Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_018146 Zymomonas mobilis subsp. mobilis ATCC 29191 plasmid pZZ6.01, complete sequence 0 crisprs NA 0 0 0 0
NC_018148 Zymomonas mobilis subsp. mobilis ATCC 29191 plasmid pZZ6.03, complete sequence 0 crisprs NA 0 0 0 0
NC_018147 Zymomonas mobilis subsp. mobilis ATCC 29191 plasmid pZZ6.02, complete sequence 0 crisprs NA 0 0 0 0
NC_018145 Zymomonas mobilis subsp. mobilis ATCC 29191, complete sequence 5 crisprs cas6f,cas7f,cas5f,cas8f,cas3f,cas1,cas3,DEDDh,csa3 0 5 4 0

Results visualization

1. NC_018145
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018145_1 125613-125820 Orphan I-F
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018145_2 1235874-1236083 Orphan I-F
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018145_3 1756727-1757238 Orphan I-F
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018145_4 1793736-1793801 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018145_5 1794090-1794184 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018145_3 3.7|1757117|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR 1757117-1757148 32 NC_013784 Zymomonas mobilis subsp. mobilis ZM4 plasmid pZZM401, complete sequence 17777-17808 0 1.0
NC_018145_3 3.7|1757117|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR 1757117-1757148 32 NZ_CP023686 Zymomonas mobilis subsp. mobilis strain ZM4 substr. 8b plasmid pZM41, complete sequence 1240-1271 0 1.0
NC_018145_3 3.7|1757117|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR 1757117-1757148 32 NZ_CP023680 Zymomonas mobilis subsp. mobilis strain ZM4 substr. 2032 plasmid pZM36, complete sequence 1240-1271 0 1.0
NC_018145_3 3.7|1757117|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR 1757117-1757148 32 NZ_CP003712 Zymomonas mobilis subsp. mobilis NRRL B-12526 plasmid pZM1252603, complete sequence 28072-28103 0 1.0
NC_018145_3 3.7|1757117|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR 1757117-1757148 32 NZ_CP003718 Zymomonas mobilis subsp. mobilis str. CP4 = NRRL B-14023 plasmid pZM1402303, complete sequence 17777-17808 0 1.0
NC_018145_3 3.7|1757117|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR 1757117-1757148 32 CP036464 Zymomonas mobilis strain ZM4* plasmid pZM36o, complete sequence 1240-1271 0 1.0
NC_018145_3 3.7|1757117|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR 1757117-1757148 32 CP036460 Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 strain ZM4 plasmid pER79ap36, complete sequence 1240-1271 0 1.0
NC_018145_1 1.3|125761|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125761-125791 31 NC_011363 Zymomonas mobilis subsp. mobilis ATCC 10988 plasmid pZMO1, complete sequence 328-358 1 0.968
NC_018145_1 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125701-125731 31 NC_013784 Zymomonas mobilis subsp. mobilis ZM4 plasmid pZZM401, complete sequence 19257-19287 2 0.935
NC_018145_1 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125701-125731 31 NZ_CP023686 Zymomonas mobilis subsp. mobilis strain ZM4 substr. 8b plasmid pZM41, complete sequence 40619-40649 2 0.935
NC_018145_1 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125701-125731 31 NZ_CP023680 Zymomonas mobilis subsp. mobilis strain ZM4 substr. 2032 plasmid pZM36, complete sequence 36255-36285 2 0.935
NC_018145_1 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125701-125731 31 NZ_CP003712 Zymomonas mobilis subsp. mobilis NRRL B-12526 plasmid pZM1252603, complete sequence 29552-29582 2 0.935
NC_018145_1 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125701-125731 31 NZ_CP003718 Zymomonas mobilis subsp. mobilis str. CP4 = NRRL B-14023 plasmid pZM1402303, complete sequence 19257-19287 2 0.935
NC_018145_1 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125701-125731 31 CP036464 Zymomonas mobilis strain ZM4* plasmid pZM36o, complete sequence 36259-36289 2 0.935
NC_018145_1 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125701-125731 31 CP036460 Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 strain ZM4 plasmid pER79ap36, complete sequence 36254-36284 2 0.935
NC_018145_1 1.3|125761|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125761-125791 31 NC_019019 Zymomonas mobilis plasmid pZMN1-1, complete sequence 328-358 2 0.935
NC_018145_1 1.3|125761|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125761-125791 31 NZ_CP021792 Zymomonas mobilis subsp. mobilis strain NRRL B-1960 plasmid pZMO1960_1A, complete sequence 924-954 2 0.935
NC_018145_1 1.3|125761|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125761-125791 31 NC_019198 Zymomonas mobilis subsp. mobilis NCIMB 11163 plasmid pZMO1A, complete sequence 328-358 2 0.935
NC_018145_1 1.3|125761|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125761-125791 31 NC_019210 Zymomonas mobilis subsp. mobilis plasmid pZMO1B, complete sequence 328-358 2 0.935
NC_018145_1 1.3|125761|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125761-125791 31 AP013397 Uncultured Mediterranean phage uvMED DNA, complete genome, group G15, isolate: uvMED-CGR-U-MedDCM-OCT-S25-C46 29814-29844 6 0.806
NC_018145_1 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125701-125731 31 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 655354-655384 7 0.774
NC_018145_1 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125701-125731 31 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2020992-2021022 7 0.774
NC_018145_1 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125701-125731 31 NZ_CP040722 Rhodococcus pyridinivorans strain YF3 plasmid unnamed3, complete sequence 31248-31278 7 0.774
NC_018145_1 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125701-125731 31 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 175019-175049 7 0.774
NC_018145_1 1.3|125761|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR 125761-125791 31 KX889068 Vibrio phage pVa5, complete genome 72714-72744 7 0.774
NC_018145_3 3.2|1756815|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR 1756815-1756846 32 MN693086 Marine virus AFVG_25M299, complete genome 17608-17639 9 0.719
NC_018145_3 3.7|1757117|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR 1757117-1757148 32 NC_007949 Polaromonas sp. JS666 plasmid 1, complete sequence 189090-189121 9 0.719
NC_018145_3 3.5|1756996|33|NC_018145|CRISPRCasFinder,CRT,PILER-CR 1756996-1757028 33 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 390717-390749 10 0.697

1. spacer 3.7|1757117|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NC_013784 (Zymomonas mobilis subsp. mobilis ZM4 plasmid pZZM401, complete sequence) position: , mismatch: 0, identity: 1.0

gtaaatcagctggaattgtcgctgactggata	CRISPR spacer
gtaaatcagctggaattgtcgctgactggata	Protospacer
********************************

2. spacer 3.7|1757117|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023686 (Zymomonas mobilis subsp. mobilis strain ZM4 substr. 8b plasmid pZM41, complete sequence) position: , mismatch: 0, identity: 1.0

gtaaatcagctggaattgtcgctgactggata	CRISPR spacer
gtaaatcagctggaattgtcgctgactggata	Protospacer
********************************

3. spacer 3.7|1757117|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023680 (Zymomonas mobilis subsp. mobilis strain ZM4 substr. 2032 plasmid pZM36, complete sequence) position: , mismatch: 0, identity: 1.0

gtaaatcagctggaattgtcgctgactggata	CRISPR spacer
gtaaatcagctggaattgtcgctgactggata	Protospacer
********************************

4. spacer 3.7|1757117|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP003712 (Zymomonas mobilis subsp. mobilis NRRL B-12526 plasmid pZM1252603, complete sequence) position: , mismatch: 0, identity: 1.0

gtaaatcagctggaattgtcgctgactggata	CRISPR spacer
gtaaatcagctggaattgtcgctgactggata	Protospacer
********************************

5. spacer 3.7|1757117|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP003718 (Zymomonas mobilis subsp. mobilis str. CP4 = NRRL B-14023 plasmid pZM1402303, complete sequence) position: , mismatch: 0, identity: 1.0

gtaaatcagctggaattgtcgctgactggata	CRISPR spacer
gtaaatcagctggaattgtcgctgactggata	Protospacer
********************************

6. spacer 3.7|1757117|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to CP036464 (Zymomonas mobilis strain ZM4* plasmid pZM36o, complete sequence) position: , mismatch: 0, identity: 1.0

gtaaatcagctggaattgtcgctgactggata	CRISPR spacer
gtaaatcagctggaattgtcgctgactggata	Protospacer
********************************

7. spacer 3.7|1757117|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to CP036460 (Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 strain ZM4 plasmid pER79ap36, complete sequence) position: , mismatch: 0, identity: 1.0

gtaaatcagctggaattgtcgctgactggata	CRISPR spacer
gtaaatcagctggaattgtcgctgactggata	Protospacer
********************************

8. spacer 1.3|125761|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NC_011363 (Zymomonas mobilis subsp. mobilis ATCC 10988 plasmid pZMO1, complete sequence) position: , mismatch: 1, identity: 0.968

aatctgttcaacactatcagcttgcaattta	CRISPR spacer
aatctgctcaacactatcagcttgcaattta	Protospacer
******.************************

9. spacer 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NC_013784 (Zymomonas mobilis subsp. mobilis ZM4 plasmid pZZM401, complete sequence) position: , mismatch: 2, identity: 0.935

acacgcttgatcttcttctgtggcgcgatgc	CRISPR spacer
atacgcttgatcttcttctatggcgcgatgc	Protospacer
*.*****************.***********

10. spacer 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023686 (Zymomonas mobilis subsp. mobilis strain ZM4 substr. 8b plasmid pZM41, complete sequence) position: , mismatch: 2, identity: 0.935

acacgcttgatcttcttctgtggcgcgatgc	CRISPR spacer
atacgcttgatcttcttctctggcgcgatgc	Protospacer
*.***************** ***********

11. spacer 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023680 (Zymomonas mobilis subsp. mobilis strain ZM4 substr. 2032 plasmid pZM36, complete sequence) position: , mismatch: 2, identity: 0.935

acacgcttgatcttcttctgtggcgcgatgc	CRISPR spacer
atacgcttgatcttcttctctggcgcgatgc	Protospacer
*.***************** ***********

12. spacer 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP003712 (Zymomonas mobilis subsp. mobilis NRRL B-12526 plasmid pZM1252603, complete sequence) position: , mismatch: 2, identity: 0.935

acacgcttgatcttcttctgtggcgcgatgc	CRISPR spacer
atacgcttgatcttcttctatggcgcgatgc	Protospacer
*.*****************.***********

13. spacer 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP003718 (Zymomonas mobilis subsp. mobilis str. CP4 = NRRL B-14023 plasmid pZM1402303, complete sequence) position: , mismatch: 2, identity: 0.935

acacgcttgatcttcttctgtggcgcgatgc	CRISPR spacer
atacgcttgatcttcttctatggcgcgatgc	Protospacer
*.*****************.***********

14. spacer 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to CP036464 (Zymomonas mobilis strain ZM4* plasmid pZM36o, complete sequence) position: , mismatch: 2, identity: 0.935

acacgcttgatcttcttctgtggcgcgatgc	CRISPR spacer
atacgcttgatcttcttctctggcgcgatgc	Protospacer
*.***************** ***********

15. spacer 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to CP036460 (Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 strain ZM4 plasmid pER79ap36, complete sequence) position: , mismatch: 2, identity: 0.935

acacgcttgatcttcttctgtggcgcgatgc	CRISPR spacer
atacgcttgatcttcttctctggcgcgatgc	Protospacer
*.***************** ***********

16. spacer 1.3|125761|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NC_019019 (Zymomonas mobilis plasmid pZMN1-1, complete sequence) position: , mismatch: 2, identity: 0.935

aatctgttcaacactatcagcttgcaattta	CRISPR spacer
aatctgctcaacgctatcagcttgcaattta	Protospacer
******.*****.******************

17. spacer 1.3|125761|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021792 (Zymomonas mobilis subsp. mobilis strain NRRL B-1960 plasmid pZMO1960_1A, complete sequence) position: , mismatch: 2, identity: 0.935

aatctgttcaacactatcagcttgcaattta	CRISPR spacer
aatctgctcaacgctatcagcttgcaattta	Protospacer
******.*****.******************

18. spacer 1.3|125761|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NC_019198 (Zymomonas mobilis subsp. mobilis NCIMB 11163 plasmid pZMO1A, complete sequence) position: , mismatch: 2, identity: 0.935

aatctgttcaacactatcagcttgcaattta	CRISPR spacer
aatctgctcaacgctatcagcttgcaattta	Protospacer
******.*****.******************

19. spacer 1.3|125761|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NC_019210 (Zymomonas mobilis subsp. mobilis plasmid pZMO1B, complete sequence) position: , mismatch: 2, identity: 0.935

aatctgttcaacactatcagcttgcaattta	CRISPR spacer
aatctgctcaacgctatcagcttgcaattta	Protospacer
******.*****.******************

20. spacer 1.3|125761|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to AP013397 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G15, isolate: uvMED-CGR-U-MedDCM-OCT-S25-C46) position: , mismatch: 6, identity: 0.806

aatctgttcaacactatcagct--tgcaattta	CRISPR spacer
aatcttttcaacactatcagctaaagcaaac--	Protospacer
***** ****************   **** .  

21. spacer 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774

acacgcttgatcttcttctgtggcgcgatgc	CRISPR spacer
acacgcgtgatcttcttctgtgtgccgcttg	Protospacer
****** ***************   ** *  

22. spacer 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 7, identity: 0.774

acacgcttgatcttcttctgtggcgcgatgc	CRISPR spacer
acacgcgtgatcttcttctgtgtgccgcttg	Protospacer
****** ***************   ** *  

23. spacer 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040722 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774

acacgcttgatcttcttctgtggcgcgatgc-	CRISPR spacer
agccgctcgatcttcttcagtggcgc-ctgtg	Protospacer
*  ****.********** *******  **. 

24. spacer 1.2|125701|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 7, identity: 0.774

acacgcttgatcttcttctgtggcgcgatgc	CRISPR spacer
acgatccggatcttcttgtgtggtgcgatgc	Protospacer
**.  *. ********* *****.*******

25. spacer 1.3|125761|31|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to KX889068 (Vibrio phage pVa5, complete genome) position: , mismatch: 7, identity: 0.774

aatctgttcaacactatcagcttgcaattta	CRISPR spacer
aatctcttcaacagtatcagcttcagctttc	Protospacer
***** ******* *********  . *** 

26. spacer 3.2|1756815|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to MN693086 (Marine virus AFVG_25M299, complete genome) position: , mismatch: 9, identity: 0.719

caagctatagcaaaattggaaaagacaaatgc	CRISPR spacer
aagactatagcaaaatgggaaaatacaaccct	Protospacer
 *..************ ****** **** . .

27. spacer 3.7|1757117|32|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NC_007949 (Polaromonas sp. JS666 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

gtaaatcagctggaattgtcgctgactggata	CRISPR spacer
cttaatgacctggaattgtcgctgacagagcg	Protospacer
 * *** * ***************** *....

28. spacer 3.5|1756996|33|NC_018145|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 10, identity: 0.697

gacccgttctgcggcaccatgccgagaagctgt	CRISPR spacer
aggccattctgcggcgccatgccgagagcttcg	Protospacer
.. **.*********.***********. .*  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 147758 : 160984 9 Thermus_phage(12.5%) NA NA
DBSCAN-SWA_2 897285 : 905446 7 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_3 977834 : 988318 10 uncultured_virus(14.29%) terminase NA
DBSCAN-SWA_4 1091000 : 1153371 52 Paenibacillus_phage(25.0%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage