Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_018500 Bacillus thuringiensis HD-771, complete genome 3 crisprs cas14k,DEDDh,WYL,csa3,cas3,cas14j,DinG,c2c10_CAS-V-U3,c2c9_V-U4 0 2 419 0
NC_018486 Bacillus thuringiensis HD-771 plasmid p01, complete sequence 0 crisprs csa3,cas14j 0 0 1 0
NC_018488 Bacillus thuringiensis HD-771 plasmid p04, complete sequence 0 crisprs csa3 0 0 0 0
NC_018490 Bacillus thuringiensis HD-771 plasmid p08, complete sequence 0 crisprs NA 0 0 0 0
NC_018502 Bacillus thuringiensis HD-771 plasmid p05, complete sequence 0 crisprs NA 0 0 1 0
NC_018501 Bacillus thuringiensis HD-771 plasmid p02, complete sequence 2 crisprs c2c10_CAS-V-U3,csa3 1 6 1 0
NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 1 crisprs NA 4 2 0 0
NC_018489 Bacillus thuringiensis HD-771 plasmid p06, complete sequence 0 crisprs NA 0 0 0 0
NC_018487 Bacillus thuringiensis HD-771 plasmid p03, complete sequence 0 crisprs NA 0 0 1 1

Results visualization

1. NC_018500
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018500_1 2170798-2170962 TypeV NA
2 spacers
cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018500_2 3501685-3501760 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018500_3 4358900-4359033 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018500_2 2.1|3501710|26|NC_018500|CRISPRCasFinder 3501710-3501735 26 NZ_CP045855 Agrobacterium sp. MA01 plasmid punnamed1, complete sequence 103187-103212 5 0.808
NC_018500_3 3.2|4358980|31|NC_018500|CRISPRCasFinder 4358980-4359010 31 JX238501 Bacillus phage phiAGATE, complete genome 124565-124595 8 0.742

1. spacer 2.1|3501710|26|NC_018500|CRISPRCasFinder matches to NZ_CP045855 (Agrobacterium sp. MA01 plasmid punnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccgccgttatgattgtgcccacca	CRISPR spacer
ttccgccgctatgattgtgcccagat	Protospacer
 *******.**************   

2. spacer 3.2|4358980|31|NC_018500|CRISPRCasFinder matches to JX238501 (Bacillus phage phiAGATE, complete genome) position: , mismatch: 8, identity: 0.742

atcaacaagcggttcaactagtgacaaaaaa	CRISPR spacer
agtgaagggcggtttaactagtggcaaaaaa	Protospacer
* ..* ..******.********.*******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 11648 12 Emiliania_huxleyi_virus(100.0%) tRNA NA
DBSCAN-SWA_2 15026 : 21422 5 Indivirus(33.33%) protease,tRNA NA
DBSCAN-SWA_3 25753 : 26530 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_4 31713 : 43285 10 Clostridium_phage(33.33%) tRNA NA
DBSCAN-SWA_5 47093 : 48335 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_6 57580 : 68827 8 Mycobacterium_phage(20.0%) NA NA
DBSCAN-SWA_7 73857 : 74889 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_8 78040 : 78301 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_9 85361 : 89992 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_10 95617 : 97045 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_11 100100 : 104870 3 uncultured_Caudovirales_phage(33.33%) transposase NA
DBSCAN-SWA_12 111903 : 112602 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_13 122439 : 127265 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_14 130760 : 132476 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_15 138316 : 140211 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_16 150109 : 152130 4 Megavirus(50.0%) NA NA
DBSCAN-SWA_17 155461 : 156283 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_18 160632 : 163983 3 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_19 175910 : 176861 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_20 181547 : 182504 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_21 190343 : 190964 1 Phage_Wrath(100.0%) NA NA
DBSCAN-SWA_22 194888 : 195662 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_23 200484 : 206338 4 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_24 212977 : 215483 2 Bacillus_virus(50.0%) transposase NA
DBSCAN-SWA_25 224414 : 225932 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_26 241558 : 245975 7 uncultured_marine_virus(33.33%) NA NA
DBSCAN-SWA_27 249138 : 252823 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_28 261090 : 264912 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_29 268528 : 278233 7 Bacillus_virus(40.0%) NA NA
DBSCAN-SWA_30 282049 : 282943 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_31 315030 : 316047 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_32 341619 : 346864 8 Paramecium_bursaria_Chlorella_virus(25.0%) NA NA
DBSCAN-SWA_33 351288 : 354312 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_34 362021 : 362699 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_35 375302 : 384958 5 Exiguobacterium_phage(25.0%) NA NA
DBSCAN-SWA_36 390797 : 392835 2 Lactococcus_phage(50.0%) transposase NA
DBSCAN-SWA_37 395994 : 402641 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_38 414057 : 415434 1 Apis_mellifera_filamentous_virus(100.0%) NA NA
DBSCAN-SWA_39 420419 : 425998 5 Moumouvirus(50.0%) coat NA
DBSCAN-SWA_40 441238 : 444139 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_41 448203 : 449148 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_42 452455 : 453589 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_43 459482 : 461915 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_44 469754 : 470789 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_45 476632 : 481173 5 Trichoplusia_ni_ascovirus(33.33%) NA NA
DBSCAN-SWA_46 496999 : 497761 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_47 512736 : 514239 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_48 520493 : 521870 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_49 528093 : 529449 1 Bacteriophage(100.0%) transposase NA
DBSCAN-SWA_50 536292 : 541595 4 Synechococcus_phage(66.67%) NA NA
DBSCAN-SWA_51 576928 : 577654 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_52 586733 : 588485 2 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_53 591771 : 592599 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_54 598806 : 600468 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_55 613321 : 614557 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_56 620643 : 622821 2 Deep-sea_thermophilic_phage(50.0%) transposase NA
DBSCAN-SWA_57 633535 : 636566 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_58 646256 : 648524 2 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_59 652678 : 660409 9 Bacillus_phage(50.0%) protease NA
DBSCAN-SWA_60 672015 : 689171 10 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_61 695644 : 701866 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_62 710157 : 710562 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_63 713854 : 714604 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_64 725732 : 727163 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_65 732343 : 733369 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_66 744939 : 746163 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_67 759053 : 762606 4 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_68 779911 : 780289 1 Listeria_phage(100.0%) NA NA
DBSCAN-SWA_69 784312 : 787810 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_70 793773 : 799352 3 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_71 840253 : 840568 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_72 850863 : 852807 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_73 864909 : 865817 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_74 870778 : 871945 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_75 876484 : 879398 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_76 885538 : 887576 2 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_77 898310 : 899342 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_78 905572 : 909448 3 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_79 918829 : 920311 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_80 928513 : 933048 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_81 938701 : 942352 3 Cafeteria_roenbergensis_virus(33.33%) NA NA
DBSCAN-SWA_82 947723 : 952569 3 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_83 963540 : 964338 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_84 967593 : 968349 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_85 1006981 : 1008998 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_86 1039931 : 1040597 1 Apis_mellifera_filamentous_virus(100.0%) NA NA
DBSCAN-SWA_87 1043917 : 1057557 11 Bacillus_phage(60.0%) transposase NA
DBSCAN-SWA_88 1064495 : 1071059 6 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_89 1075744 : 1078604 3 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_90 1087751 : 1102670 15 Listeria_phage(25.0%) portal,tail,terminase NA
DBSCAN-SWA_91 1106521 : 1112500 11 Bacillus_phage(33.33%) plate NA
DBSCAN-SWA_92 1116179 : 1130371 20 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_93 1133649 : 1136198 3 Escherichia_phage(33.33%) transposase NA
DBSCAN-SWA_94 1151552 : 1152314 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_95 1160574 : 1162008 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_96 1176059 : 1185651 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_97 1189331 : 1195886 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_98 1202178 : 1203348 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_99 1211779 : 1212157 1 Microbacterium_phage(100.0%) NA NA
DBSCAN-SWA_100 1219686 : 1222042 2 Bacillus_phage(100.0%) transposase NA
DBSCAN-SWA_101 1228782 : 1229130 1 Megavirus(100.0%) NA NA
DBSCAN-SWA_102 1236126 : 1238132 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_103 1245366 : 1246392 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_104 1252775 : 1256372 3 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_105 1265859 : 1273222 8 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_106 1282556 : 1283186 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_107 1304551 : 1310277 5 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_108 1322292 : 1323663 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_109 1327617 : 1447176 121 Bacillus_phage(72.58%) plate,capsid,portal,transposase,protease,head,holin,integrase,terminase attL 1327526:1327585|attR 1446069:1448251
DBSCAN-SWA_110 1452646 : 1458030 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_111 1465495 : 1479171 13 Stenotrophomonas_phage(11.11%) NA NA
DBSCAN-SWA_112 1485132 : 1502942 4 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_113 1509411 : 1513968 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_114 1518640 : 1524315 5 Stx2-converting_phage(33.33%) NA NA
DBSCAN-SWA_115 1529537 : 1529927 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_116 1536709 : 1541284 5 Diachasmimorpha_longicaudata_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_117 1553660 : 1554254 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_118 1566568 : 1584129 17 Bacillus_phage(50.0%) protease,transposase NA
DBSCAN-SWA_119 1589874 : 1590525 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_120 1604679 : 1607619 2 Planktothrix_phage(50.0%) tRNA NA
DBSCAN-SWA_121 1613260 : 1616329 4 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_122 1619392 : 1626550 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_123 1655454 : 1658724 7 Caulobacter_phage(33.33%) NA NA
DBSCAN-SWA_124 1661934 : 1662933 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_125 1667018 : 1672410 6 Tupanvirus(33.33%) transposase NA
DBSCAN-SWA_126 1676557 : 1678824 5 Orpheovirus(50.0%) NA NA
DBSCAN-SWA_127 1689356 : 1690475 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_128 1703259 : 1704207 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_129 1708030 : 1711120 3 Yellowstone_lake_mimivirus(50.0%) NA NA
DBSCAN-SWA_130 1716671 : 1717709 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_131 1723156 : 1725112 3 Paenibacillus_phage(33.33%) NA NA
DBSCAN-SWA_132 1728304 : 1735649 7 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_133 1742111 : 1743576 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_134 1762240 : 1769604 4 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_135 1775554 : 1777243 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_136 1781720 : 1790299 11 uncultured_Caudovirales_phage(28.57%) NA NA
DBSCAN-SWA_137 1813168 : 1814644 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_138 1823353 : 1827914 5 Fowlpox_virus(50.0%) NA NA
DBSCAN-SWA_139 1832615 : 1833785 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_140 1853290 : 1857802 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_141 1869135 : 1872875 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_142 1911645 : 1915329 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_143 1921625 : 1925173 3 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_144 1928409 : 1933341 5 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_145 1939085 : 1948002 10 Bacillus_phage(20.0%) protease NA
DBSCAN-SWA_146 1951989 : 1952196 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_147 1960359 : 1961040 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_148 1974392 : 1985763 10 Bacillus_phage(57.14%) NA NA
DBSCAN-SWA_149 1989445 : 1997988 5 Stenotrophomonas_phage(25.0%) NA NA
DBSCAN-SWA_150 2006969 : 2008422 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_151 2015918 : 2080516 79 Bacillus_phage(63.41%) portal,tail,transposase,terminase NA
DBSCAN-SWA_152 2115091 : 2115757 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_153 2133159 : 2142237 8 Escherichia_phage(25.0%) transposase NA
DBSCAN-SWA_154 2152015 : 2153095 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_155 2161730 : 2167264 6 Bacillus_phage(33.33%) integrase attL 2150421:2150440|attR 2168956:2168975
DBSCAN-SWA_156 2174511 : 2178842 4 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_157 2194686 : 2195760 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_158 2198779 : 2200817 2 Lactococcus_phage(50.0%) transposase NA
DBSCAN-SWA_159 2210555 : 2211857 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_160 2236123 : 2237888 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_161 2256714 : 2258430 1 Micromonas_pusilla_virus(100.0%) NA NA
DBSCAN-SWA_162 2265495 : 2266200 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_163 2270456 : 2271374 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_164 2289156 : 2294307 3 Heterosigma_akashiwo_virus(50.0%) NA NA
DBSCAN-SWA_165 2306036 : 2308855 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_166 2318396 : 2327782 9 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_167 2334813 : 2350461 13 Brevibacillus_phage(70.0%) NA NA
DBSCAN-SWA_168 2355221 : 2380122 16 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_169 2395176 : 2395836 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_170 2404164 : 2405988 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_171 2419431 : 2420424 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_172 2442061 : 2442847 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_173 2446900 : 2447809 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_174 2477524 : 2477842 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_175 2491856 : 2492054 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_176 2513543 : 2517033 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_177 2523745 : 2524612 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_178 2547741 : 2548296 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_179 2552052 : 2552655 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_180 2556683 : 2567862 11 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_181 2571620 : 2572502 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_182 2579125 : 2589443 11 Bacillus_virus(14.29%) NA NA
DBSCAN-SWA_183 2603577 : 2604108 1 uncultured_phage(100.0%) NA NA
DBSCAN-SWA_184 2609876 : 2619002 9 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_185 2624985 : 2627137 2 Erythrobacter_phage(50.0%) NA NA
DBSCAN-SWA_186 2632891 : 2638137 5 Bacillus_phage(66.67%) integrase attL 2627681:2627693|attR 2635706:2635718
DBSCAN-SWA_187 2661577 : 2662852 1 Rhodococcus_phage(100.0%) NA NA
DBSCAN-SWA_188 2669673 : 2670810 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_189 2674496 : 2678274 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_190 2689557 : 2694323 4 Micromonas_sp._RCC1109_virus(50.0%) NA NA
DBSCAN-SWA_191 2709448 : 2714641 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_192 2722682 : 2729150 7 Bacillus_virus(60.0%) NA NA
DBSCAN-SWA_193 2732526 : 2734905 4 Pneumococcus_phage(25.0%) NA NA
DBSCAN-SWA_194 2739853 : 2741350 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_195 2753172 : 2754174 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_196 2760002 : 2767390 10 Bacillus_phage(75.0%) NA NA
DBSCAN-SWA_197 2772298 : 2774374 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_198 2779902 : 2780730 1 Bacillus_phage(100.0%) protease NA
DBSCAN-SWA_199 2787916 : 2789745 2 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_200 2802619 : 2810612 7 Bacillus_phage(28.57%) integrase,transposase attL 2802408:2802454|attR 2816013:2816059
DBSCAN-SWA_201 2818230 : 2818440 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_202 2836273 : 2837389 1 Lactobacillus_phage(100.0%) transposase NA
DBSCAN-SWA_203 2842279 : 2844652 3 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_204 2852621 : 2854688 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_205 2859848 : 2862127 3 Acanthocystis_turfacea_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_206 2866578 : 2871397 5 Cedratvirus(33.33%) NA NA
DBSCAN-SWA_207 2878454 : 2880281 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_208 2884303 : 2884978 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_209 2889743 : 2890679 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_210 2896560 : 2966505 80 uncultured_Caudovirales_phage(46.81%) tRNA,capsid,portal,tail,protease,head,bacteriocin,terminase NA
DBSCAN-SWA_211 2970128 : 2974507 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_212 2981578 : 2981782 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_213 2987496 : 2990522 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_214 2993941 : 2996398 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_215 3006666 : 3008199 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_216 3049036 : 3050776 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_217 3064448 : 3066606 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_218 3070406 : 3074162 5 Megavirus(50.0%) NA NA
DBSCAN-SWA_219 3084683 : 3088761 4 Bacillus_virus(66.67%) transposase NA
DBSCAN-SWA_220 3092254 : 3098608 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_221 3149947 : 3153950 3 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_222 3164413 : 3176744 6 Liberibacter_phage(40.0%) NA NA
DBSCAN-SWA_223 3191511 : 3192834 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_224 3205336 : 3208771 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_225 3219758 : 3228124 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_226 3237427 : 3238420 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_227 3242148 : 3247406 5 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_228 3252413 : 3254276 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_229 3260592 : 3265866 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_230 3274976 : 3278980 2 Bacillus_phage(100.0%) transposase NA
DBSCAN-SWA_231 3289584 : 3296137 6 Bacillus_phage(75.0%) NA NA
DBSCAN-SWA_232 3301636 : 3303634 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_233 3311052 : 3311538 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_234 3326193 : 3327804 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_235 3334941 : 3338625 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_236 3370842 : 3373212 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_237 3378223 : 3380314 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_238 3384489 : 3385509 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_239 3389976 : 3395652 6 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_240 3403092 : 3406706 2 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_241 3429375 : 3431066 2 Clostridioides_phage(50.0%) NA NA
DBSCAN-SWA_242 3437919 : 3444595 7 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_243 3450341 : 3454041 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_244 3459230 : 3464583 6 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_245 3470342 : 3478501 8 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_246 3484538 : 3486113 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_247 3503667 : 3509168 5 Halovirus(33.33%) NA NA
DBSCAN-SWA_248 3514552 : 3515902 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_249 3532043 : 3536478 3 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_250 3548242 : 3552131 3 Bacillus_phage(66.67%) transposase NA
DBSCAN-SWA_251 3557534 : 3563373 4 Dickeya_phage(33.33%) NA NA
DBSCAN-SWA_252 3566718 : 3568290 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_253 3571995 : 3573093 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_254 3581060 : 3583037 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_255 3588834 : 3590385 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_256 3593709 : 3597232 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_257 3618168 : 3619182 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_258 3626703 : 3628464 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_259 3637253 : 3650687 12 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_260 3663151 : 3664531 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_261 3679755 : 3698460 17 Caulobacter_phage(37.5%) tRNA NA
DBSCAN-SWA_262 3703783 : 3707189 2 Mimivirus(50.0%) NA NA
DBSCAN-SWA_263 3713267 : 3715010 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_264 3718818 : 3721008 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_265 3737490 : 3739715 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_266 3746141 : 3746924 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_267 3764376 : 3765903 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_268 3771677 : 3777915 6 Oenococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_269 3789629 : 3790535 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_270 3799061 : 3800081 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_271 3805147 : 3809421 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_272 3813557 : 3825123 11 Prochlorococcus_phage(25.0%) NA NA
DBSCAN-SWA_273 3830967 : 3831759 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_274 3840243 : 3840996 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_275 3855015 : 3868715 12 Bacillus_phage(28.57%) integrase attL 3847713:3847727|attR 3867792:3867806
DBSCAN-SWA_276 3874445 : 3886164 10 uncultured_virus(33.33%) protease,transposase,tRNA NA
DBSCAN-SWA_277 3897322 : 3897673 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_278 3902746 : 3904336 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_279 3907410 : 3908682 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_280 3915901 : 3917844 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_281 3922562 : 3924443 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_282 3930723 : 3931560 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_283 3941449 : 3943088 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_284 3949698 : 3951479 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_285 3958980 : 3964458 5 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_286 3969789 : 3971592 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_287 3975967 : 3978217 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_288 3988226 : 3988940 1 Deep-sea_thermophilic_phage(100.0%) NA NA
DBSCAN-SWA_289 3992141 : 3993841 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_290 4009035 : 4021206 7 Catovirus(25.0%) NA NA
DBSCAN-SWA_291 4024796 : 4025330 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_292 4028349 : 4029747 1 Moumouvirus(100.0%) tRNA NA
DBSCAN-SWA_293 4037477 : 4039913 1 Klebsiella_phage(100.0%) protease NA
DBSCAN-SWA_294 4047551 : 4062076 15 Tupanvirus(25.0%) protease,tRNA NA
DBSCAN-SWA_295 4070895 : 4071432 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_296 4076132 : 4078484 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_297 4086019 : 4093581 9 Streptococcus_phage(60.0%) tRNA NA
DBSCAN-SWA_298 4102304 : 4109165 7 Bacteriophage(20.0%) tRNA NA
DBSCAN-SWA_299 4112571 : 4114035 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_300 4120442 : 4127590 5 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_301 4136050 : 4139336 4 Leptospira_phage(25.0%) protease NA
DBSCAN-SWA_302 4142422 : 4142944 1 Listeria_phage(100.0%) NA NA
DBSCAN-SWA_303 4146760 : 4164073 16 Bacillus_phage(37.5%) protease NA
DBSCAN-SWA_304 4171463 : 4178940 6 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_305 4181950 : 4189237 5 Bacillus_thuringiensis_phage(33.33%) NA NA
DBSCAN-SWA_306 4193702 : 4202158 6 Leptospira_phage(33.33%) NA NA
DBSCAN-SWA_307 4206749 : 4207730 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_308 4212831 : 4214133 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_309 4223699 : 4224758 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_310 4230752 : 4232051 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_311 4235131 : 4239597 5 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_312 4245632 : 4246904 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_313 4250128 : 4257117 7 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_314 4260850 : 4261576 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_315 4286297 : 4287200 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_316 4292730 : 4296486 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_317 4306464 : 4309207 3 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_318 4315425 : 4316013 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_319 4319790 : 4320831 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_320 4324456 : 4327571 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_321 4354164 : 4359942 7 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_322 4363250 : 4378796 15 Bacillus_phage(42.86%) NA NA
DBSCAN-SWA_323 4383463 : 4384144 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_324 4389185 : 4391942 1 Pneumococcus_phage(100.0%) NA NA
DBSCAN-SWA_325 4397704 : 4411483 9 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_326 4416686 : 4418045 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_327 4430808 : 4432289 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_328 4444353 : 4454390 10 Streptococcus_phage(28.57%) NA NA
DBSCAN-SWA_329 4459028 : 4459667 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_330 4465525 : 4474605 10 Planktothrix_phage(25.0%) NA NA
DBSCAN-SWA_331 4480674 : 4568682 102 Bacillus_phage(42.37%) portal,capsid,tail,transposase,protease,head,holin,integrase,terminase attL 4501661:4501681|attR 4540385:4540405
DBSCAN-SWA_332 4577638 : 4578196 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_333 4581847 : 4592557 11 Tupanvirus(25.0%) tRNA NA
DBSCAN-SWA_334 4596777 : 4602428 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_335 4612136 : 4614596 4 Catovirus(50.0%) NA NA
DBSCAN-SWA_336 4623558 : 4634104 8 uncultured_Caudovirales_phage(40.0%) tRNA NA
DBSCAN-SWA_337 4639875 : 4641401 2 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_338 4648181 : 4652082 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_339 4659287 : 4734559 99 Bacillus_phage(57.14%) portal,capsid,plate,coat,bacteriocin,protease,head,integrase,terminase attL 4660920:4660936|attR 4682360:4682376
DBSCAN-SWA_340 4744952 : 4745612 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_341 4748882 : 4749236 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_342 4752390 : 4752744 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_343 4756293 : 4770668 14 Streptococcus_phage(28.57%) transposase,tRNA NA
DBSCAN-SWA_344 4775467 : 4776007 1 Goatpox_virus(100.0%) NA NA
DBSCAN-SWA_345 4785806 : 4786487 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_346 4804138 : 4806547 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_347 4810214 : 4810415 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_348 4815745 : 4823377 7 Mycobacterium_phage(25.0%) NA NA
DBSCAN-SWA_349 4832231 : 4832984 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_350 4839615 : 4841382 3 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_351 4855023 : 4860399 7 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_352 4867997 : 4868870 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_353 4874778 : 4875015 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_354 4879226 : 4879706 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_355 4883606 : 4884371 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_356 4890690 : 4891500 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_357 4902622 : 4903480 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_358 4908026 : 4911332 2 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_359 4920178 : 4934950 14 Staphylococcus_phage(57.14%) integrase,tRNA attL 4925182:4925195|attR 4928628:4928641
DBSCAN-SWA_360 4952142 : 4958560 9 Trichoplusia_ni_ascovirus(33.33%) NA NA
DBSCAN-SWA_361 4972432 : 4979610 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_362 4995122 : 4997268 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_363 5001373 : 5005469 3 Staphylococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_364 5016971 : 5021373 4 Faustovirus(33.33%) tRNA NA
DBSCAN-SWA_365 5051126 : 5054453 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_366 5059612 : 5061370 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_367 5070083 : 5090345 19 Bacillus_phage(54.55%) transposase,tRNA NA
DBSCAN-SWA_368 5098518 : 5110631 10 Orpheovirus(25.0%) tRNA NA
DBSCAN-SWA_369 5118789 : 5126477 9 uncultured_Caudovirales_phage(16.67%) NA NA
DBSCAN-SWA_370 5134684 : 5136370 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_371 5139928 : 5140243 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_372 5150614 : 5151499 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_373 5159005 : 5159230 1 Caldibacillus_phage(100.0%) NA NA
DBSCAN-SWA_374 5166556 : 5167165 1 Ugandan_cassava_brown_streak_virus(100.0%) NA NA
DBSCAN-SWA_375 5173205 : 5267596 107 Bacillus_phage(47.17%) tRNA,portal,capsid,tail,plate,coat,protease,head,bacteriocin,terminase NA
DBSCAN-SWA_376 5271146 : 5287735 12 uncultured_Mediterranean_phage(33.33%) tRNA NA
DBSCAN-SWA_377 5291622 : 5299458 7 Virus_Rctr197k(50.0%) tRNA NA
DBSCAN-SWA_378 5302656 : 5305541 3 Phage_TP(66.67%) NA NA
DBSCAN-SWA_379 5311574 : 5321246 8 Streptococcus_phage(25.0%) transposase NA
DBSCAN-SWA_380 5328578 : 5331326 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_381 5344100 : 5344814 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_382 5354066 : 5357449 3 Paenibacillus_phage(50.0%) NA NA
DBSCAN-SWA_383 5366020 : 5373887 7 Clostridium_botulinum_C_phage(33.33%) NA NA
DBSCAN-SWA_384 5377440 : 5380596 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_385 5384326 : 5388557 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_386 5396651 : 5408989 12 Helicobacter_phage(16.67%) tRNA NA
DBSCAN-SWA_387 5413322 : 5413934 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_388 5420687 : 5428403 9 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_389 5432232 : 5439164 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_390 5449305 : 5489028 49 Bacillus_phage(65.91%) portal,capsid,tail,protease,head,holin,integrase,terminase attL 5463639:5463654|attR 5485778:5485793
DBSCAN-SWA_391 5492196 : 5498206 4 Prochlorococcus_phage(66.67%) NA NA
DBSCAN-SWA_392 5511586 : 5512249 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_393 5526944 : 5529190 2 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_394 5538687 : 5540390 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_395 5546307 : 5547729 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_396 5553462 : 5566703 15 Paenibacillus_phage(16.67%) NA NA
DBSCAN-SWA_397 5571588 : 5572428 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_398 5577840 : 5579964 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_399 5587433 : 5590748 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_400 5593785 : 5597210 4 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_401 5606872 : 5608672 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_402 5611782 : 5617246 5 Brevibacillus_phage(33.33%) NA NA
DBSCAN-SWA_403 5624858 : 5629214 6 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_404 5637997 : 5642625 7 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_405 5655283 : 5656420 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_406 5670725 : 5671175 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_407 5676945 : 5678046 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_408 5690983 : 5691418 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_409 5706291 : 5709561 4 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_410 5720272 : 5720827 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_411 5725141 : 5726554 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_412 5736897 : 5738928 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_413 5748602 : 5750465 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_414 5754259 : 5755294 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_415 5759290 : 5845886 106 Bacillus_phage(72.88%) tRNA,portal,capsid,tail,protease,head,holin,integrase,terminase attL 5763291:5763309|attR 5837907:5837925
DBSCAN-SWA_416 5851488 : 5852121 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_417 5858816 : 5868922 9 Paramecium_bursaria_Chlorella_virus(20.0%) tRNA NA
DBSCAN-SWA_418 5872111 : 5874085 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_419 5884424 : 5885468 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_018486
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 41 : 54453 58 Bacillus_phage(53.85%) protease,integrase,transposase attL 31480:31496|attR 40460:40476
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_018502
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2132 : 39010 49 Bacillus_phage(87.8%) portal,tail,terminase,integrase,head attL 5827:5843|attR 30133:30149
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_018501
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018501_1 45294-45457 TypeV-U3,TypeI-A? V-U3
2 spacers
c2c10_CAS-V-U3,csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018501_2 45767-45992 TypeV-U3,TypeI-A? NA:V-U3
3 spacers
c2c10_CAS-V-U3,csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_018501_1 1.2|45391|34|NC_018501|CRISPRCasFinder 45391-45424 34 NC_018487.1 39201-39234 2 0.941

1. spacer 1.2|45391|34|NC_018501|CRISPRCasFinder matches to position: 39201-39234, mismatch: 2, identity: 0.941

atatcgctcgtcatgttgctcagtttccgttata	CRISPR spacer
atatcgctcgtcatattgctcattttccgttata	Protospacer
**************.******* ***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018501_1 1.1|45326|33|NC_018501|CRISPRCasFinder 45326-45358 33 NC_018501 Bacillus thuringiensis HD-771 plasmid p02, complete sequence 45326-45358 0 1.0
NC_018501_1 1.2|45391|34|NC_018501|CRISPRCasFinder 45391-45424 34 NZ_CP020003 Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed1, complete sequence 40282-40315 0 1.0
NC_018501_1 1.2|45391|34|NC_018501|CRISPRCasFinder 45391-45424 34 NC_018501 Bacillus thuringiensis HD-771 plasmid p02, complete sequence 45391-45424 0 1.0
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP022446 Bacillus cereus C1L plasmid pC1L1, complete sequence 604885-604919 0 1.0
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NC_018501 Bacillus thuringiensis HD-771 plasmid p02, complete sequence 45799-45833 0 1.0
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NC_018501 Bacillus thuringiensis HD-771 plasmid p02, complete sequence 45797-45843 0 1.0
NC_018501_2 2.3|45864|44|NC_018501|CRT 45864-45907 44 NC_018501 Bacillus thuringiensis HD-771 plasmid p02, complete sequence 45864-45907 0 1.0
NC_018501_2 2.4|45928|45|NC_018501|CRT 45928-45972 45 NC_018501 Bacillus thuringiensis HD-771 plasmid p02, complete sequence 45928-45972 0 1.0
NC_018501_1 1.2|45391|34|NC_018501|CRISPRCasFinder 45391-45424 34 NZ_CP032610 Bacillus thuringiensis strain QZL38 plasmid p.3, complete sequence 7931-7964 1 0.971
NC_018501_1 1.2|45391|34|NC_018501|CRISPRCasFinder 45391-45424 34 NZ_CP032610 Bacillus thuringiensis strain QZL38 plasmid p.3, complete sequence 62135-62168 1 0.971
NC_018501_1 1.2|45391|34|NC_018501|CRISPRCasFinder 45391-45424 34 NZ_CP014286 Bacillus thuringiensis strain Bt185 plasmid pBT1850054, complete sequence 5919-5952 1 0.971
NC_018501_1 1.2|45391|34|NC_018501|CRISPRCasFinder 45391-45424 34 NC_011971 Bacillus cereus Q1 plasmid pBc53, complete sequence 4815-4848 1 0.971
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP034684 Bacillus sp. BD59S plasmid pBTBD59S1, complete sequence 41192-41226 1 0.971
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP020750 Bacillus mycoides strain Gnyt1 plasmid unnamed7, complete sequence 42000-42034 1 0.971
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP009332 Bacillus thuringiensis strain HD1011 plasmid 3, complete sequence 14003-14037 1 0.971
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP016590 Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-02, complete sequence 188396-188430 1 0.971
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP016590 Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-02, complete sequence 36702-36736 1 0.971
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 AP022644 Bacillus wiedmannii PL1 plasmid pBwiPL1-1 DNA, complete sequence 216288-216322 1 0.971
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP053977 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed1, complete sequence 16415-16449 1 0.971
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NC_031055 Bacillus phage PfEFR-5, complete genome 35721-35755 1 0.971
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 KT725776 Bacillus phage vB_BceS-MY192, partial genome 9492-9526 1 0.971
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NC_048641 Bacillus phage PfEFR-4, complete genome 35124-35158 1 0.971
NC_018501_1 1.2|45391|34|NC_018501|CRISPRCasFinder 45391-45424 34 NC_018487 Bacillus thuringiensis HD-771 plasmid p03, complete sequence 39201-39234 2 0.941
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP020744 Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence 290173-290207 2 0.943
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 101704-101738 2 0.943
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP013276 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-1-360K, complete sequence 110790-110824 2 0.943
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP039722 Bacillus thuringiensis strain BT-59 plasmid p1, complete sequence 248128-248162 2 0.943
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP009349 Bacillus thuringiensis HD1002 plasmid 1, complete sequence 186790-186824 2 0.943
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP045023 Bacillus thuringiensis strain JW-1 plasmid p1, complete sequence 110791-110825 2 0.943
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NC_016794 Bacillus cereus F837/76 plasmid pF837_55, complete sequence 6315-6349 3 0.914
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP032612 Bacillus thuringiensis strain QZL38 plasmid p.4, complete sequence 9738-9772 3 0.914
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP032612 Bacillus thuringiensis strain QZL38 plasmid p.4, complete sequence 65108-65142 3 0.914
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP032613 Bacillus thuringiensis strain QZL38 plasmid p.6, complete sequence 4520-4554 3 0.914
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP032613 Bacillus thuringiensis strain QZL38 plasmid p.6, complete sequence 46456-46490 3 0.914
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP009637 Bacillus cereus 03BB108 plasmid pBFI_5, complete sequence 9317-9351 3 0.914
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP009638 Bacillus cereus 03BB108 plasmid pBFI_4, complete sequence 16895-16929 3 0.914
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP014285 Bacillus thuringiensis strain Bt185 plasmid pBT1850055, complete sequence 52066-52100 3 0.914
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP014287 Bacillus thuringiensis strain Bt185 plasmid pBT1850042, complete sequence 16396-16430 3 0.914
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP053964 Bacillus cereus strain FDAARGOS_802 plasmid unnamed4, complete sequence 26368-26402 3 0.914
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 NZ_CP053966 Bacillus cereus strain FDAARGOS_802 plasmid unnamed5, complete sequence 17400-17434 3 0.914
NC_018501_2 2.1|45799|35|NC_018501|CRISPRCasFinder 45799-45833 35 GU233956 Bacillus phage 11143, partial sequence 31404-31438 4 0.886
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP022446 Bacillus cereus C1L plasmid pC1L1, complete sequence 604883-604929 8 0.83
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP016590 Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-02, complete sequence 36700-36746 8 0.83
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NC_031055 Bacillus phage PfEFR-5, complete genome 35719-35765 8 0.83
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 KT725776 Bacillus phage vB_BceS-MY192, partial genome 9490-9536 8 0.83
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NC_048641 Bacillus phage PfEFR-4, complete genome 35122-35168 8 0.83
NC_018501_2 2.3|45864|44|NC_018501|CRT 45864-45907 44 NZ_CP015251 Bacillus thuringiensis Bt18247 plasmid p174778, complete sequence 156429-156472 8 0.818
NC_018501_1 1.2|45391|34|NC_018501|CRISPRCasFinder 45391-45424 34 NC_010848 Flavobacterium sp. KI723T1 plasmid pOAD2 DNA, complete sequence 14199-14232 9 0.735
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 AP022644 Bacillus wiedmannii PL1 plasmid pBwiPL1-1 DNA, complete sequence 216286-216332 9 0.809
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP053977 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed1, complete sequence 16413-16459 9 0.809
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP016590 Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-02, complete sequence 188386-188432 9 0.809
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP034684 Bacillus sp. BD59S plasmid pBTBD59S1, complete sequence 41182-41228 9 0.809
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP020750 Bacillus mycoides strain Gnyt1 plasmid unnamed7, complete sequence 41990-42036 9 0.809
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP009332 Bacillus thuringiensis strain HD1011 plasmid 3, complete sequence 13993-14039 9 0.809
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP020744 Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence 290163-290209 9 0.809
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 101694-101740 9 0.809
NC_018501_2 2.3|45864|44|NC_018501|CRT 45864-45907 44 NZ_CP053937 Bacillus thuringiensis strain FDAARGOS_792 plasmid unnamed, complete sequence 42701-42744 9 0.795
NC_018501_2 2.3|45864|44|NC_018501|CRT 45864-45907 44 NZ_CP018934 Bacillus cereus strain ISSFR-9F plasmid unnamed1, complete sequence 40164-40207 9 0.795
NC_018501_2 2.3|45864|44|NC_018501|CRT 45864-45907 44 NZ_CP010087 Bacillus thuringiensis strain 97-27 plasmid unnamed, complete sequence 27502-27545 9 0.795
NC_018501_2 2.3|45864|44|NC_018501|CRT 45864-45907 44 NC_006578 [Bacillus thuringiensis] serovar konkukian str. 97-27 plasmid pBT9727, complete sequence 67958-68001 9 0.795
NC_018501_2 2.3|45864|44|NC_018501|CRT 45864-45907 44 NZ_CP018936 Bacillus cereus strain JEM-2 plasmid unnamed1, complete sequence 29844-29887 9 0.795
NC_018501_2 2.3|45864|44|NC_018501|CRT 45864-45907 44 NZ_CP018932 Bacillus cereus strain ISSFR-3F plasmid unnamed, complete sequence 20552-20595 9 0.795
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP013276 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-1-360K, complete sequence 110788-110834 10 0.787
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP039722 Bacillus thuringiensis strain BT-59 plasmid p1, complete sequence 248126-248172 10 0.787
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP009349 Bacillus thuringiensis HD1002 plasmid 1, complete sequence 186788-186834 10 0.787
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP045023 Bacillus thuringiensis strain JW-1 plasmid p1, complete sequence 110789-110835 10 0.787
NC_018501_2 2.3|45864|44|NC_018501|CRT 45864-45907 44 NZ_CP019234 Bacillus thuringiensis strain YGd22-03 plasmid pYGD83, complete sequence 55002-55045 10 0.773
NC_018501_2 2.3|45864|44|NC_018501|CRT 45864-45907 44 NZ_CP034684 Bacillus sp. BD59S plasmid pBTBD59S1, complete sequence 132080-132123 10 0.773
NC_018501_2 2.3|45864|44|NC_018501|CRT 45864-45907 44 CP024687 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence 53003-53046 10 0.773
NC_018501_2 2.3|45864|44|NC_018501|CRT 45864-45907 44 NC_018686 Bacillus thuringiensis MC28 plasmid pMC183, complete sequence 41520-41563 10 0.773
NC_018501_2 2.3|45864|44|NC_018501|CRT 45864-45907 44 NC_018686 Bacillus thuringiensis MC28 plasmid pMC183, complete sequence 129513-129556 10 0.773
NC_018501_2 2.3|45864|44|NC_018501|CRT 45864-45907 44 NZ_CP053978 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed2, complete sequence 8812-8855 10 0.773
NC_018501_2 2.3|45864|44|NC_018501|CRT 45864-45907 44 NZ_CP009333 Bacillus thuringiensis strain HD1011 plasmid 4, complete sequence 22717-22760 10 0.773
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP014285 Bacillus thuringiensis strain Bt185 plasmid pBT1850055, complete sequence 52064-52110 11 0.766
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP014287 Bacillus thuringiensis strain Bt185 plasmid pBT1850042, complete sequence 16394-16440 11 0.766
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP032612 Bacillus thuringiensis strain QZL38 plasmid p.4, complete sequence 9728-9774 11 0.766
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP032612 Bacillus thuringiensis strain QZL38 plasmid p.4, complete sequence 65098-65144 11 0.766
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP032613 Bacillus thuringiensis strain QZL38 plasmid p.6, complete sequence 4510-4556 11 0.766
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP032613 Bacillus thuringiensis strain QZL38 plasmid p.6, complete sequence 46446-46492 11 0.766
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP053964 Bacillus cereus strain FDAARGOS_802 plasmid unnamed4, complete sequence 26366-26412 11 0.766
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP053966 Bacillus cereus strain FDAARGOS_802 plasmid unnamed5, complete sequence 17398-17444 11 0.766
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NC_016794 Bacillus cereus F837/76 plasmid pF837_55, complete sequence 6305-6351 11 0.766
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP009637 Bacillus cereus 03BB108 plasmid pBFI_5, complete sequence 9307-9353 11 0.766
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 NZ_CP009638 Bacillus cereus 03BB108 plasmid pBFI_4, complete sequence 16885-16931 11 0.766
NC_018501_2 2.2|45797|47|NC_018501|CRT 45797-45843 47 GU233956 Bacillus phage 11143, partial sequence 31402-31448 12 0.745

1. spacer 1.1|45326|33|NC_018501|CRISPRCasFinder matches to NC_018501 (Bacillus thuringiensis HD-771 plasmid p02, complete sequence) position: , mismatch: 0, identity: 1.0

tatagtatcaacggcatccttaattccttttgt	CRISPR spacer
tatagtatcaacggcatccttaattccttttgt	Protospacer
*********************************

2. spacer 1.2|45391|34|NC_018501|CRISPRCasFinder matches to NZ_CP020003 (Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

atatcgctcgtcatgttgctcagtttccgttata	CRISPR spacer
atatcgctcgtcatgttgctcagtttccgttata	Protospacer
**********************************

3. spacer 1.2|45391|34|NC_018501|CRISPRCasFinder matches to NC_018501 (Bacillus thuringiensis HD-771 plasmid p02, complete sequence) position: , mismatch: 0, identity: 1.0

atatcgctcgtcatgttgctcagtttccgttata	CRISPR spacer
atatcgctcgtcatgttgctcagtttccgttata	Protospacer
**********************************

4. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP022446 (Bacillus cereus C1L plasmid pC1L1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtggtaacagctcattttgtt	Protospacer
***********************************

5. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NC_018501 (Bacillus thuringiensis HD-771 plasmid p02, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtggtaacagctcattttgtt	Protospacer
***********************************

6. spacer 2.2|45797|47|NC_018501|CRT matches to NC_018501 (Bacillus thuringiensis HD-771 plasmid p02, complete sequence) position: , mismatch: 0, identity: 1.0

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	Protospacer
***********************************************

7. spacer 2.3|45864|44|NC_018501|CRT matches to NC_018501 (Bacillus thuringiensis HD-771 plasmid p02, complete sequence) position: , mismatch: 0, identity: 1.0

aatcacttgttataactgtctcttcatacaaatagtttaaacat	CRISPR spacer
aatcacttgttataactgtctcttcatacaaatagtttaaacat	Protospacer
********************************************

8. spacer 2.4|45928|45|NC_018501|CRT matches to NC_018501 (Bacillus thuringiensis HD-771 plasmid p02, complete sequence) position: , mismatch: 0, identity: 1.0

tcttacgccaagtcgatagaccgaaaagcagggttgtttaaacca	CRISPR spacer
tcttacgccaagtcgatagaccgaaaagcagggttgtttaaacca	Protospacer
*********************************************

9. spacer 1.2|45391|34|NC_018501|CRISPRCasFinder matches to NZ_CP032610 (Bacillus thuringiensis strain QZL38 plasmid p.3, complete sequence) position: , mismatch: 1, identity: 0.971

atatcgctcgtcatgttgctcagtttccgttata	CRISPR spacer
atatcgctcgtcatgttgctctgtttccgttata	Protospacer
********************* ************

10. spacer 1.2|45391|34|NC_018501|CRISPRCasFinder matches to NZ_CP032610 (Bacillus thuringiensis strain QZL38 plasmid p.3, complete sequence) position: , mismatch: 1, identity: 0.971

atatcgctcgtcatgttgctcagtttccgttata	CRISPR spacer
atatcgctcgtcatgttgctctgtttccgttata	Protospacer
********************* ************

11. spacer 1.2|45391|34|NC_018501|CRISPRCasFinder matches to NZ_CP014286 (Bacillus thuringiensis strain Bt185 plasmid pBT1850054, complete sequence) position: , mismatch: 1, identity: 0.971

atatcgctcgtcatgttgctcagtttccgttata	CRISPR spacer
atatcgctcgtcatgttgctctgtttccgttata	Protospacer
********************* ************

12. spacer 1.2|45391|34|NC_018501|CRISPRCasFinder matches to NC_011971 (Bacillus cereus Q1 plasmid pBc53, complete sequence) position: , mismatch: 1, identity: 0.971

atatcgctcgtcatgttgctcagtttccgttata	CRISPR spacer
ataacgctcgtcatgttgctcagtttccgttata	Protospacer
*** ******************************

13. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP034684 (Bacillus sp. BD59S plasmid pBTBD59S1, complete sequence) position: , mismatch: 1, identity: 0.971

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtggaaacagctcattttgtt	Protospacer
****************** ****************

14. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP020750 (Bacillus mycoides strain Gnyt1 plasmid unnamed7, complete sequence) position: , mismatch: 1, identity: 0.971

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtggtaacagctcactttgtt	Protospacer
****************************.******

15. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP009332 (Bacillus thuringiensis strain HD1011 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.971

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtggaaacagctcattttgtt	Protospacer
****************** ****************

16. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP016590 (Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-02, complete sequence) position: , mismatch: 1, identity: 0.971

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtagtaacagctcattttgtt	Protospacer
****************.******************

17. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP016590 (Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-02, complete sequence) position: , mismatch: 1, identity: 0.971

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtagtaacagctcattttgtt	Protospacer
****************.******************

18. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to AP022644 (Bacillus wiedmannii PL1 plasmid pBwiPL1-1 DNA, complete sequence) position: , mismatch: 1, identity: 0.971

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtagtaacagctcattttgtt	Protospacer
****************.******************

19. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP053977 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtggaaacagctcattttgtt	Protospacer
****************** ****************

20. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NC_031055 (Bacillus phage PfEFR-5, complete genome) position: , mismatch: 1, identity: 0.971

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtggtaacagctcatttcgtt	Protospacer
*******************************.***

21. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to KT725776 (Bacillus phage vB_BceS-MY192, partial genome) position: , mismatch: 1, identity: 0.971

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtggtaacagctcatttcgtt	Protospacer
*******************************.***

22. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NC_048641 (Bacillus phage PfEFR-4, complete genome) position: , mismatch: 1, identity: 0.971

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtggtaacagctcatttcgtt	Protospacer
*******************************.***

23. spacer 1.2|45391|34|NC_018501|CRISPRCasFinder matches to NC_018487 (Bacillus thuringiensis HD-771 plasmid p03, complete sequence) position: , mismatch: 2, identity: 0.941

atatcgctcgtcatgttgctcagtttccgttata	CRISPR spacer
atatcgctcgtcatattgctcattttccgttata	Protospacer
**************.******* ***********

24. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP020744 (Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.943

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtggaaacagctaattttgtt	Protospacer
****************** ******* ********

25. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.943

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtggaaacagctaattttgtt	Protospacer
****************** ******* ********

26. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP013276 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-1-360K, complete sequence) position: , mismatch: 2, identity: 0.943

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgtcagtagtaacagctcattttgtt	Protospacer
***********.****.******************

27. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP039722 (Bacillus thuringiensis strain BT-59 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.943

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgtcagtagtaacagctcattttgtt	Protospacer
***********.****.******************

28. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP009349 (Bacillus thuringiensis HD1002 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.943

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgtcagtagtaacagctcattttgtt	Protospacer
***********.****.******************

29. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP045023 (Bacillus thuringiensis strain JW-1 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.943

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgtcagtagtaacagctcattttgtt	Protospacer
***********.****.******************

30. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NC_016794 (Bacillus cereus F837/76 plasmid pF837_55, complete sequence) position: , mismatch: 3, identity: 0.914

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtgataacagctcattttgaa	Protospacer
*****************.***************  

31. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP032612 (Bacillus thuringiensis strain QZL38 plasmid p.4, complete sequence) position: , mismatch: 3, identity: 0.914

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtagtaacagctcattttgaa	Protospacer
****************.****************  

32. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP032612 (Bacillus thuringiensis strain QZL38 plasmid p.4, complete sequence) position: , mismatch: 3, identity: 0.914

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtagtaacagctcattttgaa	Protospacer
****************.****************  

33. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP032613 (Bacillus thuringiensis strain QZL38 plasmid p.6, complete sequence) position: , mismatch: 3, identity: 0.914

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtagtaacagctcattttgaa	Protospacer
****************.****************  

34. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP032613 (Bacillus thuringiensis strain QZL38 plasmid p.6, complete sequence) position: , mismatch: 3, identity: 0.914

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtagtaacagctcattttgaa	Protospacer
****************.****************  

35. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP009637 (Bacillus cereus 03BB108 plasmid pBFI_5, complete sequence) position: , mismatch: 3, identity: 0.914

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtgataacagctcattttgaa	Protospacer
*****************.***************  

36. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP009638 (Bacillus cereus 03BB108 plasmid pBFI_4, complete sequence) position: , mismatch: 3, identity: 0.914

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtgataacagctcattttgaa	Protospacer
*****************.***************  

37. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP014285 (Bacillus thuringiensis strain Bt185 plasmid pBT1850055, complete sequence) position: , mismatch: 3, identity: 0.914

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtagtaacagctcattttgaa	Protospacer
****************.****************  

38. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP014287 (Bacillus thuringiensis strain Bt185 plasmid pBT1850042, complete sequence) position: , mismatch: 3, identity: 0.914

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtagtaacagctcattttgaa	Protospacer
****************.****************  

39. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP053964 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.914

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtgataacagctcattttgaa	Protospacer
*****************.***************  

40. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to NZ_CP053966 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.914

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcgccagtgataacagctcattttgaa	Protospacer
*****************.***************  

41. spacer 2.1|45799|35|NC_018501|CRISPRCasFinder matches to GU233956 (Bacillus phage 11143, partial sequence) position: , mismatch: 4, identity: 0.886

gcgtcatagcgccagtggtaacagctcattttgtt	CRISPR spacer
gcgtcatagcaccagtagtaacagctcattttgaa	Protospacer
**********.*****.****************  

42. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP022446 (Bacillus cereus C1L plasmid pC1L1, complete sequence) position: , mismatch: 8, identity: 0.83

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgccagtggtaacagctcattttgttgaggtggacg	Protospacer
**************************************    .. *.

43. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP016590 (Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-02, complete sequence) position: , mismatch: 8, identity: 0.83

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgccagtagtaacagctcattttgttgaggtggaca	Protospacer
******************.*******************    .. **

44. spacer 2.2|45797|47|NC_018501|CRT matches to NC_031055 (Bacillus phage PfEFR-5, complete genome) position: , mismatch: 8, identity: 0.83

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca---	CRISPR spacer
aggcgtcatagcgccagtggtaacagctcatttcgttg---aagtggaag	Protospacer
*********************************.****   **.. .   

45. spacer 2.2|45797|47|NC_018501|CRT matches to KT725776 (Bacillus phage vB_BceS-MY192, partial genome) position: , mismatch: 8, identity: 0.83

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca---	CRISPR spacer
aggcgtcatagcgccagtggtaacagctcatttcgttg---aagtggaag	Protospacer
*********************************.****   **.. .   

46. spacer 2.2|45797|47|NC_018501|CRT matches to NC_048641 (Bacillus phage PfEFR-4, complete genome) position: , mismatch: 8, identity: 0.83

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca---	CRISPR spacer
aggcgtcatagcgccagtggtaacagctcatttcgttg---aagtggaag	Protospacer
*********************************.****   **.. .   

47. spacer 2.3|45864|44|NC_018501|CRT matches to NZ_CP015251 (Bacillus thuringiensis Bt18247 plasmid p174778, complete sequence) position: , mismatch: 8, identity: 0.818

aatcacttgttataactgtctcttcatacaaatagtttaaacat	CRISPR spacer
aatcacttgttataactgtctcttcatacatatagggcgaatga	Protospacer
****************************** ****  ..**.. 

48. spacer 1.2|45391|34|NC_018501|CRISPRCasFinder matches to NC_010848 (Flavobacterium sp. KI723T1 plasmid pOAD2 DNA, complete sequence) position: , mismatch: 9, identity: 0.735

atatcgctcgtcatgttgctcagtttccgttata	CRISPR spacer
gtgtcgctcgtcttgttgatcagtttcagatccg	Protospacer
.*.********* ***** ******** * * ..

49. spacer 2.2|45797|47|NC_018501|CRT matches to AP022644 (Bacillus wiedmannii PL1 plasmid pBwiPL1-1 DNA, complete sequence) position: , mismatch: 9, identity: 0.809

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgccagtagtaacagctcattttgttgaggtggacg	Protospacer
******************.*******************    .. *.

50. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP053977 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.809

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgccagtggaaacagctcattttgttgaggtggacg	Protospacer
******************** *****************    .. *.

51. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP016590 (Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-02, complete sequence) position: , mismatch: 9, identity: 0.809

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgccagtagtaacagctcattttgttgaggtggacg	Protospacer
******************.*******************    .. *.

52. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP034684 (Bacillus sp. BD59S plasmid pBTBD59S1, complete sequence) position: , mismatch: 9, identity: 0.809

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgccagtggaaacagctcattttgttgaggtggacg	Protospacer
******************** *****************    .. *.

53. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP020750 (Bacillus mycoides strain Gnyt1 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.809

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgccagtggtaacagctcactttgttgaggtggacg	Protospacer
******************************.*******    .. *.

54. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP009332 (Bacillus thuringiensis strain HD1011 plasmid 3, complete sequence) position: , mismatch: 9, identity: 0.809

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgccagtggaaacagctcattttgttgaggtggacg	Protospacer
******************** *****************    .. *.

55. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP020744 (Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.809

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgccagtggaaacagctaattttgttgaggtagacg	Protospacer
******************** ******* *********    *. *.

56. spacer 2.2|45797|47|NC_018501|CRT matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.809

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgccagtggaaacagctaattttgttgaggtagacg	Protospacer
******************** ******* *********    *. *.

57. spacer 2.3|45864|44|NC_018501|CRT matches to NZ_CP053937 (Bacillus thuringiensis strain FDAARGOS_792 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.795

aatcacttgttataactgtctcttcatacaaatagtttaaacat	CRISPR spacer
aatcacttgttataactgtctcttcatacatataaggcgaatgg	Protospacer
****************************** ***.  ..**.. 

58. spacer 2.3|45864|44|NC_018501|CRT matches to NZ_CP018934 (Bacillus cereus strain ISSFR-9F plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.795

aatcacttgttataactgtctcttcatacaaatagtttaaacat	CRISPR spacer
aatcacttgttataactgtctcttcatacatataaggcgaatgg	Protospacer
****************************** ***.  ..**.. 

59. spacer 2.3|45864|44|NC_018501|CRT matches to NZ_CP010087 (Bacillus thuringiensis strain 97-27 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.795

aatcacttgttataactgtctcttcatacaaatagtttaaacat	CRISPR spacer
aatcacttgttataactgtctcttcatacatataaggcgaatgg	Protospacer
****************************** ***.  ..**.. 

60. spacer 2.3|45864|44|NC_018501|CRT matches to NC_006578 ([Bacillus thuringiensis] serovar konkukian str. 97-27 plasmid pBT9727, complete sequence) position: , mismatch: 9, identity: 0.795

aatcacttgttataactgtctcttcatacaaatagtttaaacat	CRISPR spacer
aatcacttgttataactgtctcttcatacatataaggcgaatgg	Protospacer
****************************** ***.  ..**.. 

61. spacer 2.3|45864|44|NC_018501|CRT matches to NZ_CP018936 (Bacillus cereus strain JEM-2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.795

aatcacttgttataactgtctcttcatacaaatagtttaaacat	CRISPR spacer
aatcacttgttataactgtctcttcatacatataaggcgaatgg	Protospacer
****************************** ***.  ..**.. 

62. spacer 2.3|45864|44|NC_018501|CRT matches to NZ_CP018932 (Bacillus cereus strain ISSFR-3F plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.795

aatcacttgttataactgtctcttcatacaaatagtttaaacat	CRISPR spacer
aatcacttgttataactgtctcttcatacatataaggcgaatgg	Protospacer
****************************** ***.  ..**.. 

63. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP013276 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-1-360K, complete sequence) position: , mismatch: 10, identity: 0.787

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgtcagtagtaacagctcattttgttgaggtggacg	Protospacer
*************.****.*******************    .. *.

64. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP039722 (Bacillus thuringiensis strain BT-59 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.787

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgtcagtagtaacagctcattttgttgaggtggacg	Protospacer
*************.****.*******************    .. *.

65. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP009349 (Bacillus thuringiensis HD1002 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.787

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgtcagtagtaacagctcattttgttgaggtggacg	Protospacer
*************.****.*******************    .. *.

66. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP045023 (Bacillus thuringiensis strain JW-1 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.787

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgtcagtagtaacagctcattttgttgaggtggacg	Protospacer
*************.****.*******************    .. *.

67. spacer 2.3|45864|44|NC_018501|CRT matches to NZ_CP019234 (Bacillus thuringiensis strain YGd22-03 plasmid pYGD83, complete sequence) position: , mismatch: 10, identity: 0.773

aatcacttgttataactgtctcttcatacaaatagtttaaacat	CRISPR spacer
aatcacttgttataactgtctcttcatacatataaggctcatga	Protospacer
****************************** ***.  .  *.. 

68. spacer 2.3|45864|44|NC_018501|CRT matches to NZ_CP034684 (Bacillus sp. BD59S plasmid pBTBD59S1, complete sequence) position: , mismatch: 10, identity: 0.773

aatcacttgttataactgtctcttcatacaaatagtttaaacat	CRISPR spacer
aatcgcttgttataactgtctcttcatacatataaggcgaatgg	Protospacer
****.************************* ***.  ..**.. 

69. spacer 2.3|45864|44|NC_018501|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 10, identity: 0.773

aatcacttgttataactgtctcttcatacaaatagtttaaacat	CRISPR spacer
aatcacttgttattactgtctcttcatacatataaggcgaatgg	Protospacer
************* **************** ***.  ..**.. 

70. spacer 2.3|45864|44|NC_018501|CRT matches to NC_018686 (Bacillus thuringiensis MC28 plasmid pMC183, complete sequence) position: , mismatch: 10, identity: 0.773

aatcacttgttataactgtctcttcatacaaatagtttaaacat	CRISPR spacer
aatcacttgttataactgtttcttcatacatataaggcgaatgg	Protospacer
*******************.********** ***.  ..**.. 

71. spacer 2.3|45864|44|NC_018501|CRT matches to NC_018686 (Bacillus thuringiensis MC28 plasmid pMC183, complete sequence) position: , mismatch: 10, identity: 0.773

aatcacttgttataactgtctcttcatacaaatagtttaaacat	CRISPR spacer
aatcacttgttataactgtttcttcatacatataaggcgaatgg	Protospacer
*******************.********** ***.  ..**.. 

72. spacer 2.3|45864|44|NC_018501|CRT matches to NZ_CP053978 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.773

aatcacttgttataactgtctcttcatacaaatagtttaaacat	CRISPR spacer
aatcacttgttataactgtctcttcgtacatataaggcgaatgg	Protospacer
*************************.**** ***.  ..**.. 

73. spacer 2.3|45864|44|NC_018501|CRT matches to NZ_CP009333 (Bacillus thuringiensis strain HD1011 plasmid 4, complete sequence) position: , mismatch: 10, identity: 0.773

aatcacttgttataactgtctcttcatacaaatagtttaaacat	CRISPR spacer
aatcacttgttataactgtctcttcgtacatataaggcgaatgg	Protospacer
*************************.**** ***.  ..**.. 

74. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP014285 (Bacillus thuringiensis strain Bt185 plasmid pBT1850055, complete sequence) position: , mismatch: 11, identity: 0.766

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgccagtagtaacagctcattttgaagaagtggacg	Protospacer
******************.****************  *    .. *.

75. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP014287 (Bacillus thuringiensis strain Bt185 plasmid pBT1850042, complete sequence) position: , mismatch: 11, identity: 0.766

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgccagtagtaacagctcattttgaagaagtggacg	Protospacer
******************.****************  *    .. *.

76. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP032612 (Bacillus thuringiensis strain QZL38 plasmid p.4, complete sequence) position: , mismatch: 11, identity: 0.766

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgccagtagtaacagctcattttgaagaagtggacg	Protospacer
******************.****************  *    .. *.

77. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP032612 (Bacillus thuringiensis strain QZL38 plasmid p.4, complete sequence) position: , mismatch: 11, identity: 0.766

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgccagtagtaacagctcattttgaagaagtggacg	Protospacer
******************.****************  *    .. *.

78. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP032613 (Bacillus thuringiensis strain QZL38 plasmid p.6, complete sequence) position: , mismatch: 11, identity: 0.766

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgccagtagtaacagctcattttgaagaagtggacg	Protospacer
******************.****************  *    .. *.

79. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP032613 (Bacillus thuringiensis strain QZL38 plasmid p.6, complete sequence) position: , mismatch: 11, identity: 0.766

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcgccagtagtaacagctcattttgaagaagtggacg	Protospacer
******************.****************  *    .. *.

80. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP053964 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed4, complete sequence) position: , mismatch: 11, identity: 0.766

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
gggcgtcatagcgccagtgataacagctcattttgaagaagtagacg	Protospacer
.******************.***************  *    *. *.

81. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP053966 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed5, complete sequence) position: , mismatch: 11, identity: 0.766

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
gggcgtcatagcgccagtgataacagctcattttgaagaagtagacg	Protospacer
.******************.***************  *    *. *.

82. spacer 2.2|45797|47|NC_018501|CRT matches to NC_016794 (Bacillus cereus F837/76 plasmid pF837_55, complete sequence) position: , mismatch: 11, identity: 0.766

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
gggcgtcatagcgccagtgataacagctcattttgaagaagtagacg	Protospacer
.******************.***************  *    *. *.

83. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP009637 (Bacillus cereus 03BB108 plasmid pBFI_5, complete sequence) position: , mismatch: 11, identity: 0.766

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
gggcgtcatagcgccagtgataacagctcattttgaagaagtagacg	Protospacer
.******************.***************  *    *. *.

84. spacer 2.2|45797|47|NC_018501|CRT matches to NZ_CP009638 (Bacillus cereus 03BB108 plasmid pBFI_4, complete sequence) position: , mismatch: 11, identity: 0.766

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
gggcgtcatagcgccagtgataacagctcattttgaagaagtagacg	Protospacer
.******************.***************  *    *. *.

85. spacer 2.2|45797|47|NC_018501|CRT matches to GU233956 (Bacillus phage 11143, partial sequence) position: , mismatch: 12, identity: 0.745

aggcgtcatagcgccagtggtaacagctcattttgttgtttaaacca	CRISPR spacer
aggcgtcatagcaccagtagtaacagctcattttgaagaagtggacg	Protospacer
************.*****.****************  *    .. *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 99717 : 108462 7 Bacillus_phage(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NC_018503
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018503_1 5477-5674 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_018503_1 1.2|5555|18|NC_018503|CRT 5555-5572 18 NC_018503.1 5459-5476 1 0.944
NC_018503_1 1.4|5639|18|NC_018503|CRT 5639-5656 18 NC_018503.1 5663-5680 1 0.944
NC_018503_1 1.1|5495|42|NC_018503|CRT 5495-5536 42 NC_018503.1 5459-5500 2 0.952
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_018503.1 5459-5488 2 0.933

1. spacer 1.2|5555|18|NC_018503|CRT matches to position: 5459-5476, mismatch: 1, identity: 0.944

gactaagccagaaactaa	CRISPR spacer
gactaaaccagaaactaa	Protospacer
******.***********

2. spacer 1.4|5639|18|NC_018503|CRT matches to position: 5663-5680, mismatch: 1, identity: 0.944

aactaagccagaaactaa	CRISPR spacer
aactaaaccagaaactaa	Protospacer
******.***********

3. spacer 1.1|5495|42|NC_018503|CRT matches to position: 5459-5500, mismatch: 2, identity: 0.952

gactaaaccagagactaaaccagagactaaaccagaaactaa	CRISPR spacer
gactaaaccagaaactaaaccagagactaaaccagagactaa	Protospacer
************.***********************.*****

4. spacer 1.3|5591|30|NC_018503|CRT matches to position: 5459-5488, mismatch: 2, identity: 0.933

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
gactaaaccagaaactaaaccagagactaa	Protospacer
******************.*****.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018503_1 1.1|5495|42|NC_018503|CRT 5495-5536 42 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5495-5536 0 1.0
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5591-5620 0 1.0
NC_018503_1 1.1|5495|42|NC_018503|CRT 5495-5536 42 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5483-5524 1 0.976
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5627-5656 1 0.967
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5543-5572 1 0.967
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5555-5584 1 0.967
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP032411 Brevibacillus laterosporus strain E7593-50 plasmid pAZOBL1, complete sequence 82289-82318 1 0.967
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP032411 Brevibacillus laterosporus strain E7593-50 plasmid pAZOBL1, complete sequence 82601-82630 1 0.967
NC_018503_1 1.1|5495|42|NC_018503|CRT 5495-5536 42 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5471-5512 2 0.952
NC_018503_1 1.1|5495|42|NC_018503|CRT 5495-5536 42 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5531-5572 2 0.952
NC_018503_1 1.1|5495|42|NC_018503|CRT 5495-5536 42 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5459-5500 2 0.952
NC_018503_1 1.1|5495|42|NC_018503|CRT 5495-5536 42 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5507-5548 2 0.952
NC_018503_1 1.1|5495|42|NC_018503|CRT 5495-5536 42 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5519-5560 2 0.952
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5603-5632 2 0.933
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5639-5668 2 0.933
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5459-5488 2 0.933
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5507-5536 2 0.933
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5519-5548 2 0.933
NC_018503_1 1.1|5495|42|NC_018503|CRT 5495-5536 42 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5567-5608 3 0.929
NC_018503_1 1.1|5495|42|NC_018503|CRT 5495-5536 42 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5579-5620 3 0.929
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5579-5608 3 0.9
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5615-5644 3 0.9
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5651-5680 3 0.9
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP032411 Brevibacillus laterosporus strain E7593-50 plasmid pAZOBL1, complete sequence 82373-82402 3 0.9
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP032411 Brevibacillus laterosporus strain E7593-50 plasmid pAZOBL1, complete sequence 82397-82426 3 0.9
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP032411 Brevibacillus laterosporus strain E7593-50 plasmid pAZOBL1, complete sequence 82421-82450 3 0.9
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP032411 Brevibacillus laterosporus strain E7593-50 plasmid pAZOBL1, complete sequence 82445-82474 3 0.9
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP032411 Brevibacillus laterosporus strain E7593-50 plasmid pAZOBL1, complete sequence 82265-82294 4 0.867
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP013278 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence 97567-97596 5 0.833
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_018509 Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence 91451-91480 5 0.833
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP051859 Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence 204095-204124 5 0.833
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP009347 Bacillus thuringiensis HD1002 plasmid 3, complete sequence 7426-7455 5 0.833
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP045025 Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence 97567-97596 5 0.833
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP053971 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence 213304-213333 5 0.833
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP039724 Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence 35738-35767 5 0.833
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 MT774411 CrAssphage cr273_1, complete genome 71907-71936 6 0.8
NC_018503_1 1.1|5495|42|NC_018503|CRT 5495-5536 42 NZ_CP032411 Brevibacillus laterosporus strain E7593-50 plasmid pAZOBL1, complete sequence 82661-82702 7 0.833
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5663-5692 7 0.767
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP008847 Bacillus anthracis strain HYU01 plasmid pX01, complete sequence 68454-68483 7 0.767
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP029806 Bacillus anthracis strain London_499 plasmid pX01, complete sequence 67354-67383 7 0.767
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_047926 Lactobacillus phage Semele, complete genome 8765-8794 7 0.767
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP004872 Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB64, complete sequence 17182-17211 7 0.767
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_017205 Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT72, complete sequence 24544-24573 7 0.767
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP015156 Bacillus thuringiensis strain Bc601 plasmid pBTBC6, complete sequence 23798-23827 7 0.767
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP004869 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB67, complete sequence 54796-54825 7 0.767
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 CP020758 Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-19, complete sequence 54972-55001 7 0.767
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP010093 Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB71, complete sequence 16477-16506 7 0.767
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP021065 Bacillus thuringiensis strain ATCC 10792 plasmid poh4, complete sequence 80447-80476 7 0.767
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP011358 Bacillus thuringiensis strain YC-10 plasmid pYC2226, complete sequence 78140-78169 7 0.767
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_018879 Bacillus thuringiensis Bt407 plasmid BTB_78p, complete sequence 37265-37294 7 0.767
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP013057 Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-2, complete sequence 77317-77346 7 0.767
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NC_020382 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-68, complete sequence 43001-43030 7 0.767
NC_018503_1 1.1|5495|42|NC_018503|CRT 5495-5536 42 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5447-5488 8 0.81
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP024775 Bacillus thuringiensis LM1212 plasmid pLM4, complete sequence 16981-17010 8 0.733
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP041077 Bacillus tropicus strain LM1212-W3 plasmid p4, complete sequence 30290-30319 8 0.733
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_AP014826 Geminocystis sp. NIES-3709 plasmid pGM3709_05, complete sequence 18432-18461 8 0.733
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP044180 Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-3, complete sequence 54049-54078 9 0.7
NC_018503_1 1.3|5591|30|NC_018503|CRT 5591-5620 30 NZ_CP030187 Salmonella enterica strain SA20094620 plasmid pSA20094620.2, complete sequence 7153-7182 9 0.7

1. spacer 1.1|5495|42|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 0, identity: 1.0

gactaaaccagagactaaaccagagactaaaccagaaactaa	CRISPR spacer
gactaaaccagagactaaaccagagactaaaccagaaactaa	Protospacer
******************************************

2. spacer 1.3|5591|30|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 0, identity: 1.0

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
gactaaaccagaaactaagccagaaactaa	Protospacer
******************************

3. spacer 1.1|5495|42|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 1, identity: 0.976

gactaaaccagagactaaaccagagactaaaccagaaactaa	CRISPR spacer
gactaaaccagagactaaaccagagactaaaccagagactaa	Protospacer
************************************.*****

4. spacer 1.3|5591|30|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 1, identity: 0.967

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
aactaaaccagaaactaagccagaaactaa	Protospacer
.*****************************

5. spacer 1.3|5591|30|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 1, identity: 0.967

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
gactaaaccagagactaagccagaaactaa	Protospacer
************.*****************

6. spacer 1.3|5591|30|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 1, identity: 0.967

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
gactaagccagaaactaagccagaaactaa	Protospacer
******.***********************

7. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP032411 (Brevibacillus laterosporus strain E7593-50 plasmid pAZOBL1, complete sequence) position: , mismatch: 1, identity: 0.967

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
gcctaaaccagaaactaagccagaaactaa	Protospacer
* ****************************

8. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP032411 (Brevibacillus laterosporus strain E7593-50 plasmid pAZOBL1, complete sequence) position: , mismatch: 1, identity: 0.967

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
gcctaaaccagaaactaagccagaaactaa	Protospacer
* ****************************

9. spacer 1.1|5495|42|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 2, identity: 0.952

gactaaaccagagactaaaccagagactaaaccagaaactaa	CRISPR spacer
aactaaaccagagactaaaccagagactaaaccagagactaa	Protospacer
.***********************************.*****

10. spacer 1.1|5495|42|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 2, identity: 0.952

gactaaaccagagactaaaccagagactaaaccagaaactaa	CRISPR spacer
aactaaaccagagactaaaccagagactaagccagaaactaa	Protospacer
.*****************************.***********

11. spacer 1.1|5495|42|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 2, identity: 0.952

gactaaaccagagactaaaccagagactaaaccagaaactaa	CRISPR spacer
gactaaaccagaaactaaaccagagactaaaccagagactaa	Protospacer
************.***********************.*****

12. spacer 1.1|5495|42|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 2, identity: 0.952

gactaaaccagagactaaaccagagactaaaccagaaactaa	CRISPR spacer
gactaaaccagagactaaaccagaaactaaaccagagactaa	Protospacer
************************.***********.*****

13. spacer 1.1|5495|42|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 2, identity: 0.952

gactaaaccagagactaaaccagagactaaaccagaaactaa	CRISPR spacer
gactaaaccagaaactaaaccagagactaaaccagagactaa	Protospacer
************.***********************.*****

14. spacer 1.3|5591|30|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 2, identity: 0.933

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
aactaagccagaaactaagccagaaactaa	Protospacer
.*****.***********************

15. spacer 1.3|5591|30|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 2, identity: 0.933

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
aactaagccagaaactaagccagaaactaa	Protospacer
.*****.***********************

16. spacer 1.3|5591|30|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 2, identity: 0.933

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
gactaaaccagaaactaaaccagagactaa	Protospacer
******************.*****.*****

17. spacer 1.3|5591|30|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 2, identity: 0.933

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
gactaaaccagagactaaaccagaaactaa	Protospacer
************.*****.***********

18. spacer 1.3|5591|30|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 2, identity: 0.933

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
gactaaaccagaaactaaaccagagactaa	Protospacer
******************.*****.*****

19. spacer 1.1|5495|42|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 3, identity: 0.929

gactaaaccagagactaaaccagagactaaaccagaaactaa	CRISPR spacer
aactaagccagaaactaaaccagagactaaaccagaaactaa	Protospacer
.*****.*****.*****************************

20. spacer 1.1|5495|42|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 3, identity: 0.929

gactaaaccagagactaaaccagagactaaaccagaaactaa	CRISPR spacer
aactaaaccagagactaaaccagaaactaagccagaaactaa	Protospacer
.***********************.*****.***********

21. spacer 1.3|5591|30|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 3, identity: 0.9

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
aactaaaccagagactaaaccagaaactaa	Protospacer
.***********.*****.***********

22. spacer 1.3|5591|30|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 3, identity: 0.9

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
aactaagccagaaactaaaccagaaactaa	Protospacer
.*****.***********.***********

23. spacer 1.3|5591|30|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 3, identity: 0.9

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
aactaagccagaaactaaaccagaaactaa	Protospacer
.*****.***********.***********

24. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP032411 (Brevibacillus laterosporus strain E7593-50 plasmid pAZOBL1, complete sequence) position: , mismatch: 3, identity: 0.9

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
gcctaaaccagaaactaagccagagcctaa	Protospacer
* **********************. ****

25. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP032411 (Brevibacillus laterosporus strain E7593-50 plasmid pAZOBL1, complete sequence) position: , mismatch: 3, identity: 0.9

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
gcctaaaccagaaactaagccagagcctaa	Protospacer
* **********************. ****

26. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP032411 (Brevibacillus laterosporus strain E7593-50 plasmid pAZOBL1, complete sequence) position: , mismatch: 3, identity: 0.9

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
gcctaaaccagaaactaagccagagcctaa	Protospacer
* **********************. ****

27. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP032411 (Brevibacillus laterosporus strain E7593-50 plasmid pAZOBL1, complete sequence) position: , mismatch: 3, identity: 0.9

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
gcctaaaccagaaactaagccagagcctaa	Protospacer
* **********************. ****

28. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP032411 (Brevibacillus laterosporus strain E7593-50 plasmid pAZOBL1, complete sequence) position: , mismatch: 4, identity: 0.867

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
tcctaaaccagaaactaagccagagcctaa	Protospacer
  **********************. ****

29. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP013278 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence) position: , mismatch: 5, identity: 0.833

gactaaacc---agaaactaagccagaaactaa	CRISPR spacer
---taaagcaaaagaaactaagccagaagctaa	Protospacer
   **** *   ****************.****

30. spacer 1.3|5591|30|NC_018503|CRT matches to NC_018509 (Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence) position: , mismatch: 5, identity: 0.833

gactaaacc---agaaactaagccagaaactaa	CRISPR spacer
---taaagcaaaagaaactaagccagaagctaa	Protospacer
   **** *   ****************.****

31. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP051859 (Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence) position: , mismatch: 5, identity: 0.833

gactaaacc---agaaactaagccagaaactaa	CRISPR spacer
---taaagcaaaagaaactaagccagaagctaa	Protospacer
   **** *   ****************.****

32. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP009347 (Bacillus thuringiensis HD1002 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.833

gactaaacc---agaaactaagccagaaactaa	CRISPR spacer
---taaagcaaaagaaactaagccagaagctaa	Protospacer
   **** *   ****************.****

33. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP045025 (Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.833

gactaaacc---agaaactaagccagaaactaa	CRISPR spacer
---taaagcaaaagaaactaagccagaagctaa	Protospacer
   **** *   ****************.****

34. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP053971 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.833

gactaaacc---agaaactaagccagaaactaa	CRISPR spacer
---taaagcaaaagaaactaagccagaagctaa	Protospacer
   **** *   ****************.****

35. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP039724 (Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.833

gactaaacc---agaaactaagccagaaactaa	CRISPR spacer
---taaagcaaaagaaactaagccagaagctaa	Protospacer
   **** *   ****************.****

36. spacer 1.3|5591|30|NC_018503|CRT matches to MT774411 (CrAssphage cr273_1, complete genome) position: , mismatch: 6, identity: 0.8

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
aacaaagaaagaaactaagccagaagctaa	Protospacer
.** **.  ****************.****

37. spacer 1.1|5495|42|NC_018503|CRT matches to NZ_CP032411 (Brevibacillus laterosporus strain E7593-50 plasmid pAZOBL1, complete sequence) position: , mismatch: 7, identity: 0.833

gactaaaccagagactaaaccagagactaaaccagaaactaa	CRISPR spacer
gcctaagccagagactagaccagagactaaaccagatgagaa	Protospacer
* ****.**********.****************** .  **

38. spacer 1.3|5591|30|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 7, identity: 0.767

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
aactaaaccagaaactaagccagcagtacc	Protospacer
.********************** *..   

39. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP008847 (Bacillus anthracis strain HYU01 plasmid pX01, complete sequence) position: , mismatch: 7, identity: 0.767

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
gactaagccagaaacaaagccagacgtttt	Protospacer
******.******** ******** ..*  

40. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP029806 (Bacillus anthracis strain London_499 plasmid pX01, complete sequence) position: , mismatch: 7, identity: 0.767

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
gactaagccagaaacaaagccagacgtttt	Protospacer
******.******** ******** ..*  

41. spacer 1.3|5591|30|NC_018503|CRT matches to NC_047926 (Lactobacillus phage Semele, complete genome) position: , mismatch: 7, identity: 0.767

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
aactgaaccagaagctaagccagaagttcc	Protospacer
.***.********.***********..*  

42. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP004872 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB64, complete sequence) position: , mismatch: 7, identity: 0.767

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
ggaaaaaccagaaacaaagccagaacaaaa	Protospacer
*.  *********** *********   **

43. spacer 1.3|5591|30|NC_018503|CRT matches to NC_017205 (Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT72, complete sequence) position: , mismatch: 7, identity: 0.767

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
ggaaaaaccagaaacaaagccagaacaaaa	Protospacer
*.  *********** *********   **

44. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP015156 (Bacillus thuringiensis strain Bc601 plasmid pBTBC6, complete sequence) position: , mismatch: 7, identity: 0.767

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
ggaaaaaccagaaacaaagccagaacaaaa	Protospacer
*.  *********** *********   **

45. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP004869 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB67, complete sequence) position: , mismatch: 7, identity: 0.767

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
ggaaaaaccagaaacaaagccagaacaaaa	Protospacer
*.  *********** *********   **

46. spacer 1.3|5591|30|NC_018503|CRT matches to CP020758 (Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-19, complete sequence) position: , mismatch: 7, identity: 0.767

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
ggaaaaaccagaaacaaagccagaacaaaa	Protospacer
*.  *********** *********   **

47. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP010093 (Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB71, complete sequence) position: , mismatch: 7, identity: 0.767

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
ggaaaaaccagaaacaaagccagaacaaaa	Protospacer
*.  *********** *********   **

48. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP021065 (Bacillus thuringiensis strain ATCC 10792 plasmid poh4, complete sequence) position: , mismatch: 7, identity: 0.767

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
ggaaaaaccagaaacaaagccagaacaaaa	Protospacer
*.  *********** *********   **

49. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP011358 (Bacillus thuringiensis strain YC-10 plasmid pYC2226, complete sequence) position: , mismatch: 7, identity: 0.767

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
ggaaaaaccagaaacaaagccagaacaaaa	Protospacer
*.  *********** *********   **

50. spacer 1.3|5591|30|NC_018503|CRT matches to NC_018879 (Bacillus thuringiensis Bt407 plasmid BTB_78p, complete sequence) position: , mismatch: 7, identity: 0.767

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
ggaaaaaccagaaacaaagccagaacaaaa	Protospacer
*.  *********** *********   **

51. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP013057 (Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-2, complete sequence) position: , mismatch: 7, identity: 0.767

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
ggaaaaaccagaaacaaagccagaacaaaa	Protospacer
*.  *********** *********   **

52. spacer 1.3|5591|30|NC_018503|CRT matches to NC_020382 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-68, complete sequence) position: , mismatch: 7, identity: 0.767

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
ggaaaaaccagaaacaaagccagaacaaaa	Protospacer
*.  *********** *********   **

53. spacer 1.1|5495|42|NC_018503|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 8, identity: 0.81

gactaaaccagagactaaaccagagactaaaccagaaactaa	CRISPR spacer
agttgaaaaagagactaaaccagaaactaaaccagagactaa	Protospacer
...*.**  ***************.***********.*****

54. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP024775 (Bacillus thuringiensis LM1212 plasmid pLM4, complete sequence) position: , mismatch: 8, identity: 0.733

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
agtaaaaccagaaactaaaccagaagttac	Protospacer
... **************.******..** 

55. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP041077 (Bacillus tropicus strain LM1212-W3 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.733

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
agtaaaaccagaaactaaaccagaagttac	Protospacer
... **************.******..** 

56. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_AP014826 (Geminocystis sp. NIES-3709 plasmid pGM3709_05, complete sequence) position: , mismatch: 8, identity: 0.733

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
tcaagaaatagaaactaaaccagaaactaa	Protospacer
    .** .*********.***********

57. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP044180 (Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-3, complete sequence) position: , mismatch: 9, identity: 0.7

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
gttcaaaccagaaacgaagccagaagaagc	Protospacer
* ..*********** *********.  . 

58. spacer 1.3|5591|30|NC_018503|CRT matches to NZ_CP030187 (Salmonella enterica strain SA20094620 plasmid pSA20094620.2, complete sequence) position: , mismatch: 9, identity: 0.7

gactaaaccagaaactaagccagaaactaa	CRISPR spacer
gttcaaaccagaaacgaagccagaagaagc	Protospacer
* ..*********** *********.  . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NC_018487
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 68274 72 Bacillus_phage(62.5%) transposase,terminase,integrase,portal attL 1283:1298|attR 62343:62358
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_018487.1|WP_001121080.1|49267_49630_+|hypothetical-protein 49267_49630_+ 120 aa aa NA HTH_XRE NA 0-68274 yes