1. spacer 1.3|639223|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 5, identity: 0.833
gatcagcggcggcgagggtgaggattatat- CRISPR spacer
gctcaccggcggcgagggagagga-tacatt Protospacer
* *** ************ ***** **.**
2. spacer 1.3|639223|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 5, identity: 0.833
gatcagcggcggcgagggtgaggattatat- CRISPR spacer
gctcaccggcggcgagggagagga-tacatt Protospacer
* *** ************ ***** **.**
3. spacer 1.2|639169|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP038236 (Leisingera sp. NJS201 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
cattgatgccggtcagggtaatgataccgt CRISPR spacer
ctttgatgccggtcagggcgatgattgggt Protospacer
* ****************..***** **
4. spacer 1.3|639223|30|NZ_CP004388|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 6, identity: 0.8
gatcagcggcggcgagggtgaggattatat CRISPR spacer
gctcaccggcggcgagggagaggatgcttt Protospacer
* *** ************ ****** * *
5. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP014527 (Haematospirillum jordaniae strain H5569 plasmid unnamed 2, complete sequence) position: , mismatch: 6, identity: 0.8
tgtaactggcggtgccggagacgacacgat CRISPR spacer
cgccatcggcggtgccggagacgacaccat Protospacer
.*. *..******************** **
6. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 6, identity: 0.8
tgtaactggcggtgccggagacgacacgat CRISPR spacer
attgagtggcggtgccggcgacgacacgct Protospacer
*.* ************ ********* *
7. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 6, identity: 0.8
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctgaccggcggtgccggcgacgacacgct Protospacer
*.**.*********** ********* *
8. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.8
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctgaccggcggtgccggcgacgacacgct Protospacer
*.**.*********** ********* *
9. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.8
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctgaccggcggtgccggcgacgacacgct Protospacer
*.**.*********** ********* *
10. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP024426 (Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence) position: , mismatch: 6, identity: 0.8
tgtaactggcggtgccggagacgacacgat CRISPR spacer
tctggcaggcggtgccggcgacgacacgct Protospacer
* *..* *********** ********* *
11. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP020445 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.8
tgtaactggcggtgccggagacgacacgat CRISPR spacer
tctggcaggcggtgccggcgacgacacgct Protospacer
* *..* *********** ********* *
12. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
tgtaactggcggtgccggagacgacacgat CRISPR spacer
tctggcaggcggtgccggcgacgacacgct Protospacer
* *..* *********** ********* *
13. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 6, identity: 0.8
tgtaactggcggtgccggagacgacacgat CRISPR spacer
tctggcaggcggtgccggcgacgacacgct Protospacer
* *..* *********** ********* *
14. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NC_008545 (Burkholderia cenocepacia HI2424 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
tgtaa-ctggcggtgccggagacgacacgat CRISPR spacer
-gcagtccggcggtgccggcaacgacacgat Protospacer
*.*. *.*********** .**********
15. spacer 1.2|639169|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP017851 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence) position: , mismatch: 7, identity: 0.767
cattgatgccggtcagggtaatgataccgt CRISPR spacer
agctgatgccgggcagggtaatgaaactgc Protospacer
..********* *********** **.*.
16. spacer 1.2|639169|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP017286 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence) position: , mismatch: 7, identity: 0.767
cattgatgccggtcagggtaatgataccgt CRISPR spacer
agctgatgccgggcagggtaatgaaactgc Protospacer
..********* *********** **.*.
17. spacer 1.2|639169|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP017281 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence) position: , mismatch: 7, identity: 0.767
cattgatgccggtcagggtaatgataccgt CRISPR spacer
agctgatgccgggcagggtaatgaaactgc Protospacer
..********* *********** **.*.
18. spacer 1.2|639169|30|NZ_CP004388|CRISPRCasFinder matches to NC_011281 (Klebsiella variicola strain 342 plasmid pKP91, complete sequence) position: , mismatch: 7, identity: 0.767
cattgatgccggtcagggtaatgataccgt CRISPR spacer
agctgatgccgggcagggtaatgaaactgc Protospacer
..********* *********** **.*.
19. spacer 1.2|639169|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP044049 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cattgatgccggtcagggtaatgataccgt CRISPR spacer
agctgatgccgggcagggtaatgaaactgc Protospacer
..********* *********** **.*.
20. spacer 1.2|639169|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP041648 (Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence) position: , mismatch: 7, identity: 0.767
cattgatgccggtcagggtaatgataccgt CRISPR spacer
agctgatgccgggcagggtaatgaaactgc Protospacer
..********* *********** **.*.
21. spacer 1.2|639169|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 7, identity: 0.767
cattgatgccggtcagggtaatgataccgt CRISPR spacer
agctgatgccgggcagggtaatgaaactgc Protospacer
..********* *********** **.*.
22. spacer 1.3|639223|30|NZ_CP004388|CRISPRCasFinder matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 7, identity: 0.767
gatcag--cggcggcgagggtgaggattatat CRISPR spacer
--ccaacccggcggcgagggtgaggatcatca Protospacer
.**. *******************.**
23. spacer 1.3|639223|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gatcagcggcggcgagggtgaggattatat CRISPR spacer
catcagcggcggcgacggtgatgacgtcat Protospacer
************** ***** **. .**
24. spacer 1.3|639223|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP021119 (Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gatcagcggcggcgagggtgaggattatat CRISPR spacer
ggtcagcggcggcgtgggtgagcatcgcgt Protospacer
*.************ ******* **....*
25. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggtgccggcgacgacacgat Protospacer
* . .*********** ***********
26. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gcttgacggcggtgccggcgacgacacgat Protospacer
* . .*********** ***********
27. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP045413 (Roseovarius sp. THAF8 plasmid pTHAF8_c, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctgcatggcggcgccggaaacgacacgat Protospacer
*. ******.******.**********
28. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
cctctatggcggtgccggtgacgacacgct Protospacer
. * ************ ********* *
29. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctgaccggcggtgccggcgacgacacctt Protospacer
*.**.*********** ******** *
30. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
cctctatggcggtgccggcgacgacacgtt Protospacer
. * ************ ********* *
31. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP045395 (Roseovarius sp. THAF27 plasmid pTHAF27_b, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctgcatggcggcgccggaaacgacacgat Protospacer
*. ******.******.**********
32. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
cctctatggcggtgccggtgacgacacgct Protospacer
. * ************ ********* *
33. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
cctctatggcggtgccggtgacgacacgct Protospacer
. * ************ ********* *
34. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctgaccggcggtgccggcgacgacacctt Protospacer
*.**.*********** ******** *
35. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctgaccggcggtgccggcgacgacacctt Protospacer
*.**.*********** ******** *
36. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgctggcggtgccggcaacgacacgtt Protospacer
* .************* .******** *
37. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgctggcggtgccggcaacgacacgtt Protospacer
* .************* .******** *
38. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
cctgaacggcggcgccggcgacgacacgat Protospacer
. *.* .*****.***** ***********
39. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
tcttgacggcggcgccggcgacgacacgat Protospacer
* * . .*****.***** ***********
40. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
tcttgacggcggcgccggcgacgacacgat Protospacer
* * . .*****.***** ***********
41. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctgactggcggtgccggcaacgacacctt Protospacer
*.************** .******* *
42. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaactggcggtgccggagacgacacgat CRISPR spacer
tctcgacggcggcgccggtgacgacacgat Protospacer
* * . .*****.***** ***********
43. spacer 1.3|639223|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 8, identity: 0.733
gatcagcggcggcgagggtgaggattatat CRISPR spacer
gatcagcggcagcgggggtgaggcgaacgc Protospacer
**********.***.******** *...
44. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
45. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
46. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
cctcgacggcggtgccggcgacgacacgct Protospacer
. * . .*********** ********* *
47. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
48. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gcttgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
49. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
50. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
51. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
52. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
53. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
54. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
55. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
56. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
57. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
58. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gcttgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
59. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
60. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
61. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
62. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
63. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gcttgatggcggtgccggcgacgacaccct Protospacer
* . ************ ******** *
64. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NC_011986 (Agrobacterium vitis S4 plasmid pAtS4a, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
cgagtgtggaggttccggagacgacacgaa Protospacer
.* . *** *** ***************
65. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
66. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
67. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
68. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
69. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
70. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gctcgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
71. spacer 1.4|639277|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaactggcggtgccggagacgacacgat CRISPR spacer
gcttgacggcggcgccggcgacgacacgat Protospacer
* . .*****.***** ***********
72. spacer 1.2|639169|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 9, identity: 0.7
cattgatgccggtcagggtaatgataccgt CRISPR spacer
ggctggtgtcggtcagggtaatgataatac Protospacer
..**.**.***************** ...
73. spacer 1.3|639223|30|NZ_CP004388|CRISPRCasFinder matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 9, identity: 0.7
gatcagcggcggcgagggtgaggattatat CRISPR spacer
ctccaacggcggcgagggtgaggaccctgc Protospacer
.**.******************.. *..