Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015845 Enterococcus hirae ATCC 9790 plasmid pTG9790, complete sequence 0 crisprs NA 0 0 0 0
NC_018081 Enterococcus hirae ATCC 9790, complete sequence 2 crisprs cas2,DEDDh,DinG,cas3,cas9,cas1,csn2,cas14j,csa3 0 1 5 0

Results visualization

1. NC_018081
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018081_1 513137-513243 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018081_2 1209433-1209598 TypeII II-A,II-B
2 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018081_2 2.1|1209468|31|NC_018081|CRISPRCasFinder 1209468-1209498 31 HG796332 Uncultured bacterium plasmid pRGI00484 2500-2530 9 0.71
NC_018081_2 2.1|1209468|31|NC_018081|CRISPRCasFinder 1209468-1209498 31 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 819082-819112 9 0.71

1. spacer 2.1|1209468|31|NC_018081|CRISPRCasFinder matches to HG796332 (Uncultured bacterium plasmid pRGI00484) position: , mismatch: 9, identity: 0.71

ctttcgcaagctctaaccactcgtcgtcgtt	CRISPR spacer
ctttcgcaagatttaaccactcgttaatcaa	Protospacer
********** *.***********.. .   

2. spacer 2.1|1209468|31|NC_018081|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.71

ctttcgcaagctctaaccactcgtcgtcgtt	CRISPR spacer
gctcgacaagctctacccactcgacgtcgac	Protospacer
 .*. .********* ******* ***** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 66364 : 155215 100 Enterococcus_phage(26.47%) capsid,tail,terminase,tRNA,protease,integrase,head,portal,plate attL 67389:67404|attR 155586:155601
DBSCAN-SWA_2 422269 : 506150 79 Bacillus_phage(26.32%) capsid,terminase,tail,protease,portal NA
DBSCAN-SWA_3 1586014 : 1593612 10 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_4 1816862 : 1925033 123 Enterococcus_phage(36.54%) capsid,terminase,tail,tRNA,transposase,protease,integrase,head,portal,holin,plate attL 1879173:1879196|attR 1914457:1914480
DBSCAN-SWA_5 2512485 : 2521544 9 Prochlorococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage