Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 4 crisprs csa3,PD-DExK,cas2,cas1,cas4,cas7,cas8c,cas5,cas3,cas9 0 14 0 0
NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 6 crisprs cas10,csm4gr5,csm3gr7,cas6,cas1,cas2,csa3 0 70 1 0
NC_017956 Tistrella mobilis KA081020-065, complete sequence 0 crisprs csa3,DEDDh,WYL,cas3,DinG 0 0 5 0
NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 3 crisprs DEDDh,csa3 1 4 1 0
NC_017959 Tistrella mobilis KA081020-065 plasmid pTM4, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_017958
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017958_1 303388-303473 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017958_2 504628-505054 Orphan I-C
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017958_3 566600-567031 orTypeII NA
6 spacers
cas2,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017958_4 699950-700039 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017958_1 1.1|303412|38|NC_017958|CRISPRCasFinder 303412-303449 38 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 303412-303449 0 1.0
NC_017958_2 2.1|504660|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504660-504693 34 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 504660-504693 0 1.0
NC_017958_2 2.2|504726|35|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504726-504760 35 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 504726-504760 0 1.0
NC_017958_2 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504793-504825 33 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 504793-504825 0 1.0
NC_017958_2 2.4|504858|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504858-504890 33 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 504858-504890 0 1.0
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 504923-504956 0 1.0
NC_017958_2 2.6|504989|34|NC_017958|CRISPRCasFinder,CRT 504989-505022 34 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 504989-505022 0 1.0
NC_017958_3 3.1|566636|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566636-566665 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 566636-566665 0 1.0
NC_017958_3 3.2|566702|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566702-566731 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 566702-566731 0 1.0
NC_017958_3 3.3|566768|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566768-566797 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 566768-566797 0 1.0
NC_017958_3 3.4|566834|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566834-566863 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 566834-566863 0 1.0
NC_017958_3 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566900-566929 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 566900-566929 0 1.0
NC_017958_3 3.6|566966|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566966-566995 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 566966-566995 0 1.0
NC_017958_4 4.1|699974|42|NC_017958|CRISPRCasFinder 699974-700015 42 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 699974-700015 0 1.0
NC_017958_3 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566900-566929 30 MN857473 Teseptimavirus S2B, complete genome 1239-1268 2 0.933
NC_017958_3 3.2|566702|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566702-566731 30 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 317548-317577 5 0.833
NC_017958_3 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566900-566929 30 NC_047954 Pseudomonas phage Njord, complete genome 42618-42647 5 0.833
NC_017958_1 1.1|303412|38|NC_017958|CRISPRCasFinder 303412-303449 38 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 45107-45144 6 0.842
NC_017958_2 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504793-504825 33 NZ_CP023550 Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence 120993-121025 6 0.818
NC_017958_2 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504793-504825 33 NZ_CP010645 Phaeobacter piscinae strain P36 plasmid pP36_b, complete sequence 70531-70563 6 0.818
NC_017958_2 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504793-504825 33 NZ_CP010691 Phaeobacter piscinae strain P42 plasmid pP42_b, complete sequence 70531-70563 6 0.818
NC_017958_3 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566900-566929 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2572711-2572740 6 0.8
NC_017958_3 3.6|566966|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566966-566995 30 MH697580 Gordonia phage Catfish, complete genome 40598-40627 6 0.8
NC_017958_3 3.6|566966|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566966-566995 30 KU682439 Stenotrophomonas phage vB_SmaS-DLP_6, complete genome 139978-140007 6 0.8
NC_017958_2 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504793-504825 33 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 804731-804763 7 0.788
NC_017958_2 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504793-504825 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 261760-261792 7 0.788
NC_017958_3 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566900-566929 30 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 891680-891709 7 0.767
NC_017958_3 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566900-566929 30 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 921445-921474 7 0.767
NC_017958_3 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566900-566929 30 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 370683-370712 7 0.767
NC_017958_3 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566900-566929 30 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 45555-45584 7 0.767
NC_017958_3 3.6|566966|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566966-566995 30 MK977696 Gordonia phage SCentae, complete genome 60381-60410 7 0.767
NC_017958_3 3.6|566966|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566966-566995 30 MK977695 Gordonia phage Pupper, complete genome 60235-60264 7 0.767
NC_017958_2 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504793-504825 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 347886-347918 8 0.758
NC_017958_2 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504793-504825 33 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 256218-256250 8 0.758
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP032676 Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence 97247-97280 8 0.765
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 174599-174632 8 0.765
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 328240-328273 8 0.765
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP041606 Streptomyces sp. S1D4-14 plasmid pS1D4-14.2, complete sequence 23712-23745 8 0.765
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 MT740734 Ralstonia phage Dina, complete genome 33180-33213 8 0.765
NC_017958_3 3.3|566768|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566768-566797 30 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 354261-354290 8 0.733
NC_017958_3 3.4|566834|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566834-566863 30 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 166375-166404 8 0.733
NC_017958_3 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566900-566929 30 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 447531-447560 8 0.733
NC_017958_3 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566900-566929 30 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 42655-42684 8 0.733
NC_017958_3 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566900-566929 30 NZ_CP034811 Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence 110094-110123 8 0.733
NC_017958_3 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566900-566929 30 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 296033-296062 8 0.733
NC_017958_3 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566900-566929 30 MH825712 Microbacterium phage ValentiniPuff, complete genome 17527-17556 8 0.733
NC_017958_3 3.6|566966|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566966-566995 30 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 88343-88372 8 0.733
NC_017958_3 3.6|566966|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566966-566995 30 NZ_CP047145 Streptomyces sp. HF10 plasmid plas1, complete sequence 5852-5881 8 0.733
NC_017958_2 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504793-504825 33 NZ_CP022748 Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence 22055-22087 9 0.727
NC_017958_2 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504793-504825 33 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 306612-306644 9 0.727
NC_017958_2 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504793-504825 33 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 284710-284742 9 0.727
NC_017958_2 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504793-504825 33 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 246088-246120 9 0.727
NC_017958_2 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504793-504825 33 NZ_CP016463 Bosea sp. RAC05 plasmid pBSY19_1, complete sequence 239832-239864 9 0.727
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 1238036-1238069 9 0.735
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 1056869-1056902 9 0.735
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 231611-231644 9 0.735
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 231611-231644 9 0.735
NC_017958_3 3.3|566768|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566768-566797 30 MK279899 Arthrobacter phage Maja, complete genome 34216-34245 9 0.7
NC_017958_3 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566900-566929 30 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 20703-20732 9 0.7
NC_017958_3 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566900-566929 30 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1792415-1792444 9 0.7
NC_017958_3 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566900-566929 30 MN813693 Mycobacterium phage Imvubu, complete genome 52154-52183 9 0.7
NC_017958_3 3.6|566966|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT 566966-566995 30 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 184345-184374 9 0.7
NC_017958_2 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504793-504825 33 NZ_CP011515 Mitsuaria sp. 7 plasmid, complete sequence 89054-89086 10 0.697
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 1630707-1630740 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 121434-121467 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 124157-124190 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 1570897-1570930 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 188971-189004 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1175916-1175949 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 1555659-1555692 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 1603417-1603450 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 1371409-1371442 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 202314-202347 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 267240-267273 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 186906-186939 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1487957-1487990 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 1499007-1499040 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 1037574-1037607 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 727314-727347 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 1076259-1076292 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 92028-92061 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 1613792-1613825 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 331200-331233 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 118796-118829 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 121434-121467 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_AP022602 Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399 33365-33398 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 128528-128561 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1684587-1684620 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 486756-486789 10 0.706
NC_017958_2 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT 504923-504956 34 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 2309426-2309459 11 0.676

1. spacer 1.1|303412|38|NC_017958|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 0, identity: 1.0

gggcggcagcccccgcccggcgagggactaacaaacct	CRISPR spacer
gggcggcagcccccgcccggcgagggactaacaaacct	Protospacer
**************************************

2. spacer 2.1|504660|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 0, identity: 1.0

accttcgacgcggtgtatgacgcgccatcgacag	CRISPR spacer
accttcgacgcggtgtatgacgcgccatcgacag	Protospacer
**********************************

3. spacer 2.2|504726|35|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 0, identity: 1.0

tcgatgacgaccgagtggagtgccccgggtgcctc	CRISPR spacer
tcgatgacgaccgagtggagtgccccgggtgcctc	Protospacer
***********************************

4. spacer 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 0, identity: 1.0

cgcggcgatccccgccagcccgccggggtgtgc	CRISPR spacer
cgcggcgatccccgccagcccgccggggtgtgc	Protospacer
*********************************

5. spacer 2.4|504858|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaaaatcgaaacaaaccgctttacagggag	CRISPR spacer
cgaaaaaatcgaaacaaaccgctttacagggag	Protospacer
*********************************

6. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 0, identity: 1.0

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
cgcggtgctcggtgccgacacgctcggcatcgag	Protospacer
**********************************

7. spacer 2.6|504989|34|NC_017958|CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 0, identity: 1.0

cgcagatgcccgcaccgttttgatttgtaatacg	CRISPR spacer
cgcagatgcccgcaccgttttgatttgtaatacg	Protospacer
**********************************

8. spacer 3.1|566636|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 0, identity: 1.0

ggagccggggcggatgtgaccagtaaggac	CRISPR spacer
ggagccggggcggatgtgaccagtaaggac	Protospacer
******************************

9. spacer 3.2|566702|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 0, identity: 1.0

gagcgagccatcgcagagttccttgacgtg	CRISPR spacer
gagcgagccatcgcagagttccttgacgtg	Protospacer
******************************

10. spacer 3.3|566768|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 0, identity: 1.0

gatttgagcgtcaaggcccccaagcttccg	CRISPR spacer
gatttgagcgtcaaggcccccaagcttccg	Protospacer
******************************

11. spacer 3.4|566834|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 0, identity: 1.0

ccccgctgcgtggaccagctgagtgatcgt	CRISPR spacer
ccccgctgcgtggaccagctgagtgatcgt	Protospacer
******************************

12. spacer 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 0, identity: 1.0

tcgctgtccgacgccgaccgctaccccctg	CRISPR spacer
tcgctgtccgacgccgaccgctaccccctg	Protospacer
******************************

13. spacer 3.6|566966|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 0, identity: 1.0

acagccaagtacatcggcgacccgacgctc	CRISPR spacer
acagccaagtacatcggcgacccgacgctc	Protospacer
******************************

14. spacer 4.1|699974|42|NC_017958|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 0, identity: 1.0

agatgcgcgccgcgctgggcgcgcggccgctgccgctcgacc	CRISPR spacer
agatgcgcgccgcgctgggcgcgcggccgctgccgctcgacc	Protospacer
******************************************

15. spacer 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to MN857473 (Teseptimavirus S2B, complete genome) position: , mismatch: 2, identity: 0.933

tcgctgtccgacgccgaccgctaccccctg	CRISPR spacer
tcgctgtccgacgccaaccgctaccccctc	Protospacer
***************.************* 

16. spacer 3.2|566702|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 5, identity: 0.833

gagcgagccatcgcagagttccttga-cgtg	CRISPR spacer
ttacgagccatctcagagttccttgagcgt-	Protospacer
  .********* ************* *** 

17. spacer 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_047954 (Pseudomonas phage Njord, complete genome) position: , mismatch: 5, identity: 0.833

tcgctgtccgacgccgaccgctaccccctg	CRISPR spacer
gggctgtccgacgccgaccgttaccctctc	Protospacer
  ******************.*****.** 

18. spacer 1.1|303412|38|NC_017958|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 6, identity: 0.842

gggcggcagcccccgcccggcgagggactaacaaacct	CRISPR spacer
gcgcggcagcgcccgcccggcgagggaccaacaaaaaa	Protospacer
* ******** *****************.******   

19. spacer 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023550 (Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818

cgcggcgatccccgccagcccgccggggtgtgc-	CRISPR spacer
ggcggcgatccccgccagcac-cccgagcgtgcc	Protospacer
 ****************** * ** *.*.**** 

20. spacer 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010645 (Phaeobacter piscinae strain P36 plasmid pP36_b, complete sequence) position: , mismatch: 6, identity: 0.818

cgcggcgatccccgccagcccgccggggtgtgc----	CRISPR spacer
cgcggcgatcatcgccagcccgcc----tgtgccgca	Protospacer
********** .************    *****    

21. spacer 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010691 (Phaeobacter piscinae strain P42 plasmid pP42_b, complete sequence) position: , mismatch: 6, identity: 0.818

cgcggcgatccccgccagcccgccggggtgtgc----	CRISPR spacer
cgcggcgatcatcgccagcccgcc----tgtgccgca	Protospacer
********** .************    *****    

22. spacer 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tcgctgtccgacgccgaccgctaccccctg	CRISPR spacer
ccgctgcccgacgccgaccgctactacgtc	Protospacer
.*****.*****************. * * 

23. spacer 3.6|566966|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to MH697580 (Gordonia phage Catfish, complete genome) position: , mismatch: 6, identity: 0.8

acagccaagtacatcggcgacccgacgctc	CRISPR spacer
tcagtgaagtacatcggcgacccgacccgt	Protospacer
 ***. ******************** * .

24. spacer 3.6|566966|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to KU682439 (Stenotrophomonas phage vB_SmaS-DLP_6, complete genome) position: , mismatch: 6, identity: 0.8

acagccaagtacatcggcgacccgacgctc	CRISPR spacer
acgtcgaagtacaacggcgacccgacgcag	Protospacer
**. * ******* **************  

25. spacer 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.788

cgcggcgatccccgccagcccgccggggtgtgc	CRISPR spacer
ggcggcgatccccgccagcccgtcgggcagcag	Protospacer
 *********************.****  *.. 

26. spacer 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.788

cgcggcgatccccgccagcccgccggggtgtgc	CRISPR spacer
cccggcgatcccgtccagcccgccggtgatggc	Protospacer
* **********  ************ *   **

27. spacer 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.767

tcgctgtccgacgccgaccgctaccccctg	CRISPR spacer
tcgctgtccggcgccgaccgcgacgaacac	Protospacer
**********.********** **   *  

28. spacer 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.767

tcgctgtccgacgccgaccgctaccccctg	CRISPR spacer
tcgctgtccggcgccgaccgcgacgaacac	Protospacer
**********.********** **   *  

29. spacer 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

tcgctgtccgacgccgaccgctaccccctg	CRISPR spacer
ccgctgaccgacgccgaccgcgacggctgg	Protospacer
.***** ************** **  *. *

30. spacer 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 7, identity: 0.767

tcgctgtccgacgccgaccgctaccccctg	CRISPR spacer
ccgctgaccgacgccgaccgcgacggctgg	Protospacer
.***** ************** **  *. *

31. spacer 3.6|566966|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to MK977696 (Gordonia phage SCentae, complete genome) position: , mismatch: 7, identity: 0.767

acagccaagtacatcggcgacccgacgctc	CRISPR spacer
aagaccaaggacaccggcgacccgacgaac	Protospacer
* ..***** ***.*************  *

32. spacer 3.6|566966|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to MK977695 (Gordonia phage Pupper, complete genome) position: , mismatch: 7, identity: 0.767

acagccaagtacatcggcgacccgacgctc	CRISPR spacer
aagaccaaggacaccggcgacccgacgaac	Protospacer
* ..***** ***.*************  *

33. spacer 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758

cgcggcgatccccgccagcccgccggggtgtgc	CRISPR spacer
cgccgcgatccccgccggcccgccgccgaccac	Protospacer
*** ************.********  *  ..*

34. spacer 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.758

cgcggcgatccccgccagcccgccggggtgtgc	CRISPR spacer
cccggcgagcgccgccagcccgccggcgcgcag	Protospacer
* ****** * *************** *.*.. 

35. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 8, identity: 0.765

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
cgccgtgctcggtgccggcacgctcgtgctggcc	Protospacer
*** *************.********   * *  

36. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.765

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
gggcgagagcggcgccgacccgctcggcatcgag	Protospacer
 *  * *  ***.****** **************

37. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 8, identity: 0.765

cgcggtgctcggtgccgacacgctcggcatcgag----	CRISPR spacer
tgcggcgctcggcgccgacacgctcg----cgcggctg	Protospacer
.****.******.*************    ** *    

38. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041606 (Streptomyces sp. S1D4-14 plasmid pS1D4-14.2, complete sequence) position: , mismatch: 8, identity: 0.765

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
cctcgtgctcggtgctgacccgctcggccacgtg	Protospacer
* . ***********.*** ********  ** *

39. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to MT740734 (Ralstonia phage Dina, complete genome) position: , mismatch: 8, identity: 0.765

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
cgcggtgcccggtaccgacacgctgttcgtcgcc	Protospacer
********.****.**********   *.***  

40. spacer 3.3|566768|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

gatttgagcgtcaaggcccccaagcttccg	CRISPR spacer
tatttgagcgacaaggcccgcaaggaccga	Protospacer
 ********* ******** ****  .* .

41. spacer 3.4|566834|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 8, identity: 0.733

ccccgctgcgtggaccagctgagtgatcgt	CRISPR spacer
ccccgcttcgtggaccagctgctcggctgg	Protospacer
******* *************  .*...* 

42. spacer 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.733

tcgctgtccgacgccgaccgctaccccctg	CRISPR spacer
gcggtgtccgacgcggaccgctacaacggc	Protospacer
 ** ********** *********  *   

43. spacer 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 8, identity: 0.733

tcgctgtccgacgccgaccgctaccccctg	CRISPR spacer
aacccgtccgacgccgaccgctatccgcac	Protospacer
   *.******************.** *  

44. spacer 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034811 (Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

tcgctgtccgacgccgaccgctaccccctg	CRISPR spacer
tctgccgccgacgccgaccgccacccccgt	Protospacer
**  .  **************.******  

45. spacer 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

tcgctgtccgacgccgaccgctaccccctg	CRISPR spacer
ggccgggccgccgccgaccgctacccccac	Protospacer
   * * *** *****************  

46. spacer 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to MH825712 (Microbacterium phage ValentiniPuff, complete genome) position: , mismatch: 8, identity: 0.733

tcgctgtccgacgccgaccgctaccccctg	CRISPR spacer
gtgctgtccgacgacggccgctaccgctac	Protospacer
 .*********** **.******** *.  

47. spacer 3.6|566966|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

acagccaagtacatcggcgacccgacgctc	CRISPR spacer
atgcgggagtacatcgccgacccgccgctc	Protospacer
*..   .********* ******* *****

48. spacer 3.6|566966|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047145 (Streptomyces sp. HF10 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.733

acagccaagtacatcggcgacccgacgctc	CRISPR spacer
ctgcgcgagtacctcggcgacccgaccctc	Protospacer
 ..  *.***** ************* ***

49. spacer 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022748 (Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.727

cgcggcgatccccgccagcccgccggggtgtgc	CRISPR spacer
tcgtgcgatctccgccatcccgccggggtaggt	Protospacer
.   ******.****** ***********. *.

50. spacer 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 9, identity: 0.727

cgcggcgatccccgccagcccgccggggtgtgc	CRISPR spacer
ggcggcgctgcccgccagcccgccgccgaggat	Protospacer
 ****** * ***************  * * ..

51. spacer 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 9, identity: 0.727

cgcggcgatccccgccagcccgccggggtgtgc	CRISPR spacer
gccggcgagccccgcaagcccgccggagagaca	Protospacer
  ****** ****** **********.* *   

52. spacer 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 9, identity: 0.727

cgcggcgatccccgccagcccgccggggtgtgc	CRISPR spacer
agcggcgatcccctcaagcccgccgatgaactc	Protospacer
 ************ * *********. * .. *

53. spacer 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 9, identity: 0.727

cgcggcgatccccgccagcccgccggggtgtgc	CRISPR spacer
gccggcgatcccggcctgcccgccggtgcactc	Protospacer
  ********** *** ********* *... *

54. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.735

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
agcttccctcggtgccgacgagctcggcatcggt	Protospacer
 **  . ************. ***********. 

55. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.735

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
agcttccctcggtgccgacgagctcggcatcggt	Protospacer
 **  . ************. ***********. 

56. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 9, identity: 0.735

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
tgccgatatcggtcccggcacgctcggcatcgcc	Protospacer
.** *   ***** ***.**************  

57. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 9, identity: 0.735

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
tgccgatatcggtcccggcacgctcggcatcgcc	Protospacer
.** *   ***** ***.**************  

58. spacer 3.3|566768|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to MK279899 (Arthrobacter phage Maja, complete genome) position: , mismatch: 9, identity: 0.7

gatttgagcgtcaaggcccccaagcttccg	CRISPR spacer
cgcaacggcctcaaggcccccaagcctccg	Protospacer
 ..   .** ***************.****

59. spacer 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.7

tcgctgtccgacgccgaccgctaccccctg	CRISPR spacer
gagctgtccgacgcggacctctaccgtgaa	Protospacer
  ************ **** ***** .  .

60. spacer 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.7

tcgctgtccgacgccgaccgctaccccctg	CRISPR spacer
gagctgtccgacgcggacctctaccgtgaa	Protospacer
  ************ **** ***** .  .

61. spacer 3.5|566900|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to MN813693 (Mycobacterium phage Imvubu, complete genome) position: , mismatch: 9, identity: 0.7

tcgctgtccgacgccgaccgctaccccctg	CRISPR spacer
gtgctgatcgacgccgaccgctacctggaa	Protospacer
 .**** .*****************.   .

62. spacer 3.6|566966|30|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.7

acagccaagtacatcggcgacccgacgctc	CRISPR spacer
ctgtttaagtacatcggcgctccgacgctg	Protospacer
 .. ..************* .******** 

63. spacer 2.3|504793|33|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcgatccccgccagcccgccggggtgtgc	CRISPR spacer
tccggcgatcaccgccagcacgccggtgatcca	Protospacer
. ******** ******** ****** *  .  

64. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

65. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

66. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

67. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

68. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

69. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

70. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

71. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

72. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

73. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

74. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

75. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

76. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

77. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

78. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

79. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

80. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

81. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

82. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

83. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

84. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

85. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ttacgtgctcggcgccgacacgctcggccgcagc	Protospacer
.   ********.***************  *.. 

86. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022602 (Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
taagcgggtcggtcccgacacgctcgtcatcgtt	Protospacer
.. *  * ***** ************ *****  

87. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
cacctacagcggcggcgacacgctcggcatcgac	Protospacer
*.*      ***.* ****************** 

88. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
cacctacagcggcggcgacacgctcggcatcgac	Protospacer
*.*      ***.* ****************** 

89. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 10, identity: 0.706

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
ctatgttctcggtgccgatacgctcggccgcagc	Protospacer
*   ** ***********.*********  *.. 

90. spacer 2.5|504923|34|NC_017958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 11, identity: 0.676

cgcggtgctcggtgccgacacgctcggcatcgag	CRISPR spacer
aattgccttcggtgccgacaagcttggcatcggt	Protospacer
 .. *. .************ ***.*******. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_017957
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017957_1 142961-143130 Orphan I-C:NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017957_2 231261-232588 Orphan I-C:NA
20 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017957_3 369746-370686 Orphan I-C:NA
14 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017957_4 412244-412551 TypeIII NA
4 spacers
cas6,csm3gr7,csm4gr5,cas10,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017957_5 416140-416721 TypeIII NA
8 spacers
cas6,csm3gr7,csm4gr5,cas10,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017957_6 421917-422064 TypeIII NA
2 spacers
cas2,cas1,cas6,csm3gr7,csm4gr5,cas10

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017957_1 1.1|142997|31|NC_017957|PILER-CR 142997-143027 31 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 142997-143027 0 1.0
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 143064-143094 0 1.0
NC_017957_1 1.3|142996|34|NC_017957|CRISPRCasFinder 142996-143029 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 142996-143029 0 1.0
NC_017957_1 1.4|143063|34|NC_017957|CRISPRCasFinder 143063-143096 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 143063-143096 0 1.0
NC_017957_2 2.1|231292|34|NC_017957|CRISPRCasFinder,CRT 231292-231325 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 231292-231325 0 1.0
NC_017957_2 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT 231357-231390 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 231357-231390 0 1.0
NC_017957_2 2.3|231422|33|NC_017957|CRISPRCasFinder,CRT 231422-231454 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 231422-231454 0 1.0
NC_017957_2 2.4|231486|33|NC_017957|CRISPRCasFinder,CRT 231486-231518 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 231486-231518 0 1.0
NC_017957_2 2.5|231550|33|NC_017957|CRISPRCasFinder,CRT 231550-231582 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 231550-231582 0 1.0
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 231614-231648 0 1.0
NC_017957_2 2.7|231680|34|NC_017957|CRISPRCasFinder,CRT 231680-231713 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 231680-231713 0 1.0
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 231745-231777 0 1.0
NC_017957_2 2.9|231809|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231809-231842 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 231809-231842 0 1.0
NC_017957_2 2.10|231874|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231874-231907 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 231874-231907 0 1.0
NC_017957_2 2.11|231939|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231939-231972 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 231939-231972 0 1.0
NC_017957_2 2.12|232004|36|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232004-232039 36 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 232004-232039 0 1.0
NC_017957_2 2.13|232071|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232071-232103 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 232071-232103 0 1.0
NC_017957_2 2.14|232135|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232135-232168 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 232135-232168 0 1.0
NC_017957_2 2.15|232200|35|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232200-232234 35 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 232200-232234 0 1.0
NC_017957_2 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232266-232299 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 232266-232299 0 1.0
NC_017957_2 2.17|232331|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232331-232364 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 232331-232364 0 1.0
NC_017957_2 2.18|232396|35|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232396-232430 35 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 232396-232430 0 1.0
NC_017957_2 2.19|232462|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232462-232494 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 232462-232494 0 1.0
NC_017957_2 2.20|232526|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232526-232557 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 232526-232557 0 1.0
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 231358-231389 0 1.0
NC_017957_2 2.22|231424|31|NC_017957|PILER-CR 231424-231454 31 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 231423-231453 0 1.0
NC_017957_2 2.23|231488|31|NC_017957|PILER-CR 231488-231518 31 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 231487-231517 0 1.0
NC_017957_2 2.24|231552|31|NC_017957|PILER-CR 231552-231582 31 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 231551-231581 0 1.0
NC_017957_3 3.1|369777|34|NC_017957|CRISPRCasFinder,CRT 369777-369810 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 369777-369810 0 1.0
NC_017957_3 3.2|369842|35|NC_017957|CRISPRCasFinder,CRT 369842-369876 35 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 369842-369876 0 1.0
NC_017957_3 3.3|369908|34|NC_017957|CRISPRCasFinder,CRT 369908-369941 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 369908-369941 0 1.0
NC_017957_3 3.4|369973|34|NC_017957|CRISPRCasFinder,CRT 369973-370006 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 369973-370006 0 1.0
NC_017957_3 3.5|370038|33|NC_017957|CRISPRCasFinder,CRT 370038-370070 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370038-370070 0 1.0
NC_017957_3 3.6|370102|35|NC_017957|CRISPRCasFinder,CRT 370102-370136 35 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370102-370136 0 1.0
NC_017957_3 3.7|370168|35|NC_017957|CRISPRCasFinder,CRT 370168-370202 35 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370168-370202 0 1.0
NC_017957_3 3.8|370234|33|NC_017957|CRISPRCasFinder,CRT 370234-370266 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370234-370266 0 1.0
NC_017957_3 3.9|370298|33|NC_017957|CRISPRCasFinder,CRT 370298-370330 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370298-370330 0 1.0
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370362-370394 0 1.0
NC_017957_3 3.11|370426|35|NC_017957|CRISPRCasFinder,CRT 370426-370460 35 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370426-370460 0 1.0
NC_017957_3 3.12|370492|35|NC_017957|CRISPRCasFinder,CRT 370492-370526 35 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370492-370526 0 1.0
NC_017957_3 3.13|370558|34|NC_017957|CRISPRCasFinder,CRT 370558-370591 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370558-370591 0 1.0
NC_017957_3 3.14|370623|33|NC_017957|CRISPRCasFinder,CRT 370623-370655 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370623-370655 0 1.0
NC_017957_3 3.15|369779|34|NC_017957|PILER-CR 369779-369812 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 369777-369810 0 1.0
NC_017957_3 3.16|369844|35|NC_017957|PILER-CR 369844-369878 35 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 369842-369876 0 1.0
NC_017957_3 3.17|369910|34|NC_017957|PILER-CR 369910-369943 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 369908-369941 0 1.0
NC_017957_3 3.18|369975|34|NC_017957|PILER-CR 369975-370008 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 369973-370006 0 1.0
NC_017957_3 3.19|370040|33|NC_017957|PILER-CR 370040-370072 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370038-370070 0 1.0
NC_017957_3 3.20|370104|35|NC_017957|PILER-CR 370104-370138 35 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370102-370136 0 1.0
NC_017957_3 3.21|370170|35|NC_017957|PILER-CR 370170-370204 35 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370168-370202 0 1.0
NC_017957_3 3.22|370236|33|NC_017957|PILER-CR 370236-370268 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370234-370266 0 1.0
NC_017957_3 3.23|370300|33|NC_017957|PILER-CR 370300-370332 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370298-370330 0 1.0
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370362-370394 0 1.0
NC_017957_3 3.25|370428|35|NC_017957|PILER-CR 370428-370462 35 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370426-370460 0 1.0
NC_017957_3 3.26|370494|35|NC_017957|PILER-CR 370494-370528 35 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370492-370526 0 1.0
NC_017957_3 3.27|370560|34|NC_017957|PILER-CR 370560-370593 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370558-370591 0 1.0
NC_017957_3 3.28|370625|33|NC_017957|PILER-CR 370625-370657 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 370623-370655 0 1.0
NC_017957_4 4.1|412281|32|NC_017957|CRISPRCasFinder,CRT 412281-412312 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 412281-412312 0 1.0
NC_017957_4 4.2|412350|29|NC_017957|CRISPRCasFinder,CRT,PILER-CR 412350-412378 29 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 412350-412378 0 1.0
NC_017957_4 4.3|412416|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 412416-412446 31 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 412416-412446 0 1.0
NC_017957_4 4.4|412484|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 412484-412514 31 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 412484-412514 0 1.0
NC_017957_5 5.1|416177|29|NC_017957|CRISPRCasFinder,CRT 416177-416205 29 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 416177-416205 0 1.0
NC_017957_5 5.2|416243|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416243-416274 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 416243-416274 0 1.0
NC_017957_5 5.3|416312|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416312-416345 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 416312-416345 0 1.0
NC_017957_5 5.4|416383|29|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416383-416411 29 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 416383-416411 0 1.0
NC_017957_5 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416449-416479 31 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 416449-416479 0 1.0
NC_017957_5 5.6|416517|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416517-416547 31 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 416517-416547 0 1.0
NC_017957_5 5.7|416585|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416585-416615 31 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 416585-416615 0 1.0
NC_017957_5 5.8|416653|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416653-416684 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 416653-416684 0 1.0
NC_017957_6 6.1|421943|35|NC_017957|CRISPRCasFinder 421943-421977 35 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 421943-421977 0 1.0
NC_017957_6 6.2|422004|35|NC_017957|CRISPRCasFinder 422004-422038 35 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 422004-422038 0 1.0
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 85670-85700 4 0.871
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 52890-52920 5 0.839
NC_017957_2 2.10|231874|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231874-231907 34 NZ_CP038146 Streptomyces sp. S501 plasmid unnamed, complete sequence 105688-105721 5 0.853
NC_017957_1 1.1|142997|31|NC_017957|PILER-CR 142997-143027 31 NC_008713 Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence 68933-68963 6 0.806
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP023550 Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence 65152-65182 6 0.806
NC_017957_1 1.4|143063|34|NC_017957|CRISPRCasFinder 143063-143096 34 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 85668-85701 6 0.824
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 CP021131 Meiothermus taiwanensis strain WR-220 plasmid pMtWR-220, complete sequence 45599-45631 6 0.818
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 198947-198978 6 0.812
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NC_010373 Methylobacterium sp. 4-46 plasmid pM44601, complete sequence 17875-17906 6 0.812
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NC_010373 Methylobacterium sp. 4-46 plasmid pM44601, complete sequence 17965-17996 6 0.812
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NC_010373 Methylobacterium sp. 4-46 plasmid pM44601, complete sequence 18055-18086 6 0.812
NC_017957_3 3.3|369908|34|NC_017957|CRISPRCasFinder,CRT 369908-369941 34 NZ_CP048426 Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence 138735-138768 6 0.824
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KX388535 Agrobacterium tumefaciens strain EU6 plasmid pTiEU6, complete sequence 126692-126724 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000059 Agrobacterium tumefaciens strain CFBP1898 plasmid pTi_CFBP1898, complete sequence 136834-136866 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 KY000034 Agrobacterium sp. strain C58PMP90 plasmid pTi_C58PMP90, complete sequence 131680-131712 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 KY000036 Agrobacterium sp. strain GV3101 plasmid pTi_GV3101, complete sequence 132945-132977 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_CP042277 Agrobacterium tumefaciens strain 186 plasmid pTi, complete sequence 74364-74396 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_CP032929 Agrobacterium tumefaciens strain 1D1460 plasmid pTi1D1460, complete sequence 111958-111990 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_CP039927 Agrobacterium tumefaciens strain CFBP7129 plasmid pTiCFBP7129, complete sequence 83575-83607 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NC_002147 Agrobacterium tumefaciens MAFF301001 plasmid pTi-SAKURA, complete sequence 121252-121284 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_CP032925 Agrobacterium tumefaciens strain 1D1108 plasmid pTi1D1108, complete sequence 73000-73032 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_AF010180 Agrobacterium fabrum str. C58 plasmid pTiC58, complete sequence 23795-23827 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_CP030831 Neorhizobium sp. NCHU2750 plasmid pTiNCHU2750, complete sequence 173215-173247 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_CP033026 Agrobacterium fabrum strain 1D132 plasmid pTi1D132, complete sequence 74004-74036 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NC_003065 Agrobacterium fabrum str. C58 plasmid Ti, complete sequence 164550-164582 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_MK439382 Agrobacterium tumefaciens strain CFBP2178 plasmid pTiCFBP2178, complete sequence 168572-168604 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_MK439383 Agrobacterium tumefaciens strain CFBP1935 plasmid pTiCFBP1935, complete sequence 163843-163875 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_MK439386 Agrobacterium tumefaciens strain T37 plasmid pTiT37, complete sequence 154097-154129 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_MK318986 Agrobacterium rhizogenes strain C6.5 plasmid pTiC6.5, complete sequence 117461-117493 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_MK439385 Agrobacterium tumefaciens strain Kerr27 plasmid pTiKerr27, complete sequence 194145-194177 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_MK439384 Agrobacterium tumefaciens strain Kerr108 plasmid pTiKerr108, complete sequence 171058-171090 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_MK439381 Agrobacterium tumefaciens strain Sule1 plasmid pTiSule1, complete sequence 168571-168603 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_MF511177 Agrobacterium rhizogenes strain C5.7 plasmid pTiC5.7, complete sequence 117461-117493 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000039 Agrobacterium deltaense strain Tun180 plasmid pTi_Tun180, complete sequence 142636-142668 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000064 Agrobacterium tumefaciens strain CFBP7126 plasmid pTi_CFBP7126, complete sequence 81077-81109 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000069 Agrobacterium deltaense strain Tun176 plasmid pTi_Tun176, complete sequence 120261-120293 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000058 Agrobacterium rhizogenes strain CFBP1317 plasmid pTi_CFBP1317, complete sequence 135700-135732 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000068 Agrobacterium deltaense strain Tun151 plasmid pTi_Tun151, complete sequence 134753-134785 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000070 Agrobacterium tumefaciens strain Tun178 plasmid pTi_Tun178, complete sequence 50901-50933 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000027 Agrobacterium rhizogenes strain CFBP2692 plasmid pTi_CFBP2692, complete sequence 147367-147399 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000031 Agrobacterium genomosp. 1 strain Tun198 plasmid pTi_Tun198, complete sequence 35981-36013 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000041 Agrobacterium tumefaciens strain CFBP296 plasmid pTi_CFBP296, complete sequence 175884-175916 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000065 Agrobacterium tumefaciens strain CFBP7128 plasmid pTi_CFBP7128, complete sequence 88156-88188 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000028 Agrobacterium genomosp. 1 strain CFBP2712 plasmid pTi_CFBP2712, complete sequence 126000-126032 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000066 Agrobacterium deltaense strain CFBP7129 plasmid pTi_CFBP7129, complete sequence 92215-92247 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000044 Agrobacterium fabrum strain CFBP1933 plasmid pTi_CFBP1933, complete sequence 110180-110212 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000050 Agrobacterium tumefaciens strain CFBP4442 plasmid pTi_CFBP4442, complete sequence 50978-51010 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000062 Agrobacterium genomosp. 3 strain CFBP4424 plasmid pTi_CFBP4424, complete sequence 185325-185357 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000073 Agrobacterium tumefaciens strain Tun188 plasmid pTi_Tun188, complete sequence 124358-124390 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000057 Agrobacterium fabrum strain CFBP5505 plasmid pTi_CFBP5505, complete sequence 153620-153652 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000071 Agrobacterium tumefaciens strain Tun183 plasmid pTi_Tun183, complete sequence 54442-54474 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000047 Agrobacterium genomosp. 1 strain CFBP2516 plasmid pTi_CFBP2516, complete sequence 37068-37100 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000046 Agrobacterium genomosp. 1 strain CFBP2177 plasmid pTi_CFBP2177, complete sequence 128331-128363 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000051 Agrobacterium genomosp. 1 strain CFBP5503 plasmid pTi_CFBP5503, complete sequence 185117-185149 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000063 Agrobacterium fabrum strain CFBP6549 plasmid pTi_CFBP6549, complete sequence 73889-73921 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000052 Agrobacterium tumefaciens strain CFBP7000 plasmid pTi_CFBP7000, complete sequence 27975-28007 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000049 Agrobacterium rhizogenes strain CFBP4423 plasmid pTi_CFBP4423, complete sequence 193781-193813 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000055 Agrobacterium rubi strain Tun159 plasmid pTi_Tun159, complete sequence 56861-56893 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000043 Agrobacterium rhizogenes strain CFBP1905 plasmid pTi_CFBP1905, complete sequence 202624-202656 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000048 Agrobacterium rhizogenes strain CFBP2746 plasmid pTi_CFBP2746, complete sequence 113265-113297 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000053 Agrobacterium genomosp. 1 strain DC12-001 plasmid pTi_DC12-001, complete sequence 193459-193491 6 0.818
NC_017957_3 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT 370362-370394 33 NZ_KY000054 Agrobacterium tumefaciens strain Tun154 plasmid pTi_Tun154, complete sequence 210842-210874 6 0.818
NC_017957_3 3.11|370426|35|NC_017957|CRISPRCasFinder,CRT 370426-370460 35 NC_004808 Streptomyces rochei plasmid pSLA2-L DNA, complete sequence 186356-186390 6 0.829
NC_017957_3 3.17|369910|34|NC_017957|PILER-CR 369910-369943 34 NZ_CP048426 Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence 138735-138768 6 0.824
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KX388535 Agrobacterium tumefaciens strain EU6 plasmid pTiEU6, complete sequence 126692-126724 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000059 Agrobacterium tumefaciens strain CFBP1898 plasmid pTi_CFBP1898, complete sequence 136834-136866 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 KY000034 Agrobacterium sp. strain C58PMP90 plasmid pTi_C58PMP90, complete sequence 131680-131712 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 KY000036 Agrobacterium sp. strain GV3101 plasmid pTi_GV3101, complete sequence 132945-132977 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_CP042277 Agrobacterium tumefaciens strain 186 plasmid pTi, complete sequence 74364-74396 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_CP032929 Agrobacterium tumefaciens strain 1D1460 plasmid pTi1D1460, complete sequence 111958-111990 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_CP039927 Agrobacterium tumefaciens strain CFBP7129 plasmid pTiCFBP7129, complete sequence 83575-83607 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NC_002147 Agrobacterium tumefaciens MAFF301001 plasmid pTi-SAKURA, complete sequence 121252-121284 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_CP032925 Agrobacterium tumefaciens strain 1D1108 plasmid pTi1D1108, complete sequence 73000-73032 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_AF010180 Agrobacterium fabrum str. C58 plasmid pTiC58, complete sequence 23795-23827 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_CP030831 Neorhizobium sp. NCHU2750 plasmid pTiNCHU2750, complete sequence 173215-173247 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_CP033026 Agrobacterium fabrum strain 1D132 plasmid pTi1D132, complete sequence 74004-74036 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NC_003065 Agrobacterium fabrum str. C58 plasmid Ti, complete sequence 164550-164582 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_MK439382 Agrobacterium tumefaciens strain CFBP2178 plasmid pTiCFBP2178, complete sequence 168572-168604 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_MK439383 Agrobacterium tumefaciens strain CFBP1935 plasmid pTiCFBP1935, complete sequence 163843-163875 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_MK439386 Agrobacterium tumefaciens strain T37 plasmid pTiT37, complete sequence 154097-154129 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_MK318986 Agrobacterium rhizogenes strain C6.5 plasmid pTiC6.5, complete sequence 117461-117493 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_MK439385 Agrobacterium tumefaciens strain Kerr27 plasmid pTiKerr27, complete sequence 194145-194177 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_MK439384 Agrobacterium tumefaciens strain Kerr108 plasmid pTiKerr108, complete sequence 171058-171090 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_MK439381 Agrobacterium tumefaciens strain Sule1 plasmid pTiSule1, complete sequence 168571-168603 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_MF511177 Agrobacterium rhizogenes strain C5.7 plasmid pTiC5.7, complete sequence 117461-117493 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000039 Agrobacterium deltaense strain Tun180 plasmid pTi_Tun180, complete sequence 142636-142668 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000064 Agrobacterium tumefaciens strain CFBP7126 plasmid pTi_CFBP7126, complete sequence 81077-81109 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000069 Agrobacterium deltaense strain Tun176 plasmid pTi_Tun176, complete sequence 120261-120293 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000058 Agrobacterium rhizogenes strain CFBP1317 plasmid pTi_CFBP1317, complete sequence 135700-135732 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000068 Agrobacterium deltaense strain Tun151 plasmid pTi_Tun151, complete sequence 134753-134785 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000070 Agrobacterium tumefaciens strain Tun178 plasmid pTi_Tun178, complete sequence 50901-50933 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000027 Agrobacterium rhizogenes strain CFBP2692 plasmid pTi_CFBP2692, complete sequence 147367-147399 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000031 Agrobacterium genomosp. 1 strain Tun198 plasmid pTi_Tun198, complete sequence 35981-36013 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000041 Agrobacterium tumefaciens strain CFBP296 plasmid pTi_CFBP296, complete sequence 175884-175916 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000065 Agrobacterium tumefaciens strain CFBP7128 plasmid pTi_CFBP7128, complete sequence 88156-88188 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000028 Agrobacterium genomosp. 1 strain CFBP2712 plasmid pTi_CFBP2712, complete sequence 126000-126032 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000066 Agrobacterium deltaense strain CFBP7129 plasmid pTi_CFBP7129, complete sequence 92215-92247 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000044 Agrobacterium fabrum strain CFBP1933 plasmid pTi_CFBP1933, complete sequence 110180-110212 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000050 Agrobacterium tumefaciens strain CFBP4442 plasmid pTi_CFBP4442, complete sequence 50978-51010 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000062 Agrobacterium genomosp. 3 strain CFBP4424 plasmid pTi_CFBP4424, complete sequence 185325-185357 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000073 Agrobacterium tumefaciens strain Tun188 plasmid pTi_Tun188, complete sequence 124358-124390 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000057 Agrobacterium fabrum strain CFBP5505 plasmid pTi_CFBP5505, complete sequence 153620-153652 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000071 Agrobacterium tumefaciens strain Tun183 plasmid pTi_Tun183, complete sequence 54442-54474 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000047 Agrobacterium genomosp. 1 strain CFBP2516 plasmid pTi_CFBP2516, complete sequence 37068-37100 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000046 Agrobacterium genomosp. 1 strain CFBP2177 plasmid pTi_CFBP2177, complete sequence 128331-128363 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000051 Agrobacterium genomosp. 1 strain CFBP5503 plasmid pTi_CFBP5503, complete sequence 185117-185149 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000063 Agrobacterium fabrum strain CFBP6549 plasmid pTi_CFBP6549, complete sequence 73889-73921 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000052 Agrobacterium tumefaciens strain CFBP7000 plasmid pTi_CFBP7000, complete sequence 27975-28007 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000049 Agrobacterium rhizogenes strain CFBP4423 plasmid pTi_CFBP4423, complete sequence 193781-193813 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000055 Agrobacterium rubi strain Tun159 plasmid pTi_Tun159, complete sequence 56861-56893 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000043 Agrobacterium rhizogenes strain CFBP1905 plasmid pTi_CFBP1905, complete sequence 202624-202656 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000048 Agrobacterium rhizogenes strain CFBP2746 plasmid pTi_CFBP2746, complete sequence 113265-113297 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000053 Agrobacterium genomosp. 1 strain DC12-001 plasmid pTi_DC12-001, complete sequence 193459-193491 6 0.818
NC_017957_3 3.24|370364|33|NC_017957|PILER-CR 370364-370396 33 NZ_KY000054 Agrobacterium tumefaciens strain Tun154 plasmid pTi_Tun154, complete sequence 210842-210874 6 0.818
NC_017957_3 3.25|370428|35|NC_017957|PILER-CR 370428-370462 35 NC_004808 Streptomyces rochei plasmid pSLA2-L DNA, complete sequence 186356-186390 6 0.829
NC_017957_4 4.2|412350|29|NC_017957|CRISPRCasFinder,CRT,PILER-CR 412350-412378 29 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 378309-378337 6 0.793
NC_017957_4 4.2|412350|29|NC_017957|CRISPRCasFinder,CRT,PILER-CR 412350-412378 29 NZ_CP014797 Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence 80388-80416 6 0.793
NC_017957_5 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416449-416479 31 MH697583 Mycobacterium phage EricMillard, complete genome 33349-33379 6 0.806
NC_017957_5 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416449-416479 31 MH727551 Mycobacterium phage Kalah2, complete genome 33399-33429 6 0.806
NC_017957_5 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416449-416479 31 MH077579 Mycobacterium phage Halley, complete genome 33062-33092 6 0.806
NC_017957_5 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416449-416479 31 MH669017 Mycobacterium phage Zelink, complete genome 34143-34173 6 0.806
NC_017957_5 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416449-416479 31 MN062701 Mycobacterium phage Dallas, complete genome 32588-32618 6 0.806
NC_017957_5 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416449-416479 31 MK524527 Mycobacterium phage ThreeRngTarjay, complete genome 33199-33229 6 0.806
NC_017957_5 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416449-416479 31 MK524529 Mycobacterium phage Phoebus, complete genome 33349-33379 6 0.806
NC_017957_5 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416449-416479 31 MF919512 Mycobacterium phage Klein, complete genome 32623-32653 6 0.806
NC_017957_5 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416449-416479 31 KF114875 Mycobacterium phage Redno2, complete genome 32812-32842 6 0.806
NC_017957_5 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416449-416479 31 MK967379 Mycobacterium phage HokkenD, complete genome 32611-32641 6 0.806
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4445862-4445892 7 0.774
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 680842-680872 7 0.774
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NC_008043 Ruegeria sp. TM1040 megaplasmid, complete sequence 494322-494352 7 0.774
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 775473-775503 7 0.774
NC_017957_1 1.4|143063|34|NC_017957|CRISPRCasFinder 143063-143096 34 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 52888-52921 7 0.794
NC_017957_2 2.1|231292|34|NC_017957|CRISPRCasFinder,CRT 231292-231325 34 NZ_AP022338 Mameliella alba strain KU6B plasmid pKUB257, complete sequence 25816-25849 7 0.794
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 NC_008537 Arthrobacter sp. FB24 plasmid 1, complete sequence 40434-40466 7 0.788
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 253033-253064 7 0.781
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NC_008537 Arthrobacter sp. FB24 plasmid 1, complete sequence 40831-40862 7 0.781
NC_017957_3 3.13|370558|34|NC_017957|CRISPRCasFinder,CRT 370558-370591 34 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 909720-909753 7 0.794
NC_017957_3 3.27|370560|34|NC_017957|PILER-CR 370560-370593 34 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 909720-909753 7 0.794
NC_017957_4 4.2|412350|29|NC_017957|CRISPRCasFinder,CRT,PILER-CR 412350-412378 29 NZ_CP040721 Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence 94144-94172 7 0.759
NC_017957_4 4.2|412350|29|NC_017957|CRISPRCasFinder,CRT,PILER-CR 412350-412378 29 AP018486 Mycobacterium phage PP DNA, complete genome 14490-14518 7 0.759
NC_017957_4 4.2|412350|29|NC_017957|CRISPRCasFinder,CRT,PILER-CR 412350-412378 29 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 316574-316602 7 0.759
NC_017957_5 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416449-416479 31 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 76981-77011 7 0.774
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1744005-1744035 8 0.742
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1623243-1623273 8 0.742
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_LR134447 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence 48922-48952 8 0.742
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 953342-953372 8 0.742
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NC_041921 Dinoroseobacter phage vB_DshS-R5C, complete genome 52351-52381 8 0.742
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP032520 Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence 340350-340380 8 0.742
NC_017957_1 1.4|143063|34|NC_017957|CRISPRCasFinder 143063-143096 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3204725-3204758 8 0.765
NC_017957_1 1.4|143063|34|NC_017957|CRISPRCasFinder 143063-143096 34 NZ_CP024907 Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence 319126-319159 8 0.765
NC_017957_2 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT 231357-231390 34 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 198946-198979 8 0.765
NC_017957_2 2.7|231680|34|NC_017957|CRISPRCasFinder,CRT 231680-231713 34 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 458567-458600 8 0.765
NC_017957_2 2.7|231680|34|NC_017957|CRISPRCasFinder,CRT 231680-231713 34 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 44972-45005 8 0.765
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MG925339 Mycobacterium phage Chunky, complete genome 20994-21026 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MH779500 Mycobacterium phage Crownjwl, complete genome 20761-20793 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MH230875 Mycobacterium phage CheetO, complete genome 20988-21020 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MK279908 Mycobacterium phage Roliet, complete genome 20985-21017 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MN096366 Mycobacterium phage AbsoluteMadLad, complete genome 20993-21025 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MT897902 Mycobacterium phage Boehler, complete genome 20994-21026 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 JX649096 Mycobacterium phage Serpentine, complete genome 20994-21026 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MK494104 Mycobacterium phage HenryJackson, complete genome 20710-20742 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 JX649099 Mycobacterium phage Gyarad, complete genome 20991-21023 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MT897903 Mycobacterium phage DirtJuice, complete genome 20977-21009 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MG962362 Mycobacterium phage AltPhacts, complete genome 20971-21003 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 KC661274 Mycobacterium phage SDcharge11, complete genome 20963-20995 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MF919503 Mycobacterium phage Dingo, complete genome 20971-21003 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 JX649100 Mycobacterium phage Alex, complete genome 20994-21026 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MH399786 Mycobacterium phage PhrodoBaggins, complete genome 20982-21014 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 KF713485 Mycobacterium phage Suffolk, complete genome 20991-21023 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 NC_028803 Mycobacterium phage OSmaximus, complete genome 21023-21055 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MF919523 Mycobacterium phage Mikota, complete genome 20975-21007 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 KP027209 Mycobacterium phage Sigman, complete genome 20979-21011 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MK279877 Mycobacterium phage Roscoe, complete genome 21223-21255 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 JN698989 Mycobacterium phage JacAttac, complete genome 20979-21011 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MK524526 Mycobacterium phage Robyn, complete genome 20560-20592 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MN444868 Mycobacterium phage Prickles, complete genome 20983-21015 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MH371117 Mycobacterium phage Kahve, complete genome 20707-20739 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MF919530 Mycobacterium phage Sheila, complete genome 20983-21015 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MG925356 Mycobacterium phage OliverWalter, complete genome 20997-21029 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 JX649098 Mycobacterium phage Nacho, complete genome 20988-21020 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MH926060 Mycobacterium phage Schadenfreude, complete genome 20543-20575 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MT889369 Mycobacterium phage Inchworm, complete genome 20979-21011 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 GQ303259 Mycobacterium phage Colbert, complete genome 21047-21079 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 JX649097 Mycobacterium phage Piglet, complete genome 20994-21026 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 KJ538723 Mycobacterium phage KingVeVeVe, complete genome 20972-21004 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 NC_021310 Mycobacterium phage Newman, complete genome 20984-21016 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 KJ174157 Mycobacterium phage Soto, complete genome 20997-21029 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 JF704099 Mycobacterium phage KLucky39, complete sequence 20991-21023 8 0.758
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 MF919507 Mycobacterium phage Horchata, complete genome 20981-21013 8 0.758
NC_017957_2 2.10|231874|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231874-231907 34 KX961385 Bordetella virus LK3, complete genome 28921-28954 8 0.765
NC_017957_2 2.10|231874|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231874-231907 34 KY000220 Bordetella phage FP1, complete genome 4244-4277 8 0.765
NC_017957_2 2.10|231874|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231874-231907 34 KY000221 Bordetella phage CN1, complete genome 4306-4339 8 0.765
NC_017957_2 2.10|231874|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231874-231907 34 NC_047877 Bordetella phage CN2, complete genome 4321-4354 8 0.765
NC_017957_2 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232266-232299 34 NZ_CP046906 Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence 74532-74565 8 0.765
NC_017957_2 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232266-232299 34 MH910042 Mycobacterium phage Scarlett, complete genome 3997-4030 8 0.765
NC_017957_2 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232266-232299 34 MH910038 Mycobacterium phage LeMond, complete genome 3997-4030 8 0.765
NC_017957_2 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232266-232299 34 MH910039 Mycobacterium phage Oscar, complete genome 3998-4031 8 0.765
NC_017957_2 2.20|232526|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232526-232557 32 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1657649-1657680 8 0.75
NC_017957_2 2.20|232526|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232526-232557 32 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 28242-28273 8 0.75
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 67963-67994 8 0.75
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 475042-475073 8 0.75
NC_017957_3 3.1|369777|34|NC_017957|CRISPRCasFinder,CRT 369777-369810 34 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 11125-11158 8 0.765
NC_017957_3 3.3|369908|34|NC_017957|CRISPRCasFinder,CRT 369908-369941 34 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 208836-208869 8 0.765
NC_017957_3 3.15|369779|34|NC_017957|PILER-CR 369779-369812 34 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 11125-11158 8 0.765
NC_017957_3 3.17|369910|34|NC_017957|PILER-CR 369910-369943 34 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 208836-208869 8 0.765
NC_017957_4 4.2|412350|29|NC_017957|CRISPRCasFinder,CRT,PILER-CR 412350-412378 29 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 151579-151607 8 0.724
NC_017957_4 4.4|412484|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 412484-412514 31 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 256880-256910 8 0.742
NC_017957_5 5.1|416177|29|NC_017957|CRISPRCasFinder,CRT 416177-416205 29 NZ_CP030829 Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence 387853-387881 8 0.724
NC_017957_5 5.2|416243|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416243-416274 32 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 800590-800621 8 0.75
NC_017957_5 5.2|416243|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416243-416274 32 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 135596-135627 8 0.75
NC_017957_5 5.2|416243|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416243-416274 32 NZ_CP018172 Mesorhizobium oceanicum strain B7 plasmid unnamed1, complete sequence 65035-65066 8 0.75
NC_017957_5 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416449-416479 31 MK864263 Gordonia phage Melba, complete genome 41077-41107 8 0.742
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1008474-1008504 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 383663-383693 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1429405-1429435 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 2053004-2053034 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 82675-82705 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP024907 Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence 319128-319158 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 2015401-2015431 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1825418-1825448 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1921043-1921073 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 750805-750835 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 2035725-2035755 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1987815-1987845 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 343798-343828 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1825572-1825602 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 60335-60365 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 532281-532311 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 495676-495706 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 408905-408935 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 508068-508098 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1199203-1199233 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1836537-1836567 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1875721-1875751 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1953291-1953321 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1876033-1876063 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1953291-1953321 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1875721-1875751 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1874924-1874954 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1953291-1953321 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1953291-1953321 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1953291-1953321 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1950606-1950636 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1876032-1876062 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1914054-1914084 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1953296-1953326 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 2030228-2030258 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 2030228-2030258 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1877095-1877125 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 104924-104954 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1896093-1896123 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1775705-1775735 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1769994-1770024 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1845901-1845931 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1903512-1903542 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1774725-1774755 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1899538-1899568 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1775715-1775745 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1775099-1775129 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1775685-1775715 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1899720-1899750 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1987835-1987865 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 108841-108871 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1877285-1877315 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1877282-1877312 9 0.71
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1877247-1877277 9 0.71
NC_017957_1 1.3|142996|34|NC_017957|CRISPRCasFinder 142996-143029 34 NC_008713 Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence 68932-68965 9 0.735
NC_017957_1 1.4|143063|34|NC_017957|CRISPRCasFinder 143063-143096 34 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 680841-680874 9 0.735
NC_017957_2 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT 231357-231390 34 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 67962-67995 9 0.735
NC_017957_2 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT 231357-231390 34 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1188415-1188448 9 0.735
NC_017957_2 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT 231357-231390 34 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1142995-1143028 9 0.735
NC_017957_2 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT 231357-231390 34 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1142984-1143017 9 0.735
NC_017957_2 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT 231357-231390 34 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1143002-1143035 9 0.735
NC_017957_2 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT 231357-231390 34 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1070780-1070813 9 0.735
NC_017957_2 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT 231357-231390 34 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1027902-1027935 9 0.735
NC_017957_2 2.7|231680|34|NC_017957|CRISPRCasFinder,CRT 231680-231713 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1330921-1330954 9 0.735
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 NZ_CP039919 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626b, complete sequence 51828-51860 9 0.727
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 528226-528258 9 0.727
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 374087-374119 9 0.727
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 NZ_CP020332 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM259, complete sequence 52111-52143 9 0.727
NC_017957_2 2.9|231809|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231809-231842 34 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 327139-327172 9 0.735
NC_017957_2 2.10|231874|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231874-231907 34 NC_004808 Streptomyces rochei plasmid pSLA2-L DNA, complete sequence 72853-72886 9 0.735
NC_017957_2 2.10|231874|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231874-231907 34 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 517615-517648 9 0.735
NC_017957_2 2.20|232526|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232526-232557 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3500445-3500476 9 0.719
NC_017957_2 2.20|232526|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232526-232557 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1617055-1617086 9 0.719
NC_017957_2 2.20|232526|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232526-232557 32 NC_009806 Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence 61580-61611 9 0.719
NC_017957_2 2.20|232526|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232526-232557 32 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 153318-153349 9 0.719
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NZ_CP030128 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence 357443-357474 9 0.719
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1188416-1188447 9 0.719
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1142996-1143027 9 0.719
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 141985-142016 9 0.719
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1142985-1143016 9 0.719
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1143003-1143034 9 0.719
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 17801-17832 9 0.719
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1070781-1070812 9 0.719
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1027903-1027934 9 0.719
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 104101-104132 9 0.719
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 LN997844 Streptomyces reticuli genome assembly TUE45, plasmid : III 39044-39075 9 0.719
NC_017957_2 2.22|231424|31|NC_017957|PILER-CR 231424-231454 31 NZ_CP011296 Rhodococcus erythropolis strain BG43 plasmid pRLCBG43, complete sequence 208947-208977 9 0.71
NC_017957_3 3.1|369777|34|NC_017957|CRISPRCasFinder,CRT 369777-369810 34 NZ_CP054618 Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence 353738-353771 9 0.735
NC_017957_3 3.3|369908|34|NC_017957|CRISPRCasFinder,CRT 369908-369941 34 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 322509-322542 9 0.735
NC_017957_3 3.3|369908|34|NC_017957|CRISPRCasFinder,CRT 369908-369941 34 NZ_CP021133 Pseudomonas fragi strain NMC25 plasmid unnamed1, complete sequence 29963-29996 9 0.735
NC_017957_3 3.3|369908|34|NC_017957|CRISPRCasFinder,CRT 369908-369941 34 MT711887 Pseudomonas phage Stalingrad, complete genome 10090-10123 9 0.735
NC_017957_3 3.8|370234|33|NC_017957|CRISPRCasFinder,CRT 370234-370266 33 NC_012797 Desulfovibrio magneticus RS-1 plasmid pDMC1, complete sequence 30137-30169 9 0.727
NC_017957_3 3.13|370558|34|NC_017957|CRISPRCasFinder,CRT 370558-370591 34 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 394393-394426 9 0.735
NC_017957_3 3.15|369779|34|NC_017957|PILER-CR 369779-369812 34 NZ_CP054618 Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence 353738-353771 9 0.735
NC_017957_3 3.17|369910|34|NC_017957|PILER-CR 369910-369943 34 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 322509-322542 9 0.735
NC_017957_3 3.17|369910|34|NC_017957|PILER-CR 369910-369943 34 NZ_CP021133 Pseudomonas fragi strain NMC25 plasmid unnamed1, complete sequence 29963-29996 9 0.735
NC_017957_3 3.17|369910|34|NC_017957|PILER-CR 369910-369943 34 MT711887 Pseudomonas phage Stalingrad, complete genome 10090-10123 9 0.735
NC_017957_3 3.22|370236|33|NC_017957|PILER-CR 370236-370268 33 NC_012797 Desulfovibrio magneticus RS-1 plasmid pDMC1, complete sequence 30137-30169 9 0.727
NC_017957_3 3.27|370560|34|NC_017957|PILER-CR 370560-370593 34 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 394393-394426 9 0.735
NC_017957_5 5.2|416243|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416243-416274 32 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 205250-205281 9 0.719
NC_017957_5 5.6|416517|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416517-416547 31 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 157227-157257 9 0.71
NC_017957_5 5.8|416653|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416653-416684 32 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 370684-370715 9 0.719
NC_017957_5 5.8|416653|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR 416653-416684 32 CP000620 Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence 94078-94109 9 0.719
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 MH910038 Mycobacterium phage LeMond, complete genome 22931-22961 10 0.677
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 MH910039 Mycobacterium phage Oscar, complete genome 22932-22962 10 0.677
NC_017957_1 1.2|143064|31|NC_017957|PILER-CR 143064-143094 31 MK376955 Mycobacterium phage KiSi, complete genome 22860-22890 10 0.677
NC_017957_1 1.4|143063|34|NC_017957|CRISPRCasFinder 143063-143096 34 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 953341-953374 10 0.706
NC_017957_1 1.4|143063|34|NC_017957|CRISPRCasFinder 143063-143096 34 NZ_CP032520 Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence 340348-340381 10 0.706
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 NC_011892 Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence 156849-156881 10 0.697
NC_017957_2 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232266-232299 34 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 699958-699991 10 0.706
NC_017957_2 2.20|232526|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232526-232557 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 557322-557353 10 0.688
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NC_008703 Mycobacterium sp. KMS plasmid pMKMS01, complete sequence 258869-258900 10 0.688
NC_017957_2 2.21|231359|32|NC_017957|PILER-CR 231359-231390 32 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 1075905-1075936 10 0.688
NC_017957_3 3.3|369908|34|NC_017957|CRISPRCasFinder,CRT 369908-369941 34 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 293208-293241 10 0.706
NC_017957_3 3.3|369908|34|NC_017957|CRISPRCasFinder,CRT 369908-369941 34 NZ_CP010870 Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6001, complete sequence 22475-22508 10 0.706
NC_017957_3 3.11|370426|35|NC_017957|CRISPRCasFinder,CRT 370426-370460 35 NZ_CP022991 Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence 608768-608802 10 0.714
NC_017957_3 3.17|369910|34|NC_017957|PILER-CR 369910-369943 34 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 293208-293241 10 0.706
NC_017957_3 3.17|369910|34|NC_017957|PILER-CR 369910-369943 34 NZ_CP010870 Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6001, complete sequence 22475-22508 10 0.706
NC_017957_3 3.25|370428|35|NC_017957|PILER-CR 370428-370462 35 NZ_CP022991 Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence 608768-608802 10 0.714
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP026855 Escherichia coli strain MS7163 plasmid pMS7163B, complete sequence 10252-10286 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP027383 Escherichia coli strain 2013C-3250 plasmid unnamed3 27127-27161 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 CP054459 Escherichia coli strain SCU-103 plasmid pSCU-103-2 49927-49961 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 CP054460 Escherichia coli strain SCU-103 plasmid pSCU-103-3 10356-10390 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP024254 Escherichia coli strain ATCC 43886 plasmid unnamed1, complete sequence 26411-26445 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 CP025878 Escherichia coli strain 503458 plasmid p503458_84, complete sequence 75649-75683 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP033883 Escherichia coli strain 50579417 plasmid p50579417_2, complete sequence 2674-2708 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 CP027378 Escherichia coli strain 2013C-4404 plasmid unnamed2 34337-34371 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 CP027379 Escherichia coli strain 2013C-4404 plasmid unnamed3, complete sequence 51601-51635 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP025625 Escherichia coli strain SCEC020007 plasmid pBOKZ_020007, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_AP017613 Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_3, complete sequence 37914-37948 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NC_022996 Escherichia coli plasmid pO26-CRL-125, complete sequence 1623-1657 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP025855 Escherichia coli strain 510016 plasmid p510016_84, complete sequence 61277-61311 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NC_022992 Escherichia coli plasmid pO111-CRL-115, complete sequence 1623-1657 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP053733 Escherichia coli strain CP55_Sichuan plasmid pCP55-141k, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP024887 Escherichia coli strain AR_0017 plasmid unitig_1_pilon, complete sequence 60512-60546 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 MN334219 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm32 plasmid pSTM32_108, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 MN334220 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm37 plasmid pSTM37-118, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_AP018803 Escherichia coli strain E2863 plasmid pE2863-1, complete sequence 905-939 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP040264 Escherichia coli strain 631 plasmid pEc631_1, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP027600 Escherichia coli strain 97-3250 plasmid unnamed1, complete sequence 77799-77833 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_LT985320 Escherichia coli strain ECOR 3 genome assembly, plasmid: RCS85_pII 75844-75878 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP051702 Escherichia coli strain SCU-125 plasmid pSCU-125-2, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP051720 Escherichia coli strain SCU-116 plasmid pSCU-116-1, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP023387 Escherichia coli strain 1190 plasmid p86, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 74976-75010 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NC_025138 Escherichia coli plasmid pH2332-107, complete sequence 93268-93302 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP027324 Escherichia coli strain 2013C-3033 plasmid unnamed, complete sequence 110697-110731 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP013024 Escherichia coli strain 2009C-3133 plasmid unnamed1, complete sequence 37916-37950 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 1024-1058 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 CP025926 Escherichia coli strain 520873 plasmid p520873_84, complete sequence 23106-23140 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 CP025889 Escherichia coli strain 503046 plasmid p503046_85, complete sequence 804-838 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 53785-53819 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 CP054380 Escherichia coli strain SCU-175 plasmid pSCU-175-1, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_AP019762 Escherichia coli O111:H- strain 110512 plasmid pO111-110512_1, complete sequence 1199-1233 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 MN335638 Escherichia coli strain SFE199 plasmid pSFE199, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 MN335639 Escherichia coli strain SFE059 plasmid pSFE059, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 MN335640 Escherichia coli strain OT-ESBL-0589 plasmid pOT-ESBL-0589, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_AP018797 Escherichia coli strain E2855 plasmid pE2855-1, complete sequence 905-939 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 CP027673 Escherichia coli strain 2014C-3003 plasmid unnamed1 58682-58716 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 CP052260 Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-2, complete sequence 921-955 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_CP019011 Escherichia coli strain Ecol_AZ161 plasmid pECAZ161_1, complete sequence 47155-47189 11 0.686
NC_017957_2 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT 231614-231648 35 NZ_MF156268 Escherichia coli strain 3-S1R plasmid pCERC10, complete sequence 1416-1450 11 0.686
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1421949-1421981 11 0.667
NC_017957_2 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231745-231777 33 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 710420-710452 11 0.667
NC_017957_2 2.11|231939|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231939-231972 34 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 106753-106786 11 0.676
NC_017957_2 2.11|231939|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231939-231972 34 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 106191-106224 11 0.676
NC_017957_2 2.11|231939|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231939-231972 34 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 105076-105109 11 0.676
NC_017957_2 2.11|231939|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231939-231972 34 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 106753-106786 11 0.676
NC_017957_2 2.11|231939|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 231939-231972 34 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 105076-105109 11 0.676
NC_017957_2 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232266-232299 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 102824-102857 11 0.676
NC_017957_2 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232266-232299 34 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 102585-102618 11 0.676
NC_017957_2 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR 232266-232299 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 102669-102702 11 0.676
NC_017957_1 1.4|143063|34|NC_017957|CRISPRCasFinder 143063-143096 34 MH910038 Mycobacterium phage LeMond, complete genome 22930-22963 12 0.647
NC_017957_1 1.4|143063|34|NC_017957|CRISPRCasFinder 143063-143096 34 MH910039 Mycobacterium phage Oscar, complete genome 22931-22964 12 0.647
NC_017957_1 1.4|143063|34|NC_017957|CRISPRCasFinder 143063-143096 34 MK376955 Mycobacterium phage KiSi, complete genome 22859-22892 12 0.647

1. spacer 1.1|142997|31|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcttcagggggccgatgaccgaggcacagc	CRISPR spacer
ggcttcagggggccgatgaccgaggcacagc	Protospacer
*******************************

2. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
gtcgcgcccacccgcacgccgaccgcggcga	Protospacer
*******************************

3. spacer 1.3|142996|34|NC_017957|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

cggcttcagggggccgatgaccgaggcacagcgc	CRISPR spacer
cggcttcagggggccgatgaccgaggcacagcgc	Protospacer
**********************************

4. spacer 1.4|143063|34|NC_017957|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

agtcgcgcccacccgcacgccgaccgcggcgacg	CRISPR spacer
agtcgcgcccacccgcacgccgaccgcggcgacg	Protospacer
**********************************

5. spacer 2.1|231292|34|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

gcggggcaccggtacagcgtggaagcccgcgcga	CRISPR spacer
gcggggcaccggtacagcgtggaagcccgcgcga	Protospacer
**********************************

6. spacer 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

cggatcagtgccccgggggcggcggcgctgaccc	CRISPR spacer
cggatcagtgccccgggggcggcggcgctgaccc	Protospacer
**********************************

7. spacer 2.3|231422|33|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

gaaatcgactttgtcgaggtggcgcgatctggc	CRISPR spacer
gaaatcgactttgtcgaggtggcgcgatctggc	Protospacer
*********************************

8. spacer 2.4|231486|33|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgccaaaacgcgcgtctgacgattcaccgtggc	CRISPR spacer
cgccaaaacgcgcgtctgacgattcaccgtggc	Protospacer
*********************************

9. spacer 2.5|231550|33|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

cctgagtgtgtaaccgcactcacgaatcaaatc	CRISPR spacer
cctgagtgtgtaaccgcactcacgaatcaaatc	Protospacer
*********************************

10. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
cactggagcccggcgacgctcaaaaaaaccttcgg	Protospacer
***********************************

11. spacer 2.7|231680|34|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

acgcccgaggccgatcctggcgatggtgccgccg	CRISPR spacer
acgcccgaggccgatcctggcgatggtgccgccg	Protospacer
**********************************

12. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
tggccatcgccgcggccctggaagcggagggcc	Protospacer
*********************************

13. spacer 2.9|231809|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtacttccggaacggcgaggccgtgaacgtaaa	CRISPR spacer
cgtacttccggaacggcgaggccgtgaacgtaaa	Protospacer
**********************************

14. spacer 2.10|231874|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

agctgccgcggcgcccgcgcccggaccatcccgt	CRISPR spacer
agctgccgcggcgcccgcgcccggaccatcccgt	Protospacer
**********************************

15. spacer 2.11|231939|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

tggttggttgatgtcaggctgcatcaggggtctc	CRISPR spacer
tggttggttgatgtcaggctgcatcaggggtctc	Protospacer
**********************************

16. spacer 2.12|232004|36|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

gcggcgcgctcgaccaggtattccatagccgcggac	CRISPR spacer
gcggcgcgctcgaccaggtattccatagccgcggac	Protospacer
************************************

17. spacer 2.13|232071|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

gacgcctgcgtggccttcgcaggtcacgatctg	CRISPR spacer
gacgcctgcgtggccttcgcaggtcacgatctg	Protospacer
*********************************

18. spacer 2.14|232135|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

catgcccacgatattcgcgcgagcaggcgggcgc	CRISPR spacer
catgcccacgatattcgcgcgagcaggcgggcgc	Protospacer
**********************************

19. spacer 2.15|232200|35|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgggtcggatcttggctggaggaggcttcctgatg	CRISPR spacer
cgggtcggatcttggctggaggaggcttcctgatg	Protospacer
***********************************

20. spacer 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

gactcggacgcactggccgccgcggaggacaacc	CRISPR spacer
gactcggacgcactggccgccgcggaggacaacc	Protospacer
**********************************

21. spacer 2.17|232331|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcggcgtcggcgaaggcggacatcaagcccga	CRISPR spacer
cgtcggcgtcggcgaaggcggacatcaagcccga	Protospacer
**********************************

22. spacer 2.18|232396|35|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

acggccgagcgcccaagctatgccgagcgacgcac	CRISPR spacer
acggccgagcgcccaagctatgccgagcgacgcac	Protospacer
***********************************

23. spacer 2.19|232462|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

acggcatcggatttgatgccgtcgaaaggagcg	CRISPR spacer
acggcatcggatttgatgccgtcgaaaggagcg	Protospacer
*********************************

24. spacer 2.20|232526|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggctgcccgacggcacgccgtgcaccacg	CRISPR spacer
ttcggctgcccgacggcacgccgtgcaccacg	Protospacer
********************************

25. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

ggatcagtgccccgggggcggcggcgctgacc	CRISPR spacer
ggatcagtgccccgggggcggcggcgctgacc	Protospacer
********************************

26. spacer 2.22|231424|31|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

aaatcgactttgtcgaggtggcgcgatctgg	CRISPR spacer
aaatcgactttgtcgaggtggcgcgatctgg	Protospacer
*******************************

27. spacer 2.23|231488|31|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccaaaacgcgcgtctgacgattcaccgtgg	CRISPR spacer
gccaaaacgcgcgtctgacgattcaccgtgg	Protospacer
*******************************

28. spacer 2.24|231552|31|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgagtgtgtaaccgcactcacgaatcaaat	CRISPR spacer
ctgagtgtgtaaccgcactcacgaatcaaat	Protospacer
*******************************

29. spacer 3.1|369777|34|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgcctacgccgagttgccggatcccatcgccgg	CRISPR spacer
tcgcctacgccgagttgccggatcccatcgccgg	Protospacer
**********************************

30. spacer 3.2|369842|35|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgatcttccaccgacacccccatccagacgttcg	CRISPR spacer
ctgatcttccaccgacacccccatccagacgttcg	Protospacer
***********************************

31. spacer 3.3|369908|34|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

cctatatcggcagcgatgccgacaaggaggccaa	CRISPR spacer
cctatatcggcagcgatgccgacaaggaggccaa	Protospacer
**********************************

32. spacer 3.4|369973|34|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

gcggggagggggctacctccacctggggtcacgc	CRISPR spacer
gcggggagggggctacctccacctggggtcacgc	Protospacer
**********************************

33. spacer 3.5|370038|33|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgtaaatctctattcggcatctgaagtctct	CRISPR spacer
ggcgtaaatctctattcggcatctgaagtctct	Protospacer
*********************************

34. spacer 3.6|370102|35|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

tggagatagcccggggacagcgcctcttgcaggtt	CRISPR spacer
tggagatagcccggggacagcgcctcttgcaggtt	Protospacer
***********************************

35. spacer 3.7|370168|35|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

cactcctcagccgaatagtatcccccgcccggagg	CRISPR spacer
cactcctcagccgaatagtatcccccgcccggagg	Protospacer
***********************************

36. spacer 3.8|370234|33|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcatggacggctaccgcgatgagacattgcg	CRISPR spacer
cgtcatggacggctaccgcgatgagacattgcg	Protospacer
*********************************

37. spacer 3.9|370298|33|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccgataatctggccgcccgaactgcgcgcctg	CRISPR spacer
gccgataatctggccgcccgaactgcgcgcctg	Protospacer
*********************************

38. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttcggctccctttcgacggcgtcg	Protospacer
*********************************

39. spacer 3.11|370426|35|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

aattcgatctgaccgcggaggtgcgcgatcagatc	CRISPR spacer
aattcgatctgaccgcggaggtgcgcgatcagatc	Protospacer
***********************************

40. spacer 3.12|370492|35|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcaggtcgccttggccaccagacttgatatcgct	CRISPR spacer
ggcaggtcgccttggccaccagacttgatatcgct	Protospacer
***********************************

41. spacer 3.13|370558|34|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

tcttgtcgacgacggcctcgatctgggaagtgct	CRISPR spacer
tcttgtcgacgacggcctcgatctgggaagtgct	Protospacer
**********************************

42. spacer 3.14|370623|33|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

tatcacgccgccctgggggcggtactggaaacc	CRISPR spacer
tatcacgccgccctgggggcggtactggaaacc	Protospacer
*********************************

43. spacer 3.15|369779|34|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgcctacgccgagttgccggatcccatcgccgg	CRISPR spacer
tcgcctacgccgagttgccggatcccatcgccgg	Protospacer
**********************************

44. spacer 3.16|369844|35|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgatcttccaccgacacccccatccagacgttcg	CRISPR spacer
ctgatcttccaccgacacccccatccagacgttcg	Protospacer
***********************************

45. spacer 3.17|369910|34|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

cctatatcggcagcgatgccgacaaggaggccaa	CRISPR spacer
cctatatcggcagcgatgccgacaaggaggccaa	Protospacer
**********************************

46. spacer 3.18|369975|34|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

gcggggagggggctacctccacctggggtcacgc	CRISPR spacer
gcggggagggggctacctccacctggggtcacgc	Protospacer
**********************************

47. spacer 3.19|370040|33|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgtaaatctctattcggcatctgaagtctct	CRISPR spacer
ggcgtaaatctctattcggcatctgaagtctct	Protospacer
*********************************

48. spacer 3.20|370104|35|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

tggagatagcccggggacagcgcctcttgcaggtt	CRISPR spacer
tggagatagcccggggacagcgcctcttgcaggtt	Protospacer
***********************************

49. spacer 3.21|370170|35|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

cactcctcagccgaatagtatcccccgcccggagg	CRISPR spacer
cactcctcagccgaatagtatcccccgcccggagg	Protospacer
***********************************

50. spacer 3.22|370236|33|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcatggacggctaccgcgatgagacattgcg	CRISPR spacer
cgtcatggacggctaccgcgatgagacattgcg	Protospacer
*********************************

51. spacer 3.23|370300|33|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccgataatctggccgcccgaactgcgcgcctg	CRISPR spacer
gccgataatctggccgcccgaactgcgcgcctg	Protospacer
*********************************

52. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttcggctccctttcgacggcgtcg	Protospacer
*********************************

53. spacer 3.25|370428|35|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

aattcgatctgaccgcggaggtgcgcgatcagatc	CRISPR spacer
aattcgatctgaccgcggaggtgcgcgatcagatc	Protospacer
***********************************

54. spacer 3.26|370494|35|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcaggtcgccttggccaccagacttgatatcgct	CRISPR spacer
ggcaggtcgccttggccaccagacttgatatcgct	Protospacer
***********************************

55. spacer 3.27|370560|34|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

tcttgtcgacgacggcctcgatctgggaagtgct	CRISPR spacer
tcttgtcgacgacggcctcgatctgggaagtgct	Protospacer
**********************************

56. spacer 3.28|370625|33|NC_017957|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

tatcacgccgccctgggggcggtactggaaacc	CRISPR spacer
tatcacgccgccctgggggcggtactggaaacc	Protospacer
*********************************

57. spacer 4.1|412281|32|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

tcaagcgcaggtacgaagcaaacctgccaaag	CRISPR spacer
tcaagcgcaggtacgaagcaaacctgccaaag	Protospacer
********************************

58. spacer 4.2|412350|29|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgagatccacctcgacgtcgagtccacct	CRISPR spacer
cgagatccacctcgacgtcgagtccacct	Protospacer
*****************************

59. spacer 4.3|412416|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

accatcatccaaactccgtgggggagatatg	CRISPR spacer
accatcatccaaactccgtgggggagatatg	Protospacer
*******************************

60. spacer 4.4|412484|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

tgcgccattacgcgacggagcttctggtcga	CRISPR spacer
tgcgccattacgcgacggagcttctggtcga	Protospacer
*******************************

61. spacer 5.1|416177|29|NC_017957|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgttattgccgcggcggggcgggaaata	CRISPR spacer
gtgttattgccgcggcggggcgggaaata	Protospacer
*****************************

62. spacer 5.2|416243|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgttcatcgatgccttcaagctgggcatcat	CRISPR spacer
ctgttcatcgatgccttcaagctgggcatcat	Protospacer
********************************

63. spacer 5.3|416312|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtcgactcctacaacaaggagcacggcctgga	CRISPR spacer
gcgtcgactcctacaacaaggagcacggcctgga	Protospacer
**********************************

64. spacer 5.4|416383|29|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

cactcaatcgccaaaacctatcctctcga	CRISPR spacer
cactcaatcgccaaaacctatcctctcga	Protospacer
*****************************

65. spacer 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggccgttcccgttcctcgacgtcgccag	CRISPR spacer
acgggccgttcccgttcctcgacgtcgccag	Protospacer
*******************************

66. spacer 5.6|416517|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

catgaccatgaccgtttccgatctcgttctg	CRISPR spacer
catgaccatgaccgtttccgatctcgttctg	Protospacer
*******************************

67. spacer 5.7|416585|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagacttcgcatgcggtcctcgtttttcgcc	CRISPR spacer
gagacttcgcatgcggtcctcgtttttcgcc	Protospacer
*******************************

68. spacer 5.8|416653|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

tatacactgtataaggaggcgaagcagcggag	CRISPR spacer
tatacactgtataaggaggcgaagcagcggag	Protospacer
********************************

69. spacer 6.1|421943|35|NC_017957|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

cccgactacggctatcaccccgtgcggctggtcaa	CRISPR spacer
cccgactacggctatcaccccgtgcggctggtcaa	Protospacer
***********************************

70. spacer 6.2|422004|35|NC_017957|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccccagcacactccgattcggcattccctctcgct	CRISPR spacer
ccccagcacactccgattcggcattccctctcgct	Protospacer
***********************************

71. spacer 1.2|143064|31|NC_017957|PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 4, identity: 0.871

gtcgcgc-ccacccgcacgccgaccgcggcga	CRISPR spacer
-tcgcccgccacgcgcacgccgaccgcgccga	Protospacer
 **** * **** *************** ***

72. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.839

--gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
cagcggcg--cacccgcacgccgatcgcggcga	Protospacer
  *. ***  **************.********

73. spacer 2.10|231874|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038146 (Streptomyces sp. S501 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.853

agctgccgcggcgcccgcgcccggaccatcccgt	CRISPR spacer
cgcggccgcggcgcccgcgccgggaccatccccg	Protospacer
 ** ***************** **********  

74. spacer 1.1|142997|31|NC_017957|PILER-CR matches to NC_008713 (Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence) position: , mismatch: 6, identity: 0.806

ggcttcagggggccgatgaccgaggcacagc	CRISPR spacer
gccaacaaggggccgatgaccgaggaacaga	Protospacer
* *  **.***************** **** 

75. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP023550 (Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ggcgagcccacccgcacgtcgaccgccacgt	Protospacer
* ** *************.******* .** 

76. spacer 1.4|143063|34|NC_017957|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 6, identity: 0.824

agtcgcgc-ccacccgcacgccgaccgcggcgacg	CRISPR spacer
-atcgcccgccacgcgcacgccgaccgcgccgaag	Protospacer
 .**** * **** *************** *** *

77. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to CP021131 (Meiothermus taiwanensis strain WR-220 plasmid pMtWR-220, complete sequence) position: , mismatch: 6, identity: 0.818

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
tggccatcgaagcggccctggaagcgctggccg	Protospacer
*********  ***************  ** * 

78. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 6, identity: 0.812

ggatcagt--gccccgggggcggcggcgctgacc	CRISPR spacer
--cgcagtcggccgcgcgggcggcggcgctgacc	Protospacer
    ****  *** ** *****************

79. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NC_010373 (Methylobacterium sp. 4-46 plasmid pM44601, complete sequence) position: , mismatch: 6, identity: 0.812

ggatcagt-gccccgggggcggcggcgctgacc	CRISPR spacer
-gattggtggccccggcggcggcggcggtgacg	Protospacer
 ***..** ******* ********** **** 

80. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NC_010373 (Methylobacterium sp. 4-46 plasmid pM44601, complete sequence) position: , mismatch: 6, identity: 0.812

ggatcagt-gccccgggggcggcggcgctgacc	CRISPR spacer
-gattggtggccccggcggcggcggcggtgacg	Protospacer
 ***..** ******* ********** **** 

81. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NC_010373 (Methylobacterium sp. 4-46 plasmid pM44601, complete sequence) position: , mismatch: 6, identity: 0.812

ggatcagt-gccccgggggcggcggcgctgacc	CRISPR spacer
-gattggtggccccggcggcggcggcggtgacg	Protospacer
 ***..** ******* ********** **** 

82. spacer 3.3|369908|34|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP048426 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.824

cctatatcggcagcgatgccgacaaggaggccaa	CRISPR spacer
gcgatatcggcagcgaagccgacaaggagcacga	Protospacer
 * ************* ************  *.*

83. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KX388535 (Agrobacterium tumefaciens strain EU6 plasmid pTiEU6, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

84. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000059 (Agrobacterium tumefaciens strain CFBP1898 plasmid pTi_CFBP1898, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

85. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to KY000034 (Agrobacterium sp. strain C58PMP90 plasmid pTi_C58PMP90, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

86. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to KY000036 (Agrobacterium sp. strain GV3101 plasmid pTi_GV3101, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

87. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP042277 (Agrobacterium tumefaciens strain 186 plasmid pTi, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

88. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP032929 (Agrobacterium tumefaciens strain 1D1460 plasmid pTi1D1460, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

89. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP039927 (Agrobacterium tumefaciens strain CFBP7129 plasmid pTiCFBP7129, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

90. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NC_002147 (Agrobacterium tumefaciens MAFF301001 plasmid pTi-SAKURA, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

91. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP032925 (Agrobacterium tumefaciens strain 1D1108 plasmid pTi1D1108, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

92. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_AF010180 (Agrobacterium fabrum str. C58 plasmid pTiC58, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

93. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP030831 (Neorhizobium sp. NCHU2750 plasmid pTiNCHU2750, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

94. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP033026 (Agrobacterium fabrum strain 1D132 plasmid pTi1D132, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

95. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NC_003065 (Agrobacterium fabrum str. C58 plasmid Ti, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

96. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_MK439382 (Agrobacterium tumefaciens strain CFBP2178 plasmid pTiCFBP2178, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

97. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_MK439383 (Agrobacterium tumefaciens strain CFBP1935 plasmid pTiCFBP1935, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

98. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_MK439386 (Agrobacterium tumefaciens strain T37 plasmid pTiT37, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

99. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_MK318986 (Agrobacterium rhizogenes strain C6.5 plasmid pTiC6.5, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

100. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_MK439385 (Agrobacterium tumefaciens strain Kerr27 plasmid pTiKerr27, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

101. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_MK439384 (Agrobacterium tumefaciens strain Kerr108 plasmid pTiKerr108, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

102. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_MK439381 (Agrobacterium tumefaciens strain Sule1 plasmid pTiSule1, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

103. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_MF511177 (Agrobacterium rhizogenes strain C5.7 plasmid pTiC5.7, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

104. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000039 (Agrobacterium deltaense strain Tun180 plasmid pTi_Tun180, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

105. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000064 (Agrobacterium tumefaciens strain CFBP7126 plasmid pTi_CFBP7126, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

106. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000069 (Agrobacterium deltaense strain Tun176 plasmid pTi_Tun176, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

107. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000058 (Agrobacterium rhizogenes strain CFBP1317 plasmid pTi_CFBP1317, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

108. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000068 (Agrobacterium deltaense strain Tun151 plasmid pTi_Tun151, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

109. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000070 (Agrobacterium tumefaciens strain Tun178 plasmid pTi_Tun178, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

110. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000027 (Agrobacterium rhizogenes strain CFBP2692 plasmid pTi_CFBP2692, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

111. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000031 (Agrobacterium genomosp. 1 strain Tun198 plasmid pTi_Tun198, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

112. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000041 (Agrobacterium tumefaciens strain CFBP296 plasmid pTi_CFBP296, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

113. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000065 (Agrobacterium tumefaciens strain CFBP7128 plasmid pTi_CFBP7128, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

114. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000028 (Agrobacterium genomosp. 1 strain CFBP2712 plasmid pTi_CFBP2712, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

115. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000066 (Agrobacterium deltaense strain CFBP7129 plasmid pTi_CFBP7129, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

116. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000044 (Agrobacterium fabrum strain CFBP1933 plasmid pTi_CFBP1933, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

117. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000050 (Agrobacterium tumefaciens strain CFBP4442 plasmid pTi_CFBP4442, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

118. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000062 (Agrobacterium genomosp. 3 strain CFBP4424 plasmid pTi_CFBP4424, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

119. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000073 (Agrobacterium tumefaciens strain Tun188 plasmid pTi_Tun188, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

120. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000057 (Agrobacterium fabrum strain CFBP5505 plasmid pTi_CFBP5505, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

121. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000071 (Agrobacterium tumefaciens strain Tun183 plasmid pTi_Tun183, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

122. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000047 (Agrobacterium genomosp. 1 strain CFBP2516 plasmid pTi_CFBP2516, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

123. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000046 (Agrobacterium genomosp. 1 strain CFBP2177 plasmid pTi_CFBP2177, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

124. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000051 (Agrobacterium genomosp. 1 strain CFBP5503 plasmid pTi_CFBP5503, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

125. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000063 (Agrobacterium fabrum strain CFBP6549 plasmid pTi_CFBP6549, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

126. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000052 (Agrobacterium tumefaciens strain CFBP7000 plasmid pTi_CFBP7000, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

127. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000049 (Agrobacterium rhizogenes strain CFBP4423 plasmid pTi_CFBP4423, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

128. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000055 (Agrobacterium rubi strain Tun159 plasmid pTi_Tun159, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

129. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000043 (Agrobacterium rhizogenes strain CFBP1905 plasmid pTi_CFBP1905, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

130. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000048 (Agrobacterium rhizogenes strain CFBP2746 plasmid pTi_CFBP2746, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

131. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000053 (Agrobacterium genomosp. 1 strain DC12-001 plasmid pTi_DC12-001, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

132. spacer 3.10|370362|33|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY000054 (Agrobacterium tumefaciens strain Tun154 plasmid pTi_Tun154, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

133. spacer 3.11|370426|35|NC_017957|CRISPRCasFinder,CRT matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 6, identity: 0.829

aattcgat---ctgaccgcggaggtgcgcgatcagatc	CRISPR spacer
---tcgatcacctgaccgcggaggtcagcgatcagatg	Protospacer
   *****   **************  ********** 

134. spacer 3.17|369910|34|NC_017957|PILER-CR matches to NZ_CP048426 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.824

cctatatcggcagcgatgccgacaaggaggccaa	CRISPR spacer
gcgatatcggcagcgaagccgacaaggagcacga	Protospacer
 * ************* ************  *.*

135. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KX388535 (Agrobacterium tumefaciens strain EU6 plasmid pTiEU6, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

136. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000059 (Agrobacterium tumefaciens strain CFBP1898 plasmid pTi_CFBP1898, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

137. spacer 3.24|370364|33|NC_017957|PILER-CR matches to KY000034 (Agrobacterium sp. strain C58PMP90 plasmid pTi_C58PMP90, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

138. spacer 3.24|370364|33|NC_017957|PILER-CR matches to KY000036 (Agrobacterium sp. strain GV3101 plasmid pTi_GV3101, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

139. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_CP042277 (Agrobacterium tumefaciens strain 186 plasmid pTi, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

140. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_CP032929 (Agrobacterium tumefaciens strain 1D1460 plasmid pTi1D1460, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

141. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_CP039927 (Agrobacterium tumefaciens strain CFBP7129 plasmid pTiCFBP7129, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

142. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NC_002147 (Agrobacterium tumefaciens MAFF301001 plasmid pTi-SAKURA, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

143. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_CP032925 (Agrobacterium tumefaciens strain 1D1108 plasmid pTi1D1108, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

144. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_AF010180 (Agrobacterium fabrum str. C58 plasmid pTiC58, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

145. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_CP030831 (Neorhizobium sp. NCHU2750 plasmid pTiNCHU2750, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

146. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_CP033026 (Agrobacterium fabrum strain 1D132 plasmid pTi1D132, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

147. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NC_003065 (Agrobacterium fabrum str. C58 plasmid Ti, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

148. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_MK439382 (Agrobacterium tumefaciens strain CFBP2178 plasmid pTiCFBP2178, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

149. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_MK439383 (Agrobacterium tumefaciens strain CFBP1935 plasmid pTiCFBP1935, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

150. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_MK439386 (Agrobacterium tumefaciens strain T37 plasmid pTiT37, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

151. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_MK318986 (Agrobacterium rhizogenes strain C6.5 plasmid pTiC6.5, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

152. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_MK439385 (Agrobacterium tumefaciens strain Kerr27 plasmid pTiKerr27, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

153. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_MK439384 (Agrobacterium tumefaciens strain Kerr108 plasmid pTiKerr108, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

154. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_MK439381 (Agrobacterium tumefaciens strain Sule1 plasmid pTiSule1, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

155. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_MF511177 (Agrobacterium rhizogenes strain C5.7 plasmid pTiC5.7, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

156. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000039 (Agrobacterium deltaense strain Tun180 plasmid pTi_Tun180, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

157. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000064 (Agrobacterium tumefaciens strain CFBP7126 plasmid pTi_CFBP7126, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

158. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000069 (Agrobacterium deltaense strain Tun176 plasmid pTi_Tun176, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

159. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000058 (Agrobacterium rhizogenes strain CFBP1317 plasmid pTi_CFBP1317, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

160. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000068 (Agrobacterium deltaense strain Tun151 plasmid pTi_Tun151, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

161. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000070 (Agrobacterium tumefaciens strain Tun178 plasmid pTi_Tun178, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

162. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000027 (Agrobacterium rhizogenes strain CFBP2692 plasmid pTi_CFBP2692, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

163. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000031 (Agrobacterium genomosp. 1 strain Tun198 plasmid pTi_Tun198, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

164. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000041 (Agrobacterium tumefaciens strain CFBP296 plasmid pTi_CFBP296, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

165. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000065 (Agrobacterium tumefaciens strain CFBP7128 plasmid pTi_CFBP7128, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

166. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000028 (Agrobacterium genomosp. 1 strain CFBP2712 plasmid pTi_CFBP2712, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

167. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000066 (Agrobacterium deltaense strain CFBP7129 plasmid pTi_CFBP7129, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

168. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000044 (Agrobacterium fabrum strain CFBP1933 plasmid pTi_CFBP1933, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

169. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000050 (Agrobacterium tumefaciens strain CFBP4442 plasmid pTi_CFBP4442, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

170. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000062 (Agrobacterium genomosp. 3 strain CFBP4424 plasmid pTi_CFBP4424, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

171. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000073 (Agrobacterium tumefaciens strain Tun188 plasmid pTi_Tun188, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

172. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000057 (Agrobacterium fabrum strain CFBP5505 plasmid pTi_CFBP5505, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

173. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000071 (Agrobacterium tumefaciens strain Tun183 plasmid pTi_Tun183, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

174. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000047 (Agrobacterium genomosp. 1 strain CFBP2516 plasmid pTi_CFBP2516, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

175. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000046 (Agrobacterium genomosp. 1 strain CFBP2177 plasmid pTi_CFBP2177, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

176. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000051 (Agrobacterium genomosp. 1 strain CFBP5503 plasmid pTi_CFBP5503, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

177. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000063 (Agrobacterium fabrum strain CFBP6549 plasmid pTi_CFBP6549, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

178. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000052 (Agrobacterium tumefaciens strain CFBP7000 plasmid pTi_CFBP7000, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

179. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000049 (Agrobacterium rhizogenes strain CFBP4423 plasmid pTi_CFBP4423, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

180. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000055 (Agrobacterium rubi strain Tun159 plasmid pTi_Tun159, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

181. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000043 (Agrobacterium rhizogenes strain CFBP1905 plasmid pTi_CFBP1905, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

182. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000048 (Agrobacterium rhizogenes strain CFBP2746 plasmid pTi_CFBP2746, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

183. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000053 (Agrobacterium genomosp. 1 strain DC12-001 plasmid pTi_DC12-001, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

184. spacer 3.24|370364|33|NC_017957|PILER-CR matches to NZ_KY000054 (Agrobacterium tumefaciens strain Tun154 plasmid pTi_Tun154, complete sequence) position: , mismatch: 6, identity: 0.818

ctcgctcatttcggctccctttcgacggcgtcg	CRISPR spacer
ctcgctcatttccgctccctatcgagcctgtcg	Protospacer
************ ******* ****   .****

185. spacer 3.25|370428|35|NC_017957|PILER-CR matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 6, identity: 0.829

aattcgat---ctgaccgcggaggtgcgcgatcagatc	CRISPR spacer
---tcgatcacctgaccgcggaggtcagcgatcagatg	Protospacer
   *****   **************  ********** 

186. spacer 4.2|412350|29|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 6, identity: 0.793

cgagatccacctcgacgtcgagtccacct--	CRISPR spacer
ggagatctacctcgacgtcgag--aatctgg	Protospacer
 ******.**************   *.**  

187. spacer 4.2|412350|29|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 6, identity: 0.793

cgagatccacctcgacgtcgagtccacct	CRISPR spacer
cgagatccacctcgtcgtcgacacccacg	Protospacer
************** ******  **  * 

188. spacer 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 6, identity: 0.806

acgggccgttcccgttcctcgacgtcgccag--	CRISPR spacer
tcgggccgttcgcgttcctcgccg--gcctgtt	Protospacer
 ********** ********* **  *** *  

189. spacer 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 6, identity: 0.806

acgggccgttcccgttcctcgacgtcgccag--	CRISPR spacer
tcgggccgttcgcgttcctcgccg--gcctgtt	Protospacer
 ********** ********* **  *** *  

190. spacer 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 6, identity: 0.806

acgggccgttcccgttcctcgacgtcgccag--	CRISPR spacer
tcgggccgttcgcgttcctcgccg--gcctgtt	Protospacer
 ********** ********* **  *** *  

191. spacer 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 6, identity: 0.806

acgggccgttcccgttcctcgacgtcgccag--	CRISPR spacer
tcgggccgttcgcgttcctcgccg--gcctgtt	Protospacer
 ********** ********* **  *** *  

192. spacer 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 6, identity: 0.806

acgggccgttcccgttcctcgacgtcgccag--	CRISPR spacer
tcgggccgttcgcgttcctcgccg--gcctgtt	Protospacer
 ********** ********* **  *** *  

193. spacer 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 6, identity: 0.806

acgggccgttcccgttcctcgacgtcgccag--	CRISPR spacer
tcgggccgttcgcgttcctcgccg--gcctgtt	Protospacer
 ********** ********* **  *** *  

194. spacer 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 6, identity: 0.806

acgggccgttcccgttcctcgacgtcgccag--	CRISPR spacer
tcgggccgttcgcgttcctcgccg--gcctgtt	Protospacer
 ********** ********* **  *** *  

195. spacer 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 6, identity: 0.806

acgggccgttcccgttcctcgacgtcgccag--	CRISPR spacer
tcgggccgttcgcgttcctcgccg--gcctgtt	Protospacer
 ********** ********* **  *** *  

196. spacer 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 6, identity: 0.806

acgggccgttcccgttcctcgacgtcgccag--	CRISPR spacer
tcgggccgttcgcgttcctcgccg--gcctgtt	Protospacer
 ********** ********* **  *** *  

197. spacer 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 6, identity: 0.806

acgggccgttcccgttcctcgacgtcgccag--	CRISPR spacer
tcgggccgttcgcgttcctcgccg--gcctgtt	Protospacer
 ********** ********* **  *** *  

198. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.774

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
cgcgaccacacccgcacgccgaccgcagcgc	Protospacer
  **  * ******************.*** 

199. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 7, identity: 0.774

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
gccagcaccaccagcacgacgaccgcggcga	Protospacer
*.*.   ***** ***** ************

200. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NC_008043 (Ruegeria sp. TM1040 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
atcgcgcgcacccgcacgccggccatgggca	Protospacer
.****** *************.**..**  *

201. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
atcaggaacaccggcacgacgaccgcggcga	Protospacer
.**. *  **** ***** ************

202. spacer 1.4|143063|34|NC_017957|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 7, identity: 0.794

--agtcgcgcccacccgcacgccgaccgcggcgacg	CRISPR spacer
ccagcggcg--cacccgcacgccgatcgcggcgatc	Protospacer
  **. ***  **************.********. 

203. spacer 2.1|231292|34|NC_017957|CRISPRCasFinder,CRT matches to NZ_AP022338 (Mameliella alba strain KU6B plasmid pKUB257, complete sequence) position: , mismatch: 7, identity: 0.794

gcggggcac-cggtacagcgtggaagcccgcgcga	CRISPR spacer
-ctgaccgcgcggtacagcgttgaagcccgcgcgc	Protospacer
 * *. *.* *********** ************ 

204. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_008537 (Arthrobacter sp. FB24 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.788

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
tggccatcgacgcgaccctggaagccgtcgagc	Protospacer
********* ****.********** *  *. *

205. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 7, identity: 0.781

ggatcagtgccccgggggcggcggcgctgacc	CRISPR spacer
gggccagtggcacgggggcggcggcgcaggtc	Protospacer
**..***** * *************** *..*

206. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NC_008537 (Arthrobacter sp. FB24 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

ggatcagtgccccgggggcggcggcgctgacc--	CRISPR spacer
cgatcagtgccccggcgacggcg--ggtgccccg	Protospacer
 ************** *.*****  * ** **  

207. spacer 3.13|370558|34|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 7, identity: 0.794

tcttgtcgacgacggcctcgatctgggaagtgct----	CRISPR spacer
tcttggcgacgacgacctcgatctg----atgctgtcg	Protospacer
***** ********.**********    .****    

208. spacer 3.27|370560|34|NC_017957|PILER-CR matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 7, identity: 0.794

tcttgtcgacgacggcctcgatctgggaagtgct----	CRISPR spacer
tcttggcgacgacgacctcgatctg----atgctgtcg	Protospacer
***** ********.**********    .****    

209. spacer 4.2|412350|29|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.759

cgagatccacctcgacgtcgagtccacct	CRISPR spacer
cgagatccccctcgacgtcgaccagacgc	Protospacer
******** ************ .  ** .

210. spacer 4.2|412350|29|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to AP018486 (Mycobacterium phage PP DNA, complete genome) position: , mismatch: 7, identity: 0.759

cgagatccacctcgacgtcgagtccacct	CRISPR spacer
ggccaaccagctcgacgtcgagtccactc	Protospacer
 *  * *** *****************..

211. spacer 4.2|412350|29|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 7, identity: 0.759

cgagatccacctcgacgtcgagtccacct	CRISPR spacer
cgagatcgacctcgacgtcgatcactgcg	Protospacer
******* ************* . *  * 

212. spacer 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 7, identity: 0.774

acgggccgttcccgttcctcgacgtcgccag	CRISPR spacer
tcgtgaagttcccgttccccgacgtcgccga	Protospacer
 ** *  ***********.**********..

213. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.742

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
agactgcccacccgcgcgccggccgcggcca	Protospacer
.   .**********.*****.******* *

214. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.742

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
acctggaccacccgcacccggaccgcggcgt	Protospacer
..*  * ********** * ********** 

215. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_LR134447 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence) position: , mismatch: 8, identity: 0.742

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
atgaccaccaccagcacgccgaccgcagcgc	Protospacer
.* .*  ***** *************.*** 

216. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccctccagcatccgcccgccgaccgcggcga	Protospacer
 .* *   **.**** ***************

217. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NC_041921 (Dinoroseobacter phage vB_DshS-R5C, complete genome) position: , mismatch: 8, identity: 0.742

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
agggctggcaaccgcacgccgacggcggcga	Protospacer
.  **   ** ************ *******

218. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccctccagcatccgcccgccgaccgcggcga	Protospacer
 .* *   **.**** ***************

219. spacer 1.4|143063|34|NC_017957|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

agtcg--cgcccacccgcacgccgaccgcggcgacg	CRISPR spacer
--ttgaccatcaacccggacgccgacctcggcgacg	Protospacer
  *.*  *..* ***** ********* ********

220. spacer 1.4|143063|34|NC_017957|CRISPRCasFinder matches to NZ_CP024907 (Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence) position: , mismatch: 8, identity: 0.765

agtcgcgcccacccgcacgccgaccg----cggcgacg	CRISPR spacer
catcacgcgcacccgcacgccgaccgttttcggc----	Protospacer
 .**.*** *****************    ****    

221. spacer 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 8, identity: 0.765

-cggatcagtgccccgggggcggcggcgctgaccc	CRISPR spacer
tcgcagtcg-gccgcgcgggcggcggcgctgacca	Protospacer
 ** * . * *** ** ***************** 

222. spacer 2.7|231680|34|NC_017957|CRISPRCasFinder,CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.765

acgcccgaggccgatcctggcgatggtgccgccg	CRISPR spacer
gctcaccatgccgatcatggcgatcgtgccgccc	Protospacer
.* * * * ******* ******* ******** 

223. spacer 2.7|231680|34|NC_017957|CRISPRCasFinder,CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.765

acgcccgaggccgatcctggcgatggtgccgccg	CRISPR spacer
gctcaccatgccgatcatggcgatcgtgccgccc	Protospacer
.* * * * ******* ******* ******** 

224. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MG925339 (Mycobacterium phage Chunky, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

225. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MH779500 (Mycobacterium phage Crownjwl, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

226. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MH230875 (Mycobacterium phage CheetO, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

227. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MK279908 (Mycobacterium phage Roliet, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

228. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MN096366 (Mycobacterium phage AbsoluteMadLad, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

229. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MT897902 (Mycobacterium phage Boehler, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

230. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to JX649096 (Mycobacterium phage Serpentine, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

231. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MK494104 (Mycobacterium phage HenryJackson, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

232. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to JX649099 (Mycobacterium phage Gyarad, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

233. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MT897903 (Mycobacterium phage DirtJuice, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

234. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MG962362 (Mycobacterium phage AltPhacts, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

235. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to KC661274 (Mycobacterium phage SDcharge11, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

236. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MF919503 (Mycobacterium phage Dingo, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

237. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to JX649100 (Mycobacterium phage Alex, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

238. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MH399786 (Mycobacterium phage PhrodoBaggins, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

239. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to KF713485 (Mycobacterium phage Suffolk, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

240. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

241. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MF919523 (Mycobacterium phage Mikota, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

242. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to KP027209 (Mycobacterium phage Sigman, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

243. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MK279877 (Mycobacterium phage Roscoe, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

244. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to JN698989 (Mycobacterium phage JacAttac, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

245. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MK524526 (Mycobacterium phage Robyn, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

246. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MN444868 (Mycobacterium phage Prickles, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

247. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MH371117 (Mycobacterium phage Kahve, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

248. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MF919530 (Mycobacterium phage Sheila, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

249. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MG925356 (Mycobacterium phage OliverWalter, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

250. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to JX649098 (Mycobacterium phage Nacho, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

251. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MH926060 (Mycobacterium phage Schadenfreude, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

252. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MT889369 (Mycobacterium phage Inchworm, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

253. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to GQ303259 (Mycobacterium phage Colbert, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

254. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to JX649097 (Mycobacterium phage Piglet, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

255. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to KJ538723 (Mycobacterium phage KingVeVeVe, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

256. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_021310 (Mycobacterium phage Newman, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

257. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to KJ174157 (Mycobacterium phage Soto, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

258. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to JF704099 (Mycobacterium phage KLucky39, complete sequence) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

259. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MF919507 (Mycobacterium phage Horchata, complete genome) position: , mismatch: 8, identity: 0.758

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atggcatcgccgaggccctggaagccgatgacg	Protospacer
  * ******** ************ ** *.* 

260. spacer 2.10|231874|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to KX961385 (Bordetella virus LK3, complete genome) position: , mismatch: 8, identity: 0.765

-agctgccgcggcgcccgcgcccggaccatcccgt	CRISPR spacer
cggtcgaagc-gcgcctgctcccggaccatcccgt	Protospacer
 .*..*  ** *****.** ***************

261. spacer 2.10|231874|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to KY000220 (Bordetella phage FP1, complete genome) position: , mismatch: 8, identity: 0.765

-agctgccgcggcgcccgcgcccggaccatcccgt	CRISPR spacer
cggtcgaagc-gcgcctgctcccggaccatcccgt	Protospacer
 .*..*  ** *****.** ***************

262. spacer 2.10|231874|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to KY000221 (Bordetella phage CN1, complete genome) position: , mismatch: 8, identity: 0.765

-agctgccgcggcgcccgcgcccggaccatcccgt	CRISPR spacer
cggtcgaagc-gcgcctgctcccggaccatcccgt	Protospacer
 .*..*  ** *****.** ***************

263. spacer 2.10|231874|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_047877 (Bordetella phage CN2, complete genome) position: , mismatch: 8, identity: 0.765

-agctgccgcggcgcccgcgcccggaccatcccgt	CRISPR spacer
cggtcgaagc-gcgcctgctcccggaccatcccgt	Protospacer
 .*..*  ** *****.** ***************

264. spacer 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

gactcggacgcactggccgccgcggaggacaacc	CRISPR spacer
tacctggacgcactggccgccgaggagcacacga	Protospacer
 **..***************** **** ***   

265. spacer 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MH910042 (Mycobacterium phage Scarlett, complete genome) position: , mismatch: 8, identity: 0.765

gactcg---gacgcactggccgccgcggaggacaacc	CRISPR spacer
---tcggccgacgccctggccgccgcggagcaccgcg	Protospacer
   ***   ***** *************** ** .* 

266. spacer 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MH910038 (Mycobacterium phage LeMond, complete genome) position: , mismatch: 8, identity: 0.765

gactcg---gacgcactggccgccgcggaggacaacc	CRISPR spacer
---tcggccgacgccctggccgccgcggagcaccgcg	Protospacer
   ***   ***** *************** ** .* 

267. spacer 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MH910039 (Mycobacterium phage Oscar, complete genome) position: , mismatch: 8, identity: 0.765

gactcg---gacgcactggccgccgcggaggacaacc	CRISPR spacer
---tcggccgacgccctggccgccgcggagcaccgcg	Protospacer
   ***   ***** *************** ** .* 

268. spacer 2.20|232526|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 8, identity: 0.75

ttcggctgcccgacggcacgccgtgcaccacg	CRISPR spacer
tgaagctgccggacggcacgccgttcagtgcg	Protospacer
*  .****** ************* ** ..**

269. spacer 2.20|232526|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 8, identity: 0.75

ttcggctgc--ccgacggcacgccgtgcaccacg	CRISPR spacer
--aggccatcgccgacgacacgccgggcaccacg	Protospacer
   ***...  ******.******* ********

270. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 8, identity: 0.75

ggatcagtgccccgggggcggcggcgctgacc	CRISPR spacer
cggcgatggcccagggtgcggcggcgctgacc	Protospacer
 *.. *  **** *** ***************

271. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

ggatcagtgccccgggggcggcggcgctgacc	CRISPR spacer
cggccgattccgcgggcgcggcggcgctgacc	Protospacer
 *..*..* ** **** ***************

272. spacer 3.1|369777|34|NC_017957|CRISPRCasFinder,CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 8, identity: 0.765

-tcgcctacgccgagttgccggatcccatcgccgg	CRISPR spacer
atcgcgcg-gccgagctgccggaccccatcgccac	Protospacer
 **** .. ******.*******.*********. 

273. spacer 3.3|369908|34|NC_017957|CRISPRCasFinder,CRT matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 8, identity: 0.765

cctatatcggcagcgatgccgacaaggaggccaa	CRISPR spacer
cgatcctcggcagcgacgccgagaaggaggccta	Protospacer
*   . **********.***** ********* *

274. spacer 3.15|369779|34|NC_017957|PILER-CR matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 8, identity: 0.765

-tcgcctacgccgagttgccggatcccatcgccgg	CRISPR spacer
atcgcgcg-gccgagctgccggaccccatcgccac	Protospacer
 **** .. ******.*******.*********. 

275. spacer 3.17|369910|34|NC_017957|PILER-CR matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 8, identity: 0.765

cctatatcggcagcgatgccgacaaggaggccaa	CRISPR spacer
cgatcctcggcagcgacgccgagaaggaggccta	Protospacer
*   . **********.***** ********* *

276. spacer 4.2|412350|29|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.724

cgagatccacctcgacgtcgagtccacct	CRISPR spacer
ggagatcgacctcgacgtcgagaacctgc	Protospacer
 ****** **************  * . .

277. spacer 4.4|412484|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 8, identity: 0.742

tgcgccattacgcgacggagcttctggtcga	CRISPR spacer
tgcgccatttcgcggcggagcttcgcaccct	Protospacer
********* ****.*********  ..*  

278. spacer 5.1|416177|29|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP030829 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence) position: , mismatch: 8, identity: 0.724

gtgttattgccgcggcggggcgggaaata	CRISPR spacer
gtgttcttgccgcggcggggctttatgcg	Protospacer
***** ***************   * ...

279. spacer 5.2|416243|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 8, identity: 0.75

ctgttcatcgatgccttcaagctgggcatcat	CRISPR spacer
cgccgtctcgatgctttcaagctgcgcatcat	Protospacer
*  . . *******.********* *******

280. spacer 5.2|416243|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 8, identity: 0.75

ctgttcatcgatgccttcaagctgggcatcat	CRISPR spacer
gcgatccgcgatgccttcaagcagggcagcac	Protospacer
 .* **  ************** ***** **.

281. spacer 5.2|416243|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018172 (Mesorhizobium oceanicum strain B7 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ctgttcatcgatgccttcaagctgggcatcat	CRISPR spacer
gtacacctcgatgccctcaggctgggcatcct	Protospacer
 *.. * ********.***.********** *

282. spacer 5.5|416449|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to MK864263 (Gordonia phage Melba, complete genome) position: , mismatch: 8, identity: 0.742

acgggccgttcccgttcctcgacgtcgccag	CRISPR spacer
gctcgccgtgcccgttcctcgacttcggcga	Protospacer
.*  ***** ************* *** *..

283. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

284. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccggcgcccacgcgcacgccgacagcatccg	Protospacer
 . ******** *********** **. * .

285. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccggcgcccacgcgcacgccgacagcatccg	Protospacer
 . ******** *********** **. * .

286. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

287. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
cgtgcgccgaccggcacgccgaccgccaggc	Protospacer
  .***** *** ************* . * 

288. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP024907 (Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
atcacgcgcacccgcacgccgaccgttttcg	Protospacer
.**.*** *****************.  . .

289. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

290. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

291. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

292. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

293. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

294. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

295. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
gcgaatttcaccagcacgccgacggcggcga	Protospacer
*. .  ..**** ********** *******

296. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

297. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

298. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

299. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

300. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

301. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

302. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

303. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

304. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

305. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

306. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

307. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

308. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

309. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

310. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

311. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

312. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

313. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

314. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

315. spacer 1.2|143064|31|NC_017957|PILER-CR matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

316. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

317. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

318. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

319. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

320. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
catgcgccgaccggcacgccgaccgccaggc	Protospacer
  .***** *** ************* . * 

321. spacer 1.2|143064|31|NC_017957|PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

322. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

323. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

324. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

325. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

326. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

327. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

328. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

329. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

330. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

331. spacer 1.2|143064|31|NC_017957|PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

332. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

333. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
cgtgcgccgaccggcacgccgaccgccaggc	Protospacer
  .***** *** ************* . * 

334. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

335. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

336. spacer 1.2|143064|31|NC_017957|PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
ccaccgccctcctgcacgccgaccgcgaggc	Protospacer
 .  ***** **.**************. * 

337. spacer 1.3|142996|34|NC_017957|CRISPRCasFinder matches to NC_008713 (Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence) position: , mismatch: 9, identity: 0.735

cggcttcagggggccgatgaccgaggcacagcgc	CRISPR spacer
agccaacaaggggccgatgaccgaggaacagaag	Protospacer
 * *  **.***************** **** . 

338. spacer 1.4|143063|34|NC_017957|CRISPRCasFinder matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 9, identity: 0.735

agtcgcgcccacccgcacgccgaccgcggcgacg	CRISPR spacer
ggccagcaccaccagcacgacgaccgcggcgacc	Protospacer
.*.*.   ***** ***** ************* 

339. spacer 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcagtgccccgggggcggcggcgctgaccc	CRISPR spacer
gcggcgatggcccagggtgcggcggcgctgaccc	Protospacer
  *.. *  **** *** ****************

340. spacer 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.735

cggatcagtgccccgggggcggcggcgctgaccc	CRISPR spacer
catggcgatacccccggggcggtggcgctgaccc	Protospacer
*. . *..*.**** *******.***********

341. spacer 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcagtgccccgggggcggcggcgctgaccc	CRISPR spacer
catggcgatacccccggggcggtggcgctgaccc	Protospacer
*. . *..*.**** *******.***********

342. spacer 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcagtgccccgggggcggcggcgctgaccc	CRISPR spacer
catggcgatacccccggggcggtggcgctgaccc	Protospacer
*. . *..*.**** *******.***********

343. spacer 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcagtgccccgggggcggcggcgctgaccc	CRISPR spacer
catggcgatacccccggggcggtggcgctgaccc	Protospacer
*. . *..*.**** *******.***********

344. spacer 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcagtgccccgggggcggcggcgctgaccc	CRISPR spacer
catggcgatacccccggggcggtggcgctgaccc	Protospacer
*. . *..*.**** *******.***********

345. spacer 2.2|231357|34|NC_017957|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcagtgccccgggggcggcggcgctgaccc	CRISPR spacer
catggcgatacccccggggcggtggcgctgaccc	Protospacer
*. . *..*.**** *******.***********

346. spacer 2.7|231680|34|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

acgcccgaggccgatcctggcgatggtgccgccg	CRISPR spacer
cggcttcgggcagatcctggcgatgatgccgctg	Protospacer
  **.. .*** *************.******.*

347. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039919 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626b, complete sequence) position: , mismatch: 9, identity: 0.727

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
tggccatcgccgccggcctggaagagatcgaaa	Protospacer
************* * ******** *.  *.  

348. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 9, identity: 0.727

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
ccggcgcggccgcggcgctggaatcggagggca	Protospacer
. * *.. ******** ****** ******** 

349. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
gcgctgaagccgcggccctcgaagcggggggcg	Protospacer
  **..  *********** *******.**** 

350. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020332 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM259, complete sequence) position: , mismatch: 9, identity: 0.727

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
ctgatctcgccgcggccctggaaacggtggcgc	Protospacer
. * . *****************.*** **  *

351. spacer 2.9|231809|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 9, identity: 0.735

---cgtacttccggaacggcgaggccgtgaacgtaaa	CRISPR spacer
aggcgga---gcggaacgccgaggccgtgaccgtatt	Protospacer
   ** *    ******* *********** ****  

352. spacer 2.10|231874|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 9, identity: 0.735

agctgccgcggcgcccgcgcccggaccatcccgt	CRISPR spacer
gccggccgcggagcgcgcgcccggaccatcgacg	Protospacer
. * ******* ** ***************    

353. spacer 2.10|231874|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 9, identity: 0.735

agctgccgcggcgcccgcgcccggaccatcccgt	CRISPR spacer
gccagccgctgcgcccgcgcccggcccaatccag	Protospacer
. * ***** ************** *** .**. 

354. spacer 2.20|232526|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

ttcggctgcccgacggcacgccgtgcaccacg	CRISPR spacer
agacgctgcgcgacggcacgccgttcaccggt	Protospacer
    ***** ************** ****.  

355. spacer 2.20|232526|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719

ttcggctgcccgacggcacgccgtgcaccacg	CRISPR spacer
ttcggctgcccgacgacacgccgcttcggatc	Protospacer
***************.*******. .   *. 

356. spacer 2.20|232526|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_009806 (Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence) position: , mismatch: 9, identity: 0.719

ttcggctgcccgacggcacgccgtgcaccacg	CRISPR spacer
acatgttgccccacggcacgcggtgcaccgag	Protospacer
 .  *.***** ********* *******. *

357. spacer 2.20|232526|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 9, identity: 0.719

ttcggctgcccgacggcacgccgtgcaccacg	CRISPR spacer
cgcaggccgccgacggcacgccgggccccacg	Protospacer
. *.* .  ************** ** *****

358. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NZ_CP030128 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ggatcagtgccccgggggcggcggcgctgacc	CRISPR spacer
ccgcctcctccacgggggcggcggcgctgacc	Protospacer
  ..*  . ** ********************

359. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.719

ggatcagtgccccgggggcggcggcgctgacc	CRISPR spacer
atggcgatacccccggggcggtggcgctgacc	Protospacer
. . *..*.**** *******.**********

360. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ggatcagtgccccgggggcggcggcgctgacc	CRISPR spacer
atggcgatacccccggggcggtggcgctgacc	Protospacer
. . *..*.**** *******.**********

361. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 9, identity: 0.719

ggatcagtgccccgggggcggcggcgctgacc	CRISPR spacer
cgccacgccccccgggggcggcggcgccgtcc	Protospacer
 * .  *. ******************.* **

362. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ggatcagtgccccgggggcggcggcgctgacc	CRISPR spacer
atggcgatacccccggggcggtggcgctgacc	Protospacer
. . *..*.**** *******.**********

363. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ggatcagtgccccgggggcggcggcgctgacc	CRISPR spacer
atggcgatacccccggggcggtggcgctgacc	Protospacer
. . *..*.**** *******.**********

364. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 9, identity: 0.719

ggatcagtgccccgggggcggcggcgctgacc	CRISPR spacer
tgctcagggccccgggggcgtcggcggccccg	Protospacer
 * **** ************ ***** .  * 

365. spacer 2.21|231359|32|NC_017957|PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ggatcagtgccccgggggcggcggcgctgacc	CRISPR spacer
atggcgatacccccggggcggtggcgctgacc	Protospacer
. . *..*.**** *******.**********

366. spacer 2.21|231359|32|NC_017957|PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ggatcagtgccccgggggcggcggcgctgacc	CRISPR spacer
atggcgatacccccggggcggtggcgctgacc	Protospacer
. . *..*.**** *******.**********

367. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ggatcagtgccccgggggcggcggcgctgacc	CRISPR spacer
gcacggtcaccccgggggcgtcggcactgacc	Protospacer
* *. . ..*********** ****.******

368. spacer 2.21|231359|32|NC_017957|PILER-CR matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 9, identity: 0.719

ggatcagtgccccgggggcggcggcgctgacc	CRISPR spacer
gctgctccgcccggcgggcggcggcgctgacg	Protospacer
*   *  .**** * **************** 

369. spacer 2.22|231424|31|NC_017957|PILER-CR matches to NZ_CP011296 (Rhodococcus erythropolis strain BG43 plasmid pRLCBG43, complete sequence) position: , mismatch: 9, identity: 0.71

aaatcgactttgtcgaggtggcgcgatctgg	CRISPR spacer
taaccgactttgtcgaggtggcgacgcacga	Protospacer
 **.*******************  .. .*.

370. spacer 3.1|369777|34|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.735

tcgcctacgccgagttgccggatcccatcgccgg	CRISPR spacer
ccgcctacgacgagttgccggaaccgctgcgcga	Protospacer
.******** ************ **  *   **.

371. spacer 3.3|369908|34|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 9, identity: 0.735

cctatatcggcagcgatgccgacaaggaggccaa	CRISPR spacer
agataaccggcaacgatgccgacgaggaggccga	Protospacer
     *.*****.**********.********.*

372. spacer 3.3|369908|34|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP021133 (Pseudomonas fragi strain NMC25 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

cctatatcggcagcgatgccgacaaggaggccaa	CRISPR spacer
gccaggtacgcaacgaagccgacaaggaggccat	Protospacer
 *.* .*  ***.*** **************** 

373. spacer 3.3|369908|34|NC_017957|CRISPRCasFinder,CRT matches to MT711887 (Pseudomonas phage Stalingrad, complete genome) position: , mismatch: 9, identity: 0.735

cctatatcggcagcgatgccgacaaggaggccaa	CRISPR spacer
gcatgaacatcagcgatgccgagaaggacgccaa	Protospacer
 *   * *. ************ ***** *****

374. spacer 3.8|370234|33|NC_017957|CRISPRCasFinder,CRT matches to NC_012797 (Desulfovibrio magneticus RS-1 plasmid pDMC1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtcatggacggctaccgcgatgagacattgcg	CRISPR spacer
cgtcatggacggctacagcgacgaggcgcccat	Protospacer
**************** ****.***.*...   

375. spacer 3.13|370558|34|NC_017957|CRISPRCasFinder,CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 9, identity: 0.735

tcttgtcgacgacggcctcgatct-----gggaagtgct	CRISPR spacer
tcttgccgacggcggcctcgatcttcatcggata-----	Protospacer
*****.*****.************     **. *     

376. spacer 3.15|369779|34|NC_017957|PILER-CR matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.735

tcgcctacgccgagttgccggatcccatcgccgg	CRISPR spacer
ccgcctacgacgagttgccggaaccgctgcgcga	Protospacer
.******** ************ **  *   **.

377. spacer 3.17|369910|34|NC_017957|PILER-CR matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 9, identity: 0.735

cctatatcggcagcgatgccgacaaggaggccaa	CRISPR spacer
agataaccggcaacgatgccgacgaggaggccga	Protospacer
     *.*****.**********.********.*

378. spacer 3.17|369910|34|NC_017957|PILER-CR matches to NZ_CP021133 (Pseudomonas fragi strain NMC25 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

cctatatcggcagcgatgccgacaaggaggccaa	CRISPR spacer
gccaggtacgcaacgaagccgacaaggaggccat	Protospacer
 *.* .*  ***.*** **************** 

379. spacer 3.17|369910|34|NC_017957|PILER-CR matches to MT711887 (Pseudomonas phage Stalingrad, complete genome) position: , mismatch: 9, identity: 0.735

cctatatcggcagcgatgccgacaaggaggccaa	CRISPR spacer
gcatgaacatcagcgatgccgagaaggacgccaa	Protospacer
 *   * *. ************ ***** *****

380. spacer 3.22|370236|33|NC_017957|PILER-CR matches to NC_012797 (Desulfovibrio magneticus RS-1 plasmid pDMC1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtcatggacggctaccgcgatgagacattgcg	CRISPR spacer
cgtcatggacggctacagcgacgaggcgcccat	Protospacer
**************** ****.***.*...   

381. spacer 3.27|370560|34|NC_017957|PILER-CR matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 9, identity: 0.735

tcttgtcgacgacggcctcgatct-----gggaagtgct	CRISPR spacer
tcttgccgacggcggcctcgatcttcatcggata-----	Protospacer
*****.*****.************     **. *     

382. spacer 5.2|416243|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 9, identity: 0.719

ctgttcatcgatgccttcaagctgggcatcat	CRISPR spacer
gagttcatcgatcccttcaagcagggccagcc	Protospacer
  ********** ********* ****    .

383. spacer 5.6|416517|31|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

catgaccatgaccgtttccgatctcgttctg	CRISPR spacer
tgccatgctgaccgtttccgacctcgatctg	Protospacer
... *.  *************.**** ****

384. spacer 5.8|416653|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

tatacactgtataaggaggcgaagcagcggag	CRISPR spacer
gacgagctgtatcaggaggcgaaggagcgcaa	Protospacer
 *.. .****** *********** **** *.

385. spacer 5.8|416653|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 9, identity: 0.719

tatacactgtataaggaggcgaagcagcggag	CRISPR spacer
gacggcctgtataaggcggcgaagaagcgctg	Protospacer
 *..  ********** ******* ****  *

386. spacer 1.2|143064|31|NC_017957|PILER-CR matches to MH910038 (Mycobacterium phage LeMond, complete genome) position: , mismatch: 10, identity: 0.677

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
acgatcggcaccagcacgacgaccgcggcga	Protospacer
.. ..   **** ***** ************

387. spacer 1.2|143064|31|NC_017957|PILER-CR matches to MH910039 (Mycobacterium phage Oscar, complete genome) position: , mismatch: 10, identity: 0.677

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
acgatcggcaccagcacgacgaccgcggcga	Protospacer
.. ..   **** ***** ************

388. spacer 1.2|143064|31|NC_017957|PILER-CR matches to MK376955 (Mycobacterium phage KiSi, complete genome) position: , mismatch: 10, identity: 0.677

gtcgcgcccacccgcacgccgaccgcggcga	CRISPR spacer
acgatcggcaccagcacgacgaccgcggcga	Protospacer
.. ..   **** ***** ************

389. spacer 1.4|143063|34|NC_017957|CRISPRCasFinder matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

agtcgcgcccacccgcacgccgaccgcggcgacg	CRISPR spacer
gccctccagcatccgcccgccgaccgcggcgacc	Protospacer
. .* *   **.**** **************** 

390. spacer 1.4|143063|34|NC_017957|CRISPRCasFinder matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

agtcgcgcccacccgcacgccgaccgcggcgacg	CRISPR spacer
gccctccagcatccgcccgccgaccgcggcgacc	Protospacer
. .* *   **.**** **************** 

391. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 10, identity: 0.697

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
gcgagctcgcggcggccctggacgcggaggaga	Protospacer
  *   **** *********** *******.  

392. spacer 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 10, identity: 0.706

gactcggacgcactggccgccgcggaggacaacc	CRISPR spacer
gcggcggccggactggccgccgcggagggactgc	Protospacer
*   *** ** *****************.    *

393. spacer 2.20|232526|32|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 10, identity: 0.688

ttcggctgcccgacggcacgccgtgcaccacg	CRISPR spacer
ttcggctgcccgacgaaacgccgcttcggatc	Protospacer
***************. ******. .   *. 

394. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 10, identity: 0.688

ggatcagtgccccgggggcggcggcgctgacc	CRISPR spacer
tggcgctggccgccggggcggcggcgctgacg	Protospacer
 *..    *** * ***************** 

395. spacer 2.21|231359|32|NC_017957|PILER-CR matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

ggatcagtgccccgggggcggcggcgctgacc	CRISPR spacer
ttgttctggctctgggggcggcggcgctgacg	Protospacer
  .*.   **.*.****************** 

396. spacer 3.3|369908|34|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 10, identity: 0.706

cctatatcggcagcgatgccgacaaggaggccaa	CRISPR spacer
ggtatatgggcaccgatgccgacaagcccgacct	Protospacer
  ***** **** *************   * *  

397. spacer 3.3|369908|34|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP010870 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6001, complete sequence) position: , mismatch: 10, identity: 0.706

cctatatcggcagcgatgccgacaaggaggccaa	CRISPR spacer
ggcagaagggcagcgaggccgccaaggaggccgc	Protospacer
  .* *  ******** **** **********. 

398. spacer 3.11|370426|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP022991 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence) position: , mismatch: 10, identity: 0.714

aattcgatctgaccgcggaggtgcgcgatcagatc	CRISPR spacer
caatcgatctgaccgcgcaggcgcgcgacggcaag	Protospacer
 * ************** ***.******. . *  

399. spacer 3.17|369910|34|NC_017957|PILER-CR matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 10, identity: 0.706

cctatatcggcagcgatgccgacaaggaggccaa	CRISPR spacer
ggtatatgggcaccgatgccgacaagcccgacct	Protospacer
  ***** **** *************   * *  

400. spacer 3.17|369910|34|NC_017957|PILER-CR matches to NZ_CP010870 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6001, complete sequence) position: , mismatch: 10, identity: 0.706

cctatatcggcagcgatgccgacaaggaggccaa	CRISPR spacer
ggcagaagggcagcgaggccgccaaggaggccgc	Protospacer
  .* *  ******** **** **********. 

401. spacer 3.25|370428|35|NC_017957|PILER-CR matches to NZ_CP022991 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence) position: , mismatch: 10, identity: 0.714

aattcgatctgaccgcggaggtgcgcgatcagatc	CRISPR spacer
caatcgatctgaccgcgcaggcgcgcgacggcaag	Protospacer
 * ************** ***.******. . *  

402. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP026855 (Escherichia coli strain MS7163 plasmid pMS7163B, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

403. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP027383 (Escherichia coli strain 2013C-3250 plasmid unnamed3) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

404. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to CP054459 (Escherichia coli strain SCU-103 plasmid pSCU-103-2) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

405. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to CP054460 (Escherichia coli strain SCU-103 plasmid pSCU-103-3) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

406. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP024254 (Escherichia coli strain ATCC 43886 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

407. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to CP025878 (Escherichia coli strain 503458 plasmid p503458_84, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

408. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP033883 (Escherichia coli strain 50579417 plasmid p50579417_2, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

409. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to CP027378 (Escherichia coli strain 2013C-4404 plasmid unnamed2) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

410. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to CP027379 (Escherichia coli strain 2013C-4404 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

411. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

412. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

413. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

414. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

415. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

416. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP025625 (Escherichia coli strain SCEC020007 plasmid pBOKZ_020007, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

417. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

418. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

419. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_AP017613 (Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_3, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

420. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NC_022996 (Escherichia coli plasmid pO26-CRL-125, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

421. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP025855 (Escherichia coli strain 510016 plasmid p510016_84, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

422. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NC_022992 (Escherichia coli plasmid pO111-CRL-115, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

423. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP053733 (Escherichia coli strain CP55_Sichuan plasmid pCP55-141k, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gcctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

424. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP024887 (Escherichia coli strain AR_0017 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

425. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gcctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

426. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to MN334219 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm32 plasmid pSTM32_108, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

427. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to MN334220 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm37 plasmid pSTM37-118, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

428. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_AP018803 (Escherichia coli strain E2863 plasmid pE2863-1, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

429. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP040264 (Escherichia coli strain 631 plasmid pEc631_1, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

430. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP027600 (Escherichia coli strain 97-3250 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

431. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_LT985320 (Escherichia coli strain ECOR 3 genome assembly, plasmid: RCS85_pII) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

432. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP051702 (Escherichia coli strain SCU-125 plasmid pSCU-125-2, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

433. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP051720 (Escherichia coli strain SCU-116 plasmid pSCU-116-1, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

434. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP023387 (Escherichia coli strain 1190 plasmid p86, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

435. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

436. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NC_025138 (Escherichia coli plasmid pH2332-107, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

437. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP027324 (Escherichia coli strain 2013C-3033 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcgca	Protospacer
  ***.************* *******.*  .  .

438. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP013024 (Escherichia coli strain 2009C-3133 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

439. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

440. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to CP025926 (Escherichia coli strain 520873 plasmid p520873_84, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

441. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to CP025889 (Escherichia coli strain 503046 plasmid p503046_85, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

442. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

443. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to CP054380 (Escherichia coli strain SCU-175 plasmid pSCU-175-1, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

444. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_AP019762 (Escherichia coli O111:H- strain 110512 plasmid pO111-110512_1, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

445. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to MN335638 (Escherichia coli strain SFE199 plasmid pSFE199, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

446. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to MN335639 (Escherichia coli strain SFE059 plasmid pSFE059, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

447. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to MN335640 (Escherichia coli strain OT-ESBL-0589 plasmid pOT-ESBL-0589, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

448. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_AP018797 (Escherichia coli strain E2855 plasmid pE2855-1, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

449. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to CP027673 (Escherichia coli strain 2014C-3003 plasmid unnamed1) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

450. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to CP052260 (Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-2, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

451. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_CP019011 (Escherichia coli strain Ecol_AZ161 plasmid pECAZ161_1, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

452. spacer 2.6|231614|35|NC_017957|CRISPRCasFinder,CRT matches to NZ_MF156268 (Escherichia coli strain 3-S1R plasmid pCERC10, complete sequence) position: , mismatch: 11, identity: 0.686

cactggagcccggcgacgctcaaaaaaaccttcgg	CRISPR spacer
gtctgaagcccggcgacgcacaaaaaagcagcaca	Protospacer
  ***.************* *******.*  .  .

453. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.667

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atcgcagcgccgccgccctggaagcggaattgg	Protospacer
    ** ****** **************.    

454. spacer 2.8|231745|33|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 11, identity: 0.667

tggccatcgccgcggccctggaagcggagggcc	CRISPR spacer
atcgcagcgccgccgccctggaagcggaattgg	Protospacer
    ** ****** **************.    

455. spacer 2.11|231939|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 11, identity: 0.676

tggttggttgatgtcaggctgcatcaggggtctc	CRISPR spacer
gatgtggtcgatgacaggctgcatcaggctgagc	Protospacer
 .  ****.**** **************     *

456. spacer 2.11|231939|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 11, identity: 0.676

tggttggttgatgtcaggctgcatcaggggtctc	CRISPR spacer
gatgtggtcgatgacaggctgcatcaggctgagc	Protospacer
 .  ****.**** **************     *

457. spacer 2.11|231939|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 11, identity: 0.676

tggttggttgatgtcaggctgcatcaggggtctc	CRISPR spacer
gatgtggtcgatgacaggctgcatcaggctgagc	Protospacer
 .  ****.**** **************     *

458. spacer 2.11|231939|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 11, identity: 0.676

tggttggttgatgtcaggctgcatcaggggtctc	CRISPR spacer
gatgtggtcgatgacaggctgcatcaggctgagc	Protospacer
 .  ****.**** **************     *

459. spacer 2.11|231939|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 11, identity: 0.676

tggttggttgatgtcaggctgcatcaggggtctc	CRISPR spacer
gatgtggtcgatgacaggctgcatcaggctgagc	Protospacer
 .  ****.**** **************     *

460. spacer 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 11, identity: 0.676

gactcggacgcactggccgccgcggaggacaacc	CRISPR spacer
ccttcggaagcactggccgtcgcggagcttccgc	Protospacer
  .***** **********.*******  .   *

461. spacer 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 11, identity: 0.676

gactcggacgcactggccgccgcggaggacaacc	CRISPR spacer
ccttcggaagcactggccgtcgcggagcttccgc	Protospacer
  .***** **********.*******  .   *

462. spacer 2.16|232266|34|NC_017957|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 11, identity: 0.676

gactcggacgcactggccgccgcggaggacaacc	CRISPR spacer
ccttcggaagcactggccgtcgcggagcttccgc	Protospacer
  .***** **********.*******  .   *

463. spacer 1.4|143063|34|NC_017957|CRISPRCasFinder matches to MH910038 (Mycobacterium phage LeMond, complete genome) position: , mismatch: 12, identity: 0.647

agtcgcgcccacccgcacgccgaccgcggcgacg	CRISPR spacer
gacgatcggcaccagcacgacgaccgcggcgacc	Protospacer
... ..   **** ***** ************* 

464. spacer 1.4|143063|34|NC_017957|CRISPRCasFinder matches to MH910039 (Mycobacterium phage Oscar, complete genome) position: , mismatch: 12, identity: 0.647

agtcgcgcccacccgcacgccgaccgcggcgacg	CRISPR spacer
gacgatcggcaccagcacgacgaccgcggcgacc	Protospacer
... ..   **** ***** ************* 

465. spacer 1.4|143063|34|NC_017957|CRISPRCasFinder matches to MK376955 (Mycobacterium phage KiSi, complete genome) position: , mismatch: 12, identity: 0.647

agtcgcgcccacccgcacgccgaccgcggcgacg	CRISPR spacer
gacgatcggcaccagcacgacgaccgcggcgacc	Protospacer
... ..   **** ***** ************* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 338829 : 346645 10 Lake_Baikal_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_017956
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1621187 : 1683636 60 uncultured_Mediterranean_phage(37.5%) bacteriocin,protease,tRNA,transposase NA
DBSCAN-SWA_2 1704648 : 1711802 8 uncultured_Mediterranean_phage(71.43%) tRNA NA
DBSCAN-SWA_3 2007134 : 2014069 8 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_4 2637248 : 2654558 15 Pseudomonas_phage(22.22%) NA NA
DBSCAN-SWA_5 3906636 : 3916603 11 Moraxella_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_017966
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017966_1 187314-187423 Orphan I-C
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017966_2 340587-340659 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017966_3 687250-687435 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017966.1 45293-45319 0 1.0
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017958.1 303673-303699 1 0.963
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017966.1 47771-47797 2 0.926
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017966.1 257466-257492 2 0.926

1. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to position: 45293-45319, mismatch: 0, identity: 1.0

gccgcccggcgagggactaacagactc	CRISPR spacer
gccgcccggcgagggactaacagactc	Protospacer
***************************

2. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to position: 303673-303699, mismatch: 1, identity: 0.963

gccgcccggcgagggactaacagactc	CRISPR spacer
gccgcccggcgagggactgacagactc	Protospacer
******************.********

3. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to position: 47771-47797, mismatch: 2, identity: 0.926

gccgcccggcgagggactaacagactc	CRISPR spacer
gccgcccggcgagggtcaaacagactc	Protospacer
*************** * *********

4. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to position: 257466-257492, mismatch: 2, identity: 0.926

gccgcccggcgagggactaacagactc	CRISPR spacer
gccgcccggcgagggtcgaacagactc	Protospacer
*************** * *********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017966_1 1.1|187353|32|NC_017966|CRISPRCasFinder 187353-187384 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 187353-187384 0 1.0
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 45293-45319 0 1.0
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 340610-340636 0 1.0
NC_017966_3 3.2|687381|31|NC_017966|PILER-CR 687381-687411 31 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 687376-687406 0 1.0
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 543268-543294 1 0.963
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 303673-303699 1 0.963
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 47771-47797 2 0.926
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 257466-257492 2 0.926
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 306092-306118 2 0.926
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 45231-45257 3 0.889
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 340660-340686 3 0.889
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 303701-303727 3 0.889
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 530626-530652 3 0.889
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 303423-303449 4 0.852
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 253420-253446 4 0.852
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 253486-253512 4 0.852
NC_017966_1 1.1|187353|32|NC_017966|CRISPRCasFinder 187353-187384 32 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 481927-481958 6 0.812
NC_017966_1 1.1|187353|32|NC_017966|CRISPRCasFinder 187353-187384 32 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 302626-302657 6 0.812
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 45107-45133 6 0.778
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NZ_AP018829 Asticcacaulis excentricus strain M6 plasmid pASEM-1, complete sequence 32976-33002 6 0.778
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 501771-501797 7 0.741
NC_017966_2 2.1|340610|27|NC_017966|CRISPRCasFinder 340610-340636 27 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 994905-994931 7 0.741
NC_017966_3 3.2|687381|31|NC_017966|PILER-CR 687381-687411 31 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 736360-736390 7 0.774
NC_017966_3 3.2|687381|31|NC_017966|PILER-CR 687381-687411 31 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 735909-735939 7 0.774
NC_017966_1 1.1|187353|32|NC_017966|CRISPRCasFinder 187353-187384 32 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 1538601-1538632 8 0.75
NC_017966_1 1.1|187353|32|NC_017966|CRISPRCasFinder 187353-187384 32 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 1354807-1354838 8 0.75
NC_017966_3 3.2|687381|31|NC_017966|PILER-CR 687381-687411 31 NZ_CP053711 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed4, complete sequence 210506-210536 9 0.71
NC_017966_3 3.2|687381|31|NC_017966|PILER-CR 687381-687411 31 NZ_CP020927 Sphingobium yanoikuyae strain SHJ plasmid pSES189, complete sequence 138744-138774 10 0.677
NC_017966_3 3.2|687381|31|NC_017966|PILER-CR 687381-687411 31 NZ_AP018520 Sphingobium sp. YG1 plasmid pYGP1, complete sequence 164126-164156 10 0.677
NC_017966_3 3.2|687381|31|NC_017966|PILER-CR 687381-687411 31 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 169977-170007 10 0.677
NC_017966_3 3.1|687279|73|NC_017966|PILER-CR 687279-687351 73 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 687274-687346 13 0.822

1. spacer 1.1|187353|32|NC_017966|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 0, identity: 1.0

gtcaatgatcggcgagccctggcgaaggctcc	CRISPR spacer
gtcaatgatcggcgagccctggcgaaggctcc	Protospacer
********************************

2. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 0, identity: 1.0

gccgcccggcgagggactaacagactc	CRISPR spacer
gccgcccggcgagggactaacagactc	Protospacer
***************************

3. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 0, identity: 1.0

gccgcccggcgagggactaacagactc	CRISPR spacer
gccgcccggcgagggactaacagactc	Protospacer
***************************

4. spacer 3.2|687381|31|NC_017966|PILER-CR matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgcggccattgccacagacgccggtcttgt	CRISPR spacer
ccgcggccattgccacagacgccggtcttgt	Protospacer
*******************************

5. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 1, identity: 0.963

gccgcccggcgagggactaacagactc	CRISPR spacer
cccgcccggcgagggactaacagactc	Protospacer
 **************************

6. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 1, identity: 0.963

gccgcccggcgagggactaacagactc	CRISPR spacer
gccgcccggcgagggactgacagactc	Protospacer
******************.********

7. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 2, identity: 0.926

gccgcccggcgagggactaacagactc	CRISPR spacer
gccgcccggcgagggtcaaacagactc	Protospacer
*************** * *********

8. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 2, identity: 0.926

gccgcccggcgagggactaacagactc	CRISPR spacer
gccgcccggcgagggtcgaacagactc	Protospacer
*************** * *********

9. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 2, identity: 0.926

gccgcccggcgagggactaacagactc	CRISPR spacer
cccgcccggcgaggggctaacagactc	Protospacer
 **************.***********

10. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 3, identity: 0.889

gccgcccggcgagggactaacagactc	CRISPR spacer
accgcccggcgagggtcgaacagactc	Protospacer
.************** * *********

11. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 3, identity: 0.889

gccgcccggcgagggactaacagactc	CRISPR spacer
cccgcccggcgagggccaaacagactc	Protospacer
 ************** * *********

12. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 3, identity: 0.889

gccgcccggcgagggactaacagactc	CRISPR spacer
cccgcccggcgagggactaacagccta	Protospacer
 ********************** ** 

13. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 3, identity: 0.889

gccgcccggcgagggactaacagactc	CRISPR spacer
cccgcccggcgagggactaaaggactc	Protospacer
 ******************* .*****

14. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 4, identity: 0.852

gccgcccggcgagggactaacagactc	CRISPR spacer
cccgcccggcgagggactaacaaacct	Protospacer
 *********************.**..

15. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 4, identity: 0.852

gccgcccggcgagggactaacagactc	CRISPR spacer
cccgcccggcgagggactgacaaaccc	Protospacer
 *****************.***.**.*

16. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 4, identity: 0.852

gccgcccggcgagggactaacagactc	CRISPR spacer
cccgcccggcgagggactgacaaaccc	Protospacer
 *****************.***.**.*

17. spacer 1.1|187353|32|NC_017966|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.812

-gtcaatgatcggcgagccctggcgaaggctcc	CRISPR spacer
cgccga-gatcgacgagccctggcgcaggcttc	Protospacer
 *.*.* *****.************ *****.*

18. spacer 1.1|187353|32|NC_017966|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.812

-gtcaatgatcggcgagccctggcgaaggctcc	CRISPR spacer
cgccga-gatcgacgagccctggcgcaggcttc	Protospacer
 *.*.* *****.************ *****.*

19. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 6, identity: 0.778

gccgcccggcgagggactaacagactc	CRISPR spacer
cccgcccggcgagggaccaacaaaaaa	Protospacer
 ****************.****.*   

20. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NZ_AP018829 (Asticcacaulis excentricus strain M6 plasmid pASEM-1, complete sequence) position: , mismatch: 6, identity: 0.778

gccgcccggcgagggactaacagactc	CRISPR spacer
accgcccggcgagggactaaaaaatct	Protospacer
.******************* *.*...

21. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.741

gccgcccggcgagggactaacagactc	CRISPR spacer
cccgcccggcgagggactaaataaaag	Protospacer
 *******************  .*   

22. spacer 2.1|340610|27|NC_017966|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.741

gccgcccggcgagggactaacagactc	CRISPR spacer
cccgcccggcgagggactaaaaagact	Protospacer
 ******************* *.. ..

23. spacer 3.2|687381|31|NC_017966|PILER-CR matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 7, identity: 0.774

ccgcggccattgccacagacgccggtcttgt	CRISPR spacer
ctcctgccattgccgcagacgccgggctcgc	Protospacer
*. * *********.********** **.*.

24. spacer 3.2|687381|31|NC_017966|PILER-CR matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 7, identity: 0.774

ccgcggccattgccacagacgccggtcttgt	CRISPR spacer
ctcctgccattgccgcagacgccgggctcgc	Protospacer
*. * *********.********** **.*.

25. spacer 1.1|187353|32|NC_017966|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.75

--gtcaatgatcggcgagccctggcgaaggctcc	CRISPR spacer
aggccg--gatcggcgagacctggcgaacgcagc	Protospacer
  *.*.  ********** ********* **  *

26. spacer 1.1|187353|32|NC_017966|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 8, identity: 0.75

--gtcaatgatcggcgagccctggcgaaggctcc	CRISPR spacer
aggccg--gatcggcgagacctggcgaacgcagc	Protospacer
  *.*.  ********** ********* **  *

27. spacer 3.2|687381|31|NC_017966|PILER-CR matches to NZ_CP053711 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.71

ccgcggccattgccacagacgccggtcttgt	CRISPR spacer
gccgagccattgcaccagacgccggtctgac	Protospacer
 *  .********  ************* ..

28. spacer 3.2|687381|31|NC_017966|PILER-CR matches to NZ_CP020927 (Sphingobium yanoikuyae strain SHJ plasmid pSES189, complete sequence) position: , mismatch: 10, identity: 0.677

ccgcggccattgccacagacgccggtcttgt	CRISPR spacer
gtagaaccattgccccagacgccgctcttcg	Protospacer
 .. ..******** ********* ****  

29. spacer 3.2|687381|31|NC_017966|PILER-CR matches to NZ_AP018520 (Sphingobium sp. YG1 plasmid pYGP1, complete sequence) position: , mismatch: 10, identity: 0.677

ccgcggccattgccacagacgccggtcttgt	CRISPR spacer
gtagaaccattgccccagacgccgctcttcg	Protospacer
 .. ..******** ********* ****  

30. spacer 3.2|687381|31|NC_017966|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 10, identity: 0.677

ccgcggccattgccacagacgccggtcttgt	CRISPR spacer
tgctggcgattgccgcagacgccggtcgacg	Protospacer
.  .*** ******.************    

31. spacer 3.1|687279|73|NC_017966|PILER-CR matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 13, identity: 0.822

tggctgtaggcgacgacggtggtgttcgcgatcggataggtggcggaactggtgccgttg	CRISPR spacer
tggctgtaggcgacgacggtggtgttcgcgatcggataggtggcggaactggtgccgttg	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1203 : 16723 19 Vibrio_phage(14.29%) plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage