Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013828 Hungateiclostridium thermocellum AD2 chromosome, complete genome 5 crisprs WYL,cas8b1,cas6,csx1,cas10,csm3gr7,csx10gr5,csx19,cas2,cas4,cas3,csa3,DEDDh,DinG,csm2gr11,cas1,cas5,cas7 0 8 5 0

Results visualization

1. NZ_CP013828
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013828_1 881812-882001 TypeI ?
2 spacers
csx1,csm3gr7,csx19,csx10gr5,cas10,cas2,cas4

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013828_2 979303-984692 Orphan NA
80 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013828_3 1918540-1920316 Unclear NA
26 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013828_4 1933649-1936892 Unclear NA
48 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013828_5 3473346-3475182 TypeI-B NA
27 spacers
cas2,cas1,cas4,cas3,cas5,cas7,cas8b1,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013828_2 2.32|981411|36|NZ_CP013828|CRISPRCasFinder,CRT,PILER-CR 981411-981446 36 NZ_CP048423 Sphingomonas insulae strain KCTC 12872 plasmid unnamed4, complete sequence 7989-8024 7 0.806
NZ_CP013828_3 3.24|1920114|39|NZ_CP013828|CRISPRCasFinder,CRT 1920114-1920152 39 MT330372 Cronobacter phage JC01, complete genome 8028-8066 7 0.821
NZ_CP013828_4 4.16|1934690|36|NZ_CP013828|CRISPRCasFinder,CRT 1934690-1934725 36 NZ_KT020842 Clostridium perfringens strain JP838 plasmid pJP838B, complete sequence 16212-16247 7 0.806
NZ_CP013828_4 4.64|1934691|36|NZ_CP013828|PILER-CR 1934691-1934726 36 NZ_KT020842 Clostridium perfringens strain JP838 plasmid pJP838B, complete sequence 16212-16247 7 0.806
NZ_CP013828_3 3.47|1920114|40|NZ_CP013828|PILER-CR 1920114-1920153 40 MT330372 Cronobacter phage JC01, complete genome 8027-8066 8 0.8
NZ_CP013828_2 2.52|982753|36|NZ_CP013828|CRISPRCasFinder,CRT,PILER-CR 982753-982788 36 NC_015511 Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY01, complete sequence 123093-123128 9 0.75
NZ_CP013828_4 4.27|1935425|37|NZ_CP013828|CRISPRCasFinder,CRT 1935425-1935461 37 NC_010929 Agrobacterium tumefaciens Ti plasmid pTiBo542, complete sequence 26866-26902 12 0.676
NZ_CP013828_4 4.27|1935425|37|NZ_CP013828|CRISPRCasFinder,CRT 1935425-1935461 37 NZ_KY000026 Agrobacterium genomosp. 6 strain CFBP1873 plasmid pTi_CFBP1873, complete sequence 26868-26904 12 0.676
NZ_CP013828_4 4.75|1935426|37|NZ_CP013828|PILER-CR 1935426-1935462 37 NC_010929 Agrobacterium tumefaciens Ti plasmid pTiBo542, complete sequence 26866-26902 12 0.676
NZ_CP013828_4 4.75|1935426|37|NZ_CP013828|PILER-CR 1935426-1935462 37 NZ_KY000026 Agrobacterium genomosp. 6 strain CFBP1873 plasmid pTi_CFBP1873, complete sequence 26868-26904 12 0.676

1. spacer 2.32|981411|36|NZ_CP013828|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048423 (Sphingomonas insulae strain KCTC 12872 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.806

ccgcca-gctccggacggaagcgaggcaacggcggaa	CRISPR spacer
-ggcgacgctgcggacggaagcggggcaacggcgaac	Protospacer
  ** * *** ************.**********.* 

2. spacer 3.24|1920114|39|NZ_CP013828|CRISPRCasFinder,CRT matches to MT330372 (Cronobacter phage JC01, complete genome) position: , mismatch: 7, identity: 0.821

ctagacagtcacgcgcgattgcctgtacaatgttttcaa	CRISPR spacer
ccagcacgtcacgcgcgatagcctgtacgatgttttcca	Protospacer
*.**   ************ ********.******** *

3. spacer 4.16|1934690|36|NZ_CP013828|CRISPRCasFinder,CRT matches to NZ_KT020842 (Clostridium perfringens strain JP838 plasmid pJP838B, complete sequence) position: , mismatch: 7, identity: 0.806

-gtggtacgttctgccataccatttagccttatactc	CRISPR spacer
aacagtat-ttcttccataccatttagccttatattc	Protospacer
 ...***. **** ********************.**

4. spacer 4.64|1934691|36|NZ_CP013828|PILER-CR matches to NZ_KT020842 (Clostridium perfringens strain JP838 plasmid pJP838B, complete sequence) position: , mismatch: 7, identity: 0.806

-gtggtacgttctgccataccatttagccttatactc	CRISPR spacer
aacagtat-ttcttccataccatttagccttatattc	Protospacer
 ...***. **** ********************.**

5. spacer 3.47|1920114|40|NZ_CP013828|PILER-CR matches to MT330372 (Cronobacter phage JC01, complete genome) position: , mismatch: 8, identity: 0.8

ctagacagtcacgcgcgattgcctgtacaatgttttcaaa	CRISPR spacer
ccagcacgtcacgcgcgatagcctgtacgatgttttccac	Protospacer
*.**   ************ ********.******** * 

6. spacer 2.52|982753|36|NZ_CP013828|CRISPRCasFinder,CRT,PILER-CR matches to NC_015511 (Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY01, complete sequence) position: , mismatch: 9, identity: 0.75

tatagtagatgcagaagaagccttgcaggaaatact	CRISPR spacer
gttgggcattgccgaagaagtcttgcaggaaatact	Protospacer
  *.*  . *** *******.***************

7. spacer 4.27|1935425|37|NZ_CP013828|CRISPRCasFinder,CRT matches to NC_010929 (Agrobacterium tumefaciens Ti plasmid pTiBo542, complete sequence) position: , mismatch: 12, identity: 0.676

ttggtcaaggtgttgacgaggacaaagacaaaattgg	CRISPR spacer
tcggtcaagatgttgacgaggacaacgaaggtcgcaa	Protospacer
*.*******.*************** ** ..   ...

8. spacer 4.27|1935425|37|NZ_CP013828|CRISPRCasFinder,CRT matches to NZ_KY000026 (Agrobacterium genomosp. 6 strain CFBP1873 plasmid pTi_CFBP1873, complete sequence) position: , mismatch: 12, identity: 0.676

ttggtcaaggtgttgacgaggacaaagacaaaattgg	CRISPR spacer
tcggtcaagatgttgacgaggacaacgaaggtcgcaa	Protospacer
*.*******.*************** ** ..   ...

9. spacer 4.75|1935426|37|NZ_CP013828|PILER-CR matches to NC_010929 (Agrobacterium tumefaciens Ti plasmid pTiBo542, complete sequence) position: , mismatch: 12, identity: 0.676

ttggtcaaggtgttgacgaggacaaagacaaaattgg	CRISPR spacer
tcggtcaagatgttgacgaggacaacgaaggtcgcaa	Protospacer
*.*******.*************** ** ..   ...

10. spacer 4.75|1935426|37|NZ_CP013828|PILER-CR matches to NZ_KY000026 (Agrobacterium genomosp. 6 strain CFBP1873 plasmid pTi_CFBP1873, complete sequence) position: , mismatch: 12, identity: 0.676

ttggtcaaggtgttgacgaggacaaagacaaaattgg	CRISPR spacer
tcggtcaagatgttgacgaggacaacgaaggtcgcaa	Protospacer
*.*******.*************** ** ..   ...

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 884055 : 956515 59 uncultured_virus(20.0%) transposase NA
DBSCAN-SWA_2 1181541 : 1190964 8 Prochlorococcus_phage(28.57%) NA NA
DBSCAN-SWA_3 2182630 : 2245116 52 Corynebacterium_phage(11.11%) transposase,protease,tRNA NA
DBSCAN-SWA_4 2789256 : 2867569 78 Erysipelothrix_phage(69.23%) head,holin,transposase,tail,portal,tRNA,capsid,protease,terminase NA
DBSCAN-SWA_5 3104772 : 3144181 32 Enterobacteria_phage(40.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage