protospacer
 .*. *.************ ***** ****

203. spacer 64.3|6967392|30|NC_019729|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.767

cacgccgacaccagcgccaacaccaacacc-	CRISPR spacer
accgccgccaccagcgccagcacc-acgcaa	Protospacer
  ***** ***********.**** **.*  

204. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP024249 (Escherichia coli O182:H21 strain D181 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
acctctaacacctgcgccaccaccaacacc	Protospacer
  * *..***** ****** **********

205. spacer 64.3|6967392|30|NC_019729|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
ggcaacaacaccagcgccaccaccatcacc	Protospacer
 .*. *.************ ***** ****

206. spacer 64.3|6967392|30|NC_019729|CRT matches to NC_017627 (Escherichia coli 042 plasmid pAA, complete sequence) position: , mismatch: 7, identity: 0.767

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
acctctaacacctgcgccaccaccaacacc	Protospacer
  * *..***** ****** **********

207. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 7, identity: 0.767

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
tccagcgccaccagcgccagcaccaacagc	Protospacer
. *. ** ***********.******** *

208. spacer 64.3|6967392|30|NC_019729|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.767

cacgccgacaccagcgccaacaccaacacc-	CRISPR spacer
accgccgccaccagcgccagcacc-acgcaa	Protospacer
  ***** ***********.**** **.*  

209. spacer 64.3|6967392|30|NC_019729|CRT matches to NC_019037 (Escherichia coli plasmid pChi7122-2, complete sequence) position: , mismatch: 7, identity: 0.767

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
acctctaacacctgcgccaccaccaacacc	Protospacer
  * *..***** ****** **********

210. spacer 5.1|533418|33|NC_019729|CRISPRCasFinder matches to MT773554 (Myoviridae sp. isolate BML_2 genomic sequence) position: , mismatch: 8, identity: 0.758

tttgttgcattaatttcagcaacaggcaagatg	CRISPR spacer
aatgttgcagtaattccagcaacaggctatagc	Protospacer
  ******* *****.*********** * *  

211. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052067 (Lactobacillus paracasei strain 347-16 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758

tccaacc--ttaaattcctgagctgatcgcttttc	CRISPR spacer
--ggacttattaagttcctgagctgatagcttttt	Protospacer
   .**.  ****.************* ******.

212. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048005 (Lactobacillus paracasei strain CACC 566 plasmid p2CACC566, complete sequence) position: , mismatch: 8, identity: 0.758

tccaacc--ttaaattcctgagctgatcgcttttc	CRISPR spacer
--ggacttattaagttcctgagctgatagcttttt	Protospacer
   .**.  ****.************* ******.

213. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028237 (Lactobacillus plantarum strain SRCM101511 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758

tccaacc--ttaaattcctgagctgatcgcttttc	CRISPR spacer
--ggacttattaagttcctgagctgatagcttttt	Protospacer
   .**.  ****.************* ******.

214. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024414 (Lactobacillus plantarum strain ATCC 8014 plasmid pLP49, complete sequence) position: , mismatch: 8, identity: 0.758

tccaacc--ttaaattcctgagctgatcgcttttc	CRISPR spacer
--ggacttattaagttcctgagctgatagcttttt	Protospacer
   .**.  ****.************* ******.

215. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021459 (Lactobacillus brevis strain ZLB004 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.758

tccaacc--ttaaattcctgagctgatcgcttttc	CRISPR spacer
--ggacttattaagttcctgagctgatagcttttt	Protospacer
   .**.  ****.************* ******.

216. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021461 (Lactobacillus brevis strain ZLB004 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.758

tccaacc--ttaaattcctgagctgatcgcttttc	CRISPR spacer
--ggactgattaagttcctgagctgatagcttttt	Protospacer
   .**.  ****.************* ******.

217. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NC_015603 (Lactobacillus kefiranofaciens ZW3 plasmid pWW2, complete sequence) position: , mismatch: 8, identity: 0.758

tccaacc--ttaaattcctgagctgatcgcttttc	CRISPR spacer
--ggacttattaagttcctgagctgatagcttttt	Protospacer
   .**.  ****.************* ******.

218. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017264 (Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.23, complete sequence) position: , mismatch: 8, identity: 0.758

tccaacc--ttaaattcctgagctgatcgcttttc	CRISPR spacer
--ggacttattaagttcctgagctgatagcttttt	Protospacer
   .**.  ****.************* ******.

219. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035157 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed1) position: , mismatch: 8, identity: 0.758

tccaacc--ttaaattcctgagctgatcgcttttc	CRISPR spacer
--ggacttattaagttcctgagctgatagcttttt	Protospacer
   .**.  ****.************* ******.

220. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017410 (Lactobacillus plantarum strain RI-113 plasmid pRI113_4, complete sequence) position: , mismatch: 8, identity: 0.758

tccaacc--ttaaattcctgagctgatcgcttttc	CRISPR spacer
--ggacttattaagttcctgagctgatagcttttt	Protospacer
   .**.  ****.************* ******.

221. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NC_013200 (Lactobacillus rhamnosus Lc 705 plasmid pLC1, complete sequence) position: , mismatch: 8, identity: 0.758

tccaacc--ttaaattcctgagctgatcgcttttc	CRISPR spacer
--ggacttattaagttcctgagctgatagcttttt	Protospacer
   .**.  ****.************* ******.

222. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040377 (Lactobacillus plantarum subsp. plantarum strain BNH17 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

tccaacc--ttaaattcctgagctgatcgcttttc	CRISPR spacer
--ggacttattaagttcctgagctgatagcttttt	Protospacer
   .**.  ****.************* ******.

223. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028225 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

tccaacc--ttaaattcctgagctgatcgcttttc	CRISPR spacer
--ggacttattaagttcctgagctgatagcttttt	Protospacer
   .**.  ****.************* ******.

224. spacer 46.13|4978767|33|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 8, identity: 0.758

tatcactccgggcccctcacaccggagatggtg	CRISPR spacer
gatgcgctcgggcgcctcacaccggagctggtg	Protospacer
 **   ..***** ************* *****

225. spacer 53.1|5824410|29|NC_019729|CRISPRCasFinder matches to NZ_CP051549 (Phytobacter diazotrophicus strain UAEU22 plasmid unnamed1) position: , mismatch: 8, identity: 0.724

caggaacaggctttccgggctgttccaca	CRISPR spacer
ggggaacagtctttccgggatgttcatgc	Protospacer
 .******* ********* *****    

226. spacer 58.24|6127405|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to CP002963 (Emticicia oligotrophica DSM 17448 plasmid pEMTOL02, complete sequence) position: , mismatch: 8, identity: 0.765

ctaattgtccaaaagttggattaagaactgccgc-	CRISPR spacer
ctaattgtgcaaaagttgtattaa-aattgttaaa	Protospacer
******** ********* ***** **.**...  

227. spacer 62.4|6577966|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NC_011775 (Bacillus cereus G9842 plasmid pG9842_209, complete sequence) position: , mismatch: 8, identity: 0.758

caatatcatttttagaaatattggaaatatttt	CRISPR spacer
tattatcattgttataaatattggaaatagagg	Protospacer
.* ******* *** **************    

228. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 8, identity: 0.733

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
gtggtgcgcaccagcgccgacaccaacacc	Protospacer
   *.  .**********.***********

229. spacer 64.3|6967392|30|NC_019729|CRT matches to KT898134 (Aeromonas phage phiARM81mr, complete genome) position: , mismatch: 8, identity: 0.733

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
gccgccgacaccatcgccaaccccaagcga	Protospacer
  *********** ******* ****    

230. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP015279 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.733

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
gccgccgacacccgcgccaacgccagaccg	Protospacer
  ********** ********.***.  * 

231. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP016381 (Aeromonas hydrophila strain AHNIH1 plasmid pASP-135, complete sequence) position: , mismatch: 8, identity: 0.733

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
gtggccgacaccagagccaagaccaaatgc	Protospacer
   *********** ***** *****   *

232. spacer 64.3|6967392|30|NC_019729|CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 8, identity: 0.733

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
cacgccgccaccagcgccaaccggtccgct	Protospacer
******* *************     *.*.

233. spacer 64.3|6967392|30|NC_019729|CRT matches to MK448982 (Streptococcus phage Javan554, complete genome) position: , mismatch: 8, identity: 0.733

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
ccaaccgacaccagctccaagaccaactgt	Protospacer
*  .*********** **** ******  .

234. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP015268 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.733

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
gccgccgacacccgcgccaacgccagaccg	Protospacer
  ********** ********.***.  * 

235. spacer 64.3|6967392|30|NC_019729|CRT matches to MH593832 (Phage sp. isolate ctcj9, complete genome) position: , mismatch: 8, identity: 0.733

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
gacgccaacaccaccgccaacaccggaaat	Protospacer
 *****.****** **********.. * .

236. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037436 (Lactobacillus plantarum strain EM plasmid pEM7, complete sequence) position: , mismatch: 9, identity: 0.727

tccaaccttaaattcctgagctgatcgcttttc	CRISPR spacer
tgacttattaagttcctgggctgatcgcttttt	Protospacer
*    . ****.******.*************.

237. spacer 15.1|1286051|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037436 (Lactobacillus plantarum strain EM plasmid pEM7, complete sequence) position: , mismatch: 9, identity: 0.727

tccaaccttaaattcctgagctgatcgcttttc	CRISPR spacer
tgacttattaagttcctgggctgatcgcttttt	Protospacer
*    . ****.******.*************.

238. spacer 19.1|1581027|31|NC_019729|CRISPRCasFinder matches to NC_017311 (Desulfovibrio vulgaris RCH1 plasmid pDEVAL01, complete sequence) position: , mismatch: 9, identity: 0.71

caaatcacctgtttatgccccaccaccagcg	CRISPR spacer
tggttgcgctgttcacgccccaccaccagcg	Protospacer
... *   *****.*.***************

239. spacer 19.1|1581027|31|NC_019729|CRISPRCasFinder matches to NC_005863 (Desulfovibrio vulgaris str. Hildenborough plasmid pDV, complete sequence) position: , mismatch: 9, identity: 0.71

caaatcacctgtttatgccccaccaccagcg	CRISPR spacer
tggttgcgctgttcacgccccaccaccagcg	Protospacer
... *   *****.*.***************

240. spacer 44.7|4873922|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to MN693987 (Marine virus AFVG_250M285, complete genome) position: , mismatch: 9, identity: 0.727

aactccctttcctcgtcatcgtcgggcggttcc	CRISPR spacer
ttggccctttcctcgtcatcttcaggcggaggc	Protospacer
    **************** **.*****   *

241. spacer 44.12|4874276|34|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023822 (Escherichia coli strain 7/2 plasmid p7_2.2, complete sequence) position: , mismatch: 9, identity: 0.735

cgattagc-tacgaacaattggacgatgtagatga	CRISPR spacer
-aagaagtatacgaacaactggacgatgtatattc	Protospacer
 .*  **. *********.*********** **  

242. spacer 44.41|4876390|34|NC_019729|CRISPRCasFinder,CRT matches to MK291442 (Paracoccus phage vB_PkoS_Pkon1, complete genome) position: , mismatch: 9, identity: 0.735

tccttgcgattgacaatgaagcccgccagcgagc	CRISPR spacer
ccttgtcgatgggcaatgaagcccgccagcaaag	Protospacer
.*.*  **** *.*****************.*. 

243. spacer 46.8|4978411|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.735

ccaaagccatgttggcgccgatcgcaactgtgcg	CRISPR spacer
ccgtcagcgtgttggcgccgatcgccaccgtgcc	Protospacer
**.  . *.**************** **.**** 

244. spacer 46.8|4978411|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

---ccaaagccatgttggcgccgatcgcaactgtgcg	CRISPR spacer
tggtcaggg---tgttggcgccgatcgccaccgtgcc	Protospacer
   .**..*   **************** **.**** 

245. spacer 58.6|6126094|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.735

agtcgtcggggtctggcggttcgtcggtcgattc	CRISPR spacer
gatcgtcggggtctgcctgttcgtcggcggcctg	Protospacer
..************* * *********. * .* 

246. spacer 58.6|6126094|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.735

agtcgtcggggtctggcggttcgtcggtcgattc	CRISPR spacer
gatcgtcggggtctgcctgttcgtcggcggcctg	Protospacer
..************* * *********. * .* 

247. spacer 58.6|6126094|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007231 (Yersinia similis strain Y_sim_228 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

agtcgtcggggtctggcggttcgtcggtcgattc	CRISPR spacer
agtggtaggggtctggcggttcgtgagccagacc	Protospacer
*** ** ***************** .*.*.. .*

248. spacer 58.6|6126094|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to MN694101 (Marine virus AFVG_250M707, complete genome) position: , mismatch: 9, identity: 0.735

agtcgtcggggtctggcggttcgtcggtcgattc	CRISPR spacer
agttgtcggggtctggcgtttcgtagaagggatg	Protospacer
***.************** ***** *.  *. * 

249. spacer 58.24|6127405|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to AF440571 (Sulfolobus islandicus filamentous virus, partial genome) position: , mismatch: 9, identity: 0.735

ctaattgtccaaaagttggattaagaactgccgc	CRISPR spacer
gtaattgtccaaatggtggattaagctcattcgt	Protospacer
 ************ * *********  *  .**.

250. spacer 58.26|6127551|36|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to MN693849 (Marine virus AFVG_250M1030, complete genome) position: , mismatch: 9, identity: 0.75

tgatgcgcgtgtaggatgcgcgccccccgttggatt	CRISPR spacer
cggtgtgcgtgtaggatgcgcaccccccgcgtgaag	Protospacer
.*.**.***************.*******.  **  

251. spacer 58.53|6129544|37|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to MN694774 (Marine virus AFVG_250M941, complete genome) position: , mismatch: 9, identity: 0.757

tttgctgttcagttaatttaatatttgtttcaataaa	CRISPR spacer
tttgtttttcagttaatttaatatttctactatttat	Protospacer
****.* ******************* * ..* * * 

252. spacer 62.4|6577966|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NC_017483 (Lactococcus lactis subsp. lactis CV56 plasmid pCV56A, complete sequence) position: , mismatch: 9, identity: 0.727

caatatcatttttagaaatattggaaatatttt	CRISPR spacer
tggagacatttttagaaatattggaaagactta	Protospacer
... . ********************* *.** 

253. spacer 62.4|6577966|33|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NC_019308 (Lactococcus lactis subsp. lactis plasmid pIL6, complete sequence) position: , mismatch: 9, identity: 0.727

caatatcatttttagaaatattggaaatatttt	CRISPR spacer
tggagacatttttagaaatattggaaagactta	Protospacer
... . ********************* *.** 

254. spacer 64.3|6967392|30|NC_019729|CRT matches to MN813693 (Mycobacterium phage Imvubu, complete genome) position: , mismatch: 9, identity: 0.7

cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
agtaacacaaccagcaccaacaccaacacc	Protospacer
 ... *.  ******.**************

255. spacer 3.1|377940|36|NC_019729|CRISPRCasFinder matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 10, identity: 0.722

tatctaaatcaattaactgaattaggaattagcaga	CRISPR spacer
aattaaaatcaattaacagaattaagaattatactg	Protospacer
 **. ************ ******.******    .

256. spacer 37.1|4153115|33|NC_019729|CRISPRCasFinder matches to NC_049930 (Enterococcus phage vB_EfaP_Zip, complete genome) position: , mismatch: 10, identity: 0.697

gtgatgagtaattttaagcaatttatggatgat	CRISPR spacer
gtgataagtaattttaaacaatttcatagtata	Protospacer
*****.***********.******   ..*.  

257. spacer 44.28|4875437|34|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to KY883658 (Vibrio phage JSF27, complete genome) position: , mismatch: 10, identity: 0.706

aagatgatttttagagagtgaacaaatccgatta	CRISPR spacer
cggatgatttttggagagtgagcaaagtctacag	Protospacer
 .**********.********.**** .* *. .

258. spacer 44.28|4875437|34|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to KY883657 (Vibrio phage JSF23, complete genome) position: , mismatch: 10, identity: 0.706

aagatgatttttagagagtgaacaaatccgatta	CRISPR spacer
cggatgatttttggagagtgagcaaagtctacag	Protospacer
 .**********.********.**** .* *. .

259. spacer 44.28|4875437|34|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to MT066160 (Vibrio phage Saratov-12, complete genome) position: , mismatch: 10, identity: 0.706

aagatgatttttagagagtgaacaaatccgatta	CRISPR spacer
cggatgatttttggagagtgagcaaagtctacag	Protospacer
 .**********.********.**** .* *. .

260. spacer 44.28|4875437|34|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NC_015158 (Vibrio phage ICP2, complete genome) position: , mismatch: 10, identity: 0.706

aagatgatttttagagagtgaacaaatccgatta	CRISPR spacer
cggatgatttttggagagtgagcaaagtctacag	Protospacer
 .**********.********.**** .* *. .

261. spacer 44.28|4875437|34|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to KM224878 (Vibrio phage ICP2_2011_A, complete genome) position: , mismatch: 10, identity: 0.706

aagatgatttttagagagtgaacaaatccgatta	CRISPR spacer
cggatgatttttggagagtgagcaaagtctacag	Protospacer
 .**********.********.**** .* *. .

262. spacer 44.28|4875437|34|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to HQ641346 (Vibrio phage ICP2_2006_A, complete genome) position: , mismatch: 10, identity: 0.706

aagatgatttttagagagtgaacaaatccgatta	CRISPR spacer
cggatgatttttggagagtgagcaaagtctacag	Protospacer
 .**********.********.**** .* *. .

263. spacer 44.28|4875437|34|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to MT767883 (Vibrio phage Saratov-15, complete genome) position: , mismatch: 10, identity: 0.706

aagatgatttttagagagtgaacaaatccgatta	CRISPR spacer
cggatgatttttggagagtgagcaaagtctacag	Protospacer
 .**********.********.**** .* *. .

264. spacer 62.17|6578914|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007231 (Yersinia similis strain Y_sim_228 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ttcatagatgtggaatttgacgttttccatgagc	CRISPR spacer
gctgcaggggtggaatttgacgttatccatcaga	Protospacer
 ....**. *************** ***** ** 

265. spacer 62.17|6578914|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028488 (Yersinia massiliensis strain GTA plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ttcatagatgtggaatttgacgttttccatgagc	CRISPR spacer
agctgcggggtggaatttgacgttatccatcaga	Protospacer
  *   *. *************** ***** ** 

266. spacer 64.3|6967392|30|NC_019729|CRT matches to NZ_CP050315 (Shewanella aestuarii strain PN3F2 plasmid pPN3F2_2, complete sequence) position: , mismatch: 10, identity: 0.667

------cacgccgacaccagcgccaacaccaacacc	CRISPR spacer
gggcggcacaccaacaccaacaccaacacc------	Protospacer
      ***.**.******.*.********      

267. spacer 3.2|378006|36|NC_019729|CRISPRCasFinder matches to CP015514 (Vibrio vulnificus strain FORC_036 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.694

catttaagcaaattaactgaattattcctaaataat	CRISPR spacer
agcttatgcaaattaacttaattattcctgagctga	Protospacer
 ..*** *********** **********.*.. . 

268. spacer 5.1|533418|33|NC_019729|CRISPRCasFinder matches to NZ_CP035463 (Photobacterium damselae subsp. damselae strain KC-Na-NB1 plasmid pFPPDNB1-5, complete sequence) position: , mismatch: 11, identity: 0.667

tttgttgcattaatttcagcaacaggcaagatg	CRISPR spacer
attgttgctttattttcagcaacagcttttgct	Protospacer
 ******* *** ************ .   .. 

269. spacer 32.1|3371418|32|NC_019729|CRISPRCasFinder matches to MN694547 (Marine virus AFVG_250M388, complete genome) position: , mismatch: 11, identity: 0.656

aaaaatccgttgccgaacttccttcttccttt	CRISPR spacer
cgtttcttcttgccgagcttcctccttccttt	Protospacer
 .   ... *******.******.********

270. spacer 40.5|4644999|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to MH976516 (Corynebacterium phage PeteyPab, complete genome) position: , mismatch: 11, identity: 0.676

tccgtcagaagggcaaaaagaagggaaaggtttt	CRISPR spacer
ccgcgaagaagggcaagcagaagggaaaggccga	Protospacer
.*    **********. ************..  

271. spacer 40.5|4644999|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to MG198778 (Corynebacterium phage PotatoChip, complete genome) position: , mismatch: 11, identity: 0.676

tccgtcagaagggcaaaaagaagggaaaggtttt	CRISPR spacer
ccgcgaagaagggcaagcagaagggaaaggccga	Protospacer
.*    **********. ************..  

272. spacer 40.5|4644999|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to MG198780 (Corynebacterium phage Zion, complete genome) position: , mismatch: 11, identity: 0.676

tccgtcagaagggcaaaaagaagggaaaggtttt	CRISPR spacer
ccgcgaagaagggcaagcagaagggaaaggccga	Protospacer
.*    **********. ************..  

273. spacer 40.5|4644999|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to MH926056 (Corynebacterium phage Cruella, complete genome) position: , mismatch: 11, identity: 0.676

tccgtcagaagggcaaaaagaagggaaaggtttt	CRISPR spacer
ccgcgaagaagggcaagcagaagggaaaggccga	Protospacer
.*    **********. ************..  

274. spacer 40.5|4644999|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to MG198776 (Corynebacterium phage C3PO, complete genome) position: , mismatch: 11, identity: 0.676

tccgtcagaagggcaaaaagaagggaaaggtttt	CRISPR spacer
ccgcgaagaagggcaagcagaagggaaaggccga	Protospacer
.*    **********. ************..  

275. spacer 40.5|4644999|34|NC_019729|CRISPRCasFinder,CRT,PILER-CR matches to MK977700 (Corynebacterium phage Stickynote, complete genome) position: , mismatch: 11, identity: 0.676

tccgtcagaagggcaaaaagaagggaaaggtttt	CRISPR spacer
ccgcgaagaagggcaagcagaagggaaaggccga	Protospacer
.*    **********. ************..  

276. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KX581091 (Vibrio phage Cla, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

277. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KX581096 (Vibrio phage pVa-5, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

278. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to MK672804 (Vibrio phage Va_178/90_p41, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

279. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KY658673 (Vibrio phage H2 PGK-2017, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

280. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KX581093 (Vibrio phage Pel, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

281. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KX581097 (Vibrio phage pVa-6, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

282. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KY658677 (Vibrio phage P3, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

283. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KX581098 (Vibrio phage VaK, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

284. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KY658674 (Vibrio phage H8, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

285. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KY658676 (Vibrio phage P2, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

286. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KX581090 (Vibrio phage Her, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

287. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KY658678 (Vibrio phage pVa-3, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

288. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KY658679 (Vibrio phage pVa-4, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

289. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to MK672800 (Vibrio phage Va_90-11-287_p41_Ba35, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

290. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to MK672799 (Vibrio phage Va_90-11-287_p41, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

291. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KX581092 (Vibrio phage Len, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

292. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KX581094 (Vibrio phage pVa-2, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

293. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to MK672803 (Vibrio phage Va_91-7-154_p41, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

294. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KY658680 (Vibrio phage pVa-8, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

295. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KY658675 (Vibrio phage H20, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

296. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KX581095 (Vibrio phage pVa-1, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

297. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KX581099 (Vibrio phage Strym, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

298. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to MK672801 (Vibrio phage Va_90-11-287_p41_T265, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

299. spacer 62.7|6578193|33|NC_019729|CRISPRCasFinder,CRT matches to KX581100 (Vibrio phage pVa-7, complete genome) position: , mismatch: 11, identity: 0.667

gcaattctggtaaacctaccaagcggcatttgt	CRISPR spacer
cgtcttctggttaacttaccaagcggcaaagcg	Protospacer
    ******* ***.************     

300. spacer 7.10|604111|35|NC_019729|CRISPRCasFinder,CRT matches to NZ_CP014068 (Enterococcus gallinarum strain FDAARGOS_163 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.657

cagaagtatcggtgtcaataatatcgaaacattga	CRISPR spacer
ggatgttataggtgtcaatcatatcgaaacaccag	Protospacer
 .. . *** ********* ***********....

301. spacer 44.3|4873622|37|NC_019729|PILER-CR,CRISPRCasFinder,CRT matches to NC_010579 (Xylella fastidiosa M23 plasmid pXFAS01, complete sequence) position: , mismatch: 12, identity: 0.676

ctaaaatcgcgcaacatcaaattaacagcagcatcaa	CRISPR spacer
tccattctgcgccagatcaaattaacagcagcattct	Protospacer
.. *  ..**** * *******************.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1508884 : 1552510 31 Bacillus_virus(14.29%) transposase NA
DBSCAN-SWA_2 1614940 : 1658250 37 Nostoc_phage(10.0%) tRNA,transposase,protease NA
DBSCAN-SWA_3 2918738 : 2966541 48 Bacteriophage(22.22%) transposase NA
DBSCAN-SWA_4 4206945 : 4326347 86 Tupanvirus(27.78%) tRNA,transposase,protease NA
DBSCAN-SWA_5 4376273 : 4445746 46 Pseudomonas_phage(12.5%) transposase,protease NA
DBSCAN-SWA_6 5990670 : 5997442 7 Streptomyces_phage(16.67%) transposase NA
DBSCAN-SWA_7 6267891 : 6277449 8 Ectocarpus_siliculosus_virus(20.0%) NA NA
DBSCAN-SWA_8 6377452 : 6446762 54 Microcystis_virus(20.0%) transposase,protease NA
DBSCAN-SWA_9 6640263 : 6725911 55 Leptospira_phage(40.0%) tail,transposase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_019729.1|WP_190274390.1|2958030_2958204_-|hypothetical-protein 2958030_2958204_- 57 aa aa NA NA NA 2918738-2966541 yes
3. NC_019764
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019764_1 26887-26969 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019764_2 50769-50923 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_019764_1 1.1|26910|37|NC_019764|CRISPRCasFinder 26910-26946 37 NC_019764.1 26982-27018 0 1.0

1. spacer 1.1|26910|37|NC_019764|CRISPRCasFinder matches to position: 26982-27018, mismatch: 0, identity: 1.0

tgaacgtcttccgattcttctgaaggcaaaggaggag	CRISPR spacer
tgaacgtcttccgattcttctgaaggcaaaggaggag	Protospacer
*************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_019764_1 1.1|26910|37|NC_019764|CRISPRCasFinder 26910-26946 37 NC_019764 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.04, complete sequence 26910-26946 0 1.0
NC_019764_1 1.1|26910|37|NC_019764|CRISPRCasFinder 26910-26946 37 NC_019764 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.04, complete sequence 26982-27018 0 1.0
NC_019764_2 2.1|50819|55|NC_019764|CRISPRCasFinder 50819-50873 55 NC_019764 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.04, complete sequence 50819-50873 0 1.0

1. spacer 1.1|26910|37|NC_019764|CRISPRCasFinder matches to NC_019764 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.04, complete sequence) position: , mismatch: 0, identity: 1.0

tgaacgtcttccgattcttctgaaggcaaaggaggag	CRISPR spacer
tgaacgtcttccgattcttctgaaggcaaaggaggag	Protospacer
*************************************

2. spacer 1.1|26910|37|NC_019764|CRISPRCasFinder matches to NC_019764 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.04, complete sequence) position: , mismatch: 0, identity: 1.0

tgaacgtcttccgattcttctgaaggcaaaggaggag	CRISPR spacer
tgaacgtcttccgattcttctgaaggcaaaggaggag	Protospacer
*************************************

3. spacer 2.1|50819|55|NC_019764|CRISPRCasFinder matches to NC_019764 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.04, complete sequence) position: , mismatch: 0, identity: 1.0

ctgccgcctttgtttgtacctgttcctctgcttccgattctggctgttctagcga	CRISPR spacer
ctgccgcctttgtttgtacctgttcctctgcttccgattctggctgttctagcga	Protospacer
*******************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_019730
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 24502 : 84223 28 Thermus_phage(33.33%) transposase NA
DBSCAN-SWA_2 111386 : 174296 55 Synechococcus_phage(16.67%) transposase NA
DBSCAN-SWA_3 181536 : 246055 56 Tetraselmis_virus(18.18%) transposase,integrase attL 211765:211780|attR 252800:252815
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NC_019763
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019763_1 40283-40397 TypeV NA
1 spacers
cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019763_2 229867-229963 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_019763_1 1.1|40317|47|NC_019763|CRISPRCasFinder 40317-40363 47 NC_019763 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.01, complete sequence 40317-40363 0 1.0
NC_019763_2 2.1|229892|47|NC_019763|CRISPRCasFinder 229892-229938 47 NC_019763 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.01, complete sequence 229892-229938 0 1.0

1. spacer 1.1|40317|47|NC_019763|CRISPRCasFinder matches to NC_019763 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.01, complete sequence) position: , mismatch: 0, identity: 1.0

cttgaggaaacaggtttaagccgagatgcagcagcgcgctttatcgc	CRISPR spacer
cttgaggaaacaggtttaagccgagatgcagcagcgcgctttatcgc	Protospacer
***********************************************

2. spacer 2.1|229892|47|NC_019763|CRISPRCasFinder matches to NC_019763 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.01, complete sequence) position: , mismatch: 0, identity: 1.0

ggaaaattttccattgtcactgtggcccagagccagatttggctgaa	CRISPR spacer
ggaaaattttccattgtcactgtggcccagagccagatttggctgaa	Protospacer
***********************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6905 : 70325 55 uncultured_Caudovirales_phage(15.38%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage