Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_018704 Amphibacillus xylanus NBRC 15112, complete genome 1 crisprs csa3,cas14j,WYL,cas3,RT,DinG,DEDDh 0 1 10 0

Results visualization

1. NC_018704
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018704_1 2106882-2107064 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018704_1 1.2|2106942|22|NC_018704|CRT 2106942-2106963 22 NC_047948 Staphylococcus phage phiSA_BS2, complete genome 84680-84701 2 0.909
NC_018704_1 1.2|2106942|22|NC_018704|CRT 2106942-2106963 22 MH078572 Staphylococcus phage phiSA_BS1, complete genome 39533-39554 2 0.909

1. spacer 1.2|2106942|22|NC_018704|CRT matches to NC_047948 (Staphylococcus phage phiSA_BS2, complete genome) position: , mismatch: 2, identity: 0.909

gtttatgtgcgatattttgaat	CRISPR spacer
atttatgtgctatattttgaat	Protospacer
.********* ***********

2. spacer 1.2|2106942|22|NC_018704|CRT matches to MH078572 (Staphylococcus phage phiSA_BS1, complete genome) position: , mismatch: 2, identity: 0.909

gtttatgtgcgatattttgaat	CRISPR spacer
atttatgtgctatattttgaat	Protospacer
.********* ***********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 155990 : 224265 73 Bacillus_phage(29.41%) capsid,holin,head,protease,portal,tail,tRNA,integrase,terminase attL 189272:189331|attR 225281:225366
DBSCAN-SWA_2 437217 : 445422 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_3 481131 : 489470 8 Lactococcus_phage(28.57%) transposase NA
DBSCAN-SWA_4 1029468 : 1081609 53 Bacillus_phage(37.5%) coat,transposase,holin,protease,tRNA NA
DBSCAN-SWA_5 1102086 : 1110652 7 Tupanvirus(33.33%) tRNA NA
DBSCAN-SWA_6 1173242 : 1182332 9 Helicobacter_phage(16.67%) tRNA NA
DBSCAN-SWA_7 1252461 : 1260245 10 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_8 1432176 : 1494850 57 Streptococcus_phage(30.0%) transposase,tRNA,integrase,coat attL 1424471:1424485|attR 1456281:1456295
DBSCAN-SWA_9 1682520 : 1737285 60 Streptococcus_phage(25.0%) transposase,integrase attL 1692404:1692420|attR 1730611:1730627
DBSCAN-SWA_10 2352430 : 2401529 35 Bacillus_phage(30.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage