Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017669 Halobacillus halophilus DSM 2266 plasmid PL16, complete sequence 1 crisprs NA 0 1 0 0
NC_017668 Halobacillus halophilus DSM 2266, complete genome 2 crisprs csa3,RT,cas14j,cas3,DEDDh,DinG 0 0 4 0
NC_017670 Halobacillus halophilus DSM 2266 plasmid PL3, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_017669
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017669_1 14004-14109 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017669_1 1.1|14030|54|NC_017669|CRISPRCasFinder 14030-14083 54 NZ_CP022107 Halobacillus halophilus strain HL2HP6 plasmid pHL2HP62 sequence 15334-15387 0 1.0
NC_017669_1 1.1|14030|54|NC_017669|CRISPRCasFinder 14030-14083 54 NC_017669 Halobacillus halophilus DSM 2266 plasmid PL16, complete sequence 14030-14083 0 1.0
NC_017669_1 1.1|14030|54|NC_017669|CRISPRCasFinder 14030-14083 54 NZ_CP022107 Halobacillus halophilus strain HL2HP6 plasmid pHL2HP62 sequence 15374-15427 7 0.87
NC_017669_1 1.1|14030|54|NC_017669|CRISPRCasFinder 14030-14083 54 NC_017669 Halobacillus halophilus DSM 2266 plasmid PL16, complete sequence 14070-14123 7 0.87

1. spacer 1.1|14030|54|NC_017669|CRISPRCasFinder matches to NZ_CP022107 (Halobacillus halophilus strain HL2HP6 plasmid pHL2HP62 sequence) position: , mismatch: 0, identity: 1.0

cttttctttcgttcaactatcgacaactcgaaacgatctccttttctttcgttc	CRISPR spacer
cttttctttcgttcaactatcgacaactcgaaacgatctccttttctttcgttc	Protospacer
******************************************************

2. spacer 1.1|14030|54|NC_017669|CRISPRCasFinder matches to NC_017669 (Halobacillus halophilus DSM 2266 plasmid PL16, complete sequence) position: , mismatch: 0, identity: 1.0

cttttctttcgttcaactatcgacaactcgaaacgatctccttttctttcgttc	CRISPR spacer
cttttctttcgttcaactatcgacaactcgaaacgatctccttttctttcgttc	Protospacer
******************************************************

3. spacer 1.1|14030|54|NC_017669|CRISPRCasFinder matches to NZ_CP022107 (Halobacillus halophilus strain HL2HP6 plasmid pHL2HP62 sequence) position: , mismatch: 7, identity: 0.87

cttttctttcgttcaactatcgacaactcgaaacgatctcctt---ttctttcgttc	CRISPR spacer
cttttctttcgttcaactatcaacaactcgaaacgatctcattaagttattgcg---	Protospacer
*********************.****************** **   ** ** **   

4. spacer 1.1|14030|54|NC_017669|CRISPRCasFinder matches to NC_017669 (Halobacillus halophilus DSM 2266 plasmid PL16, complete sequence) position: , mismatch: 7, identity: 0.87

cttttctttcgttcaactatcgacaactcgaaacgatctcctt---ttctttcgttc	CRISPR spacer
cttttctttcgttcaactatcaacaactcgaaacgatctcattaagttattgcg---	Protospacer
*********************.****************** **   ** ** **   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_017668
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017668_1 1271191-1271285 TypeV NA
1 spacers
cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017668_2 1657361-1657450 TypeI-A,TypeV NA
1 spacers
cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 603431 : 613207 9 Synechococcus_phage(28.57%) NA NA
DBSCAN-SWA_2 2207641 : 2216380 10 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_3 2958777 : 2966051 8 Streptococcus_phage(33.33%) transposase NA
DBSCAN-SWA_4 3616102 : 3621565 6 Staphylococcus_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage